Microbiology Test 2 Review Questions – Spring 2015
1. Be able to define/be familiar with the terms assigned for your RAPs.
2. Be able to describe how changes in temperature effect microbial growth
rates, and why.
3. Be able to describe three different microbial changes (to different cellular
molecules, for example membranes, proteins, etc.) that happen in response
to changes in temperature.
4. How do piezophiles change their membranes to live in high pressure?
5. What is aW and how does it affect microbial growth?
6. Be able to describe the roles of compatible solutes, pressure sensitive
channels and global stress responses in microbial salt tolerance.
7. Acidophiles live in environments with very high [H+]. Be able to discuss
three strategies that they use to do this.
8. Alkaliphiles live in environments with very low [H+] and very high [OH-].
Describe three different adaptations used to live in this type of environment.
9. Microbes use proton- and sodium gradients as sources of energy for a variety
of cellular processes. Describe three.
10. Be able to differentiate between the types of metabolism present in obligate
aerobes, microaerophiles, facultative anaerobes, aerotolerant anaerobes and
obligate anaerobes.
11. Compare and contrast microbial genomes with those typically seen in
eukaryotes with respect to size, shape, and structure.
12. What is a plasmid? What types of genes to plasmids tend to carry?
13. How do quinolone antibiotics work?
14. What is horizontal gene transfer?
15. Be able to discuss how operons and regulons help microbes respond rapidly
when their environment changes.
16. Be able to discuss all of the steps involved in transformation in
Streptococcus, paying particular attention to the role of quorum sensing in
the process.
17. What are sigma factors, and how are they involved in helping microbes to
respond quickly to environmental changes? Be able to give a specific
example of a sigma factor, what types of genes it regulates, and how it does
so.
18. How does transformation in Gram-negative microorganisms differ from that
in Gram-positive organisms (two ways)?
19. Be able to describe/draw all of the steps in conjugation. Know the functions
of TraI and the F plasmid.
20. What is an Hfr microbe, and how might it be involved in the transfer of
antibiotic resistance or pathogenicity genes from one cell or species to
another?
21. We used to think that transformation only occurred between members of the
same species. Give one specific example that shows that this is not true.
22. Be able to compare and contrast the mechanisms of generalized versus
specialized transduction.
23. What are attP, attB, attR and attL? How do the latter two form?
24. Horizontal gene transfer events, together with other evolutionary
mechanisms such as mutation, recombination and selection, have resulted in
the generation of large ‘genome islands’ that can be transported from one cell
to another. What types of genes can be found in these islands? (See the figure
on the last page of your notes).
25. Be able to distinguish between all of the metabolic types of microorganisms
that we discussed (fermentative, lithotrophs, organotrophs, phototrophs,
chemotrophs, autotrophs, heterotrophs).
26. A common theme running through this course is how microbes adapt rapidly
to the world around them. Be able to discuss how a facultative anaerobe that
is able to respire using either sulfate or nitrate as its final electron acceptor
would 1) decide which one to use and 2) adapt so that it could use that
acceptor. What types of molecules would need to be expressed?
27. How do standard reduction potentials relate to energy generation?
28. What is the difference between lithotrophy and anaerobic respiration?
29. Know the oxidized and reduced forms of nitrogen, sulfur, iron and carbon.
30. If the electron donor in an electron transport chain is more electropositive
than NADH, then what process must microbes use in order to reduce NAD+?
Why is NADH important to microbial survival?
31. What is methanogenesis? Where are the microbes that perform this process
typically found?
32. What is methanotrophy? How might it be involved in the recycling of deep
sea methane hydrates?
33. Be able to give the commands that you would use to do the following in a
Linux operating system:
a. Change directories (down one and back up one)
b. Get a list of the contents in a directory
c. Determine which directory you are currently working in
d. Start the MacQIIME program
34. Be able to describe how pyrosequencing works, including how a flash of light
is generated (chemically) when a particular base is added to the reaction.
35. What is the 16S rRNA gene, and why is this gene so valuable for metagenomic
analysis?
36. What are Phred scores? What does a Phred score of 20 mean? What does a
Phred score of 30 mean?
37. We ran the split_libraries.py program using the following commands:
split_libraries.py -m mapping_centralia.txt -f catfna -q catqual -b 11 -o
split_library_centralia_output
Explain each of the individual commands used above (what do -m, -f, -q, -b and o mean?)
38. In the following FASTA file, what would -b equal?
>HD4AU5D04IK2EL#AGACGCACTCAGT
AGACGCACTCAGAGTTTGATCATGGGCTCAGAATCAAACGCTGGCGGCGCGCTTAACACATG