Protocol for generation of mutants in Salmonella using lambda red
recombination method
The following protocol is based upon plasmids pKD13mod, pKD46 and pCP20.
1. Design primers 60bp in length to amplify a Kanamycin cassette from pKD13mod
with flanking DNA to the gene targeted for deletion as follows:
For the forward primer (RF1), select 40bp from ATG backwards, then add 20bp
from vector backbone (ATTCCGGGGATCCGTCGACC).
For the reverse primer (RR1), select 24bp from the last nucleotide (stop codon) of
gene inwards and 16bp after stop codon (downstream of gene). Reverse
complement this sequence, then add 20bp of reverse-complemented vector
backbone sequence (GTGTAGGCTGGAGCTGCTCC).
2. Set up PCR as follows:
10X PCR buffer
10 mM dNTPs
10 M RF1
10 M RR1
Taq
pKD13mod
Water
Total reaction volume
10.0 L
3.5 L
3.0 L
3.0 L
1.5 L
2.0 L (100ng)
77.0 L
100.0 L
Stage 1:
95C for 5 min
Stage 2 (X30): 95C for 0.5 min
60C for 0.5 min
72C for 3 min
Stage 3:
72C for 5 min
3. Verify the PCR reaction by loading 5L on a gel.
4. Add 1ul of DpnI (20U/L) to the remaining PCR product and incubate for 1 hr at
37C (DpnI cuts methylated DNA not PCR DNA. This eliminates the pKD13mod
vector from subsequent steps).
5. Purify the PCR DNA using the Qiagen kit and elute in 30L elution buffer.
6. Grow Salmonella harboring pKD46 in LB + Carb100 at 30C O/N. (pKD46 has a
temperature sensitive replicon and the  red genes express from an arabinose
inducible promoter. Growth at 37C causes plasmid instability). On the following
day, dilute 1:100 in 25mL of LB + Carb100, add arabinose (final concentration of
0.1M) and grow at 30C for 4 hrs. Wash cells 4 times in ice-cold water and
resuspend in residual liquid. Transfer 80L to ice-cold electroporation cuvettes
and add about 800ng of corresponding PCR product. Leave on ice for 5 min.
Electroporate and add 350L of SOC. Transfer to tube and shake for 1 hour at
30C. Then centrifuge cells, discard supernatant and resuspend pellet to a final
volume of 100L. Spread cells on LB-Kan60 plates and incubate O/N at 37C.
7. Design primers to confirm that Kan gene has replaced the gene of interest:
For the forward primer (DF1), select 20 or 21bp upstream of the gene that’s been
deleted (not too close to gene sequence).
For the reverse primer, use K1 that binds to the Kan marker.
(K1: CAGTCATAGCCGAATAGCCT is a reverse primer that anneals to the start
of the Kan marker)
8. Next day, pick at least 2 colonies from the LB-Kan60 plate and resuspend in
100L of water. Do colony PCR as follows:
10X PCR buffer
10 mM dNTPs
10 M DF1
10 M K1
Taq
Resuspended colony
Water
Total reaction volume
10.0 L
3.5 L
3.0 L
3.0 L
1.5 L
1.0 L
78.0 L
100.0 L
Stage 1:
95C for 5 min
Stage 2 (X30): 95C for 0.5 min
50C for 0.5 min
72C for 3 min
Stage 3:
72C for 5 min
9. Take 2L of the resuspended colony and spot it on LB-Kan60 plate and
incubate plate at 43C O/N to ensure loss of pKD46.
10. Run PCR on a gel (product should be ~500bp).
11. Restreak PCR-positive colony from step 9 on LB-Kan60 plate 2 times over 2
days. On the final day, streak on both LB-Kan60 and LB-Carb100 plate.
Repeat till no growth is seen on LB-Carb100 plate. Make freezer stock.
12. Inoculate colony from previous step in LB + Kan60 and grow at 37C O/N.
On the following day, take 5mL of LB + Kan60, then add 0. 05mL of the O/N
culture and incubate at 37C for 3 hours. Wash cells 4 times in ice-cold water
and resuspend in residual liquid. Transfer 80L to ice-cold electroporation
cuvette and add 100ng of pCP20. Leave on ice for 5 mins. Electroporate and
add 350L of SOC. Transfer to tube and shake for 1 hour at 30C. Then
centrifuge cells, discard supernatant and resuspend pellet to a final volume of
100L. Spread cells on LB-Carb100 plate and incubate for 2 days at 30C.
13. To confirm deletion of gene, do colony PCR using DF1 and DR1 (DR1 is
reverse primer obtained by selecting 20 or 21 bp downstream of the gene
that’s been deleted (not too close to gene sequence) and reverse
complemented). Pick at least 2 colonies from the previous step and resuspend
in 100L of water. Do colony PCR as follows:
10X PCR buffer
10 mM dNTPs
10 M DF1
10 M DR1
Taq
Resuspended colony
Water
Total reaction volume
10.0 L
3.5 L
3.0 L
3.0 L
1.5 L
1.0 L
78.0 L
100.0 L
Stage 1:
95C for 5 min
Stage 2 (X30): 95C for 0.5 min
50C for 0.5 min
72C for 3 min
Stage 3:
72C for 5 min
14. Take 2L of the resuspended colony and spot it on LB plate and incubate at
43C O/N. Run PCR from previous step on a gel (PCR product should be
~500bp). If product of the right size is seen, purify the product using Qiagen
kit then confirm deletion by DNA sequencing.
15. Restreak colonies from previous step on LB plate, 3 times over 3 days. On the
final day, streak on both LB and LB-Carb100 plates. Repeat till no growth is
seen on LB-Carb100. Make freezer stock.