SUPPLEMENTARY EXPERIMENTAL PROCEDURES.
Plasmid construction
DNA cloning, manipulation and analyses were all performed according to standard
procedures (Ausubel et al., 1993).
Construction of LhGR-N, -I, -C.
The ligand-binding domain of the glucocorticoid receptor (residues 508-795) (EMBL
accession number: M14053.Emrod) was amplified from pBIGR (Lloyd et al., 1994)
by polymerase chain reaction (PCR) using primers that introduced SpeI restriction
sites at each end (Forward primer: 5’-AGACTAGTGAAGCTCGAAAAACAAAG3’; reverse primer: 5’-GTACTAGTAGATTTTTGATGAAACAGAAG-3’; SpeI sites
underlined). To construct pKI-LhGR-I this fragment was inserted into the SpeI site
that separates the lac repressor and GAL4 domains of LhG4 in pKI-HisAGal4 (Moore
et al., 1998). To construct LhGR-N and –C, the LhG4 coding region was amplified by
PCR using primers L1 and L2 that introduced NheI sites immediately after the ATG
codon and before the stop codon of LhG4 as well as XhoI and SpeI sites upstream and
downstream
of
the
coding
region
respectively
(forward
primer:
5’-
ATCCTCGAGAACAATGGCTAGCAAACCGGTAACGTTATA-3’; reverse primer:
TCACTAGTCTAGCTAGCCTCTTTTTTTGGGTTTGGTG-3’;
restriction
sites
underlined). For LhGR-N, a fragment encoding the modified amino-terminus of LhG4
was obtained from this amplification product by digestion with XhoI, cloned in
pBluescript II SK (Stratagene; Basingstoke, UK; GenBank # X52328), and the
amplified GR LBD was then ligated as an SpeI fragment into its NheI site. The
modified XhoI fragment was reisolated and inserted between the XhoI sites of pKI-
HisA-Gal4 replacing the amino-terminal portion of the LhG4 coding region with a
fragment encoding the amino-terminal GR LBD fusion to produce pKI-LhGR-N. For
LhGR-C, a fragment encoding the modified carboxy-terminus of LhG4 was obtained
from the amplified LhG4 coding region by digestion with SpeI, cloned in pBluescript
SK II, and the amplified GR LBD was then ligated as an SpeI fragment into its NheI
site. The SpeI fragment was then reisolated and inserted at the SpeI site of pKI-HisAO
(Moore et al., 1998) to generate pKI-LhGR-C. All amplification products were
confirmed by sequencing. pKI-LhGR-N, -I, and –C were used for transient expression
in protoplasts. To construct plant transformation vectors, fragments encoding the
LhG4, LhGR-N, or LhGR-C coding regions flanked by CaMV 35S promoter and
polyadenylation signals were isolated from pKI-HisA-Gal4 (Moore et al., 1998), pKILhGR-N or –C as SphI fragments and cloned in the corresponding site of pUCAP
(van Engelen et al., 1995) from which a portion of the polylinker had previously been
deleted by digestion with HincII and Ecl136II and religation. This formed pdU-LhG4,
pdU-LhGR-N and pdU-LhGR-C. The expression cassettes were transferred from
these plasmids to pBINPLUS (van Engelen et al., 1995) using AscI and PacI to
produce pBIN-LhG4, pBIN-LhGR-N, and pBIN-LhGR-C. To construct pBIN-LhGRI, the amplified GR LBD was inserted into the unique SpeI site of pdU-LhG4 and the
resulting fusion was transferred to pBINPLUS using AscI and PacI.
Construction of pOp1-pOp6.
To generate a 52bp repeat carrying an ideal lac operator sequence (underlined) and an
XbaI site (double underlined) the following oligonucleotides were annealed:
NOP1:
5’CAAGAAATCTAGAAAGAAGAAAGGGAAGAGAAAGAATTGTGAGCGCTC
ACAATTGAAAGA3’.
NOP2:
5’CTAGTCTTTCAATTGTGAGCGCTCACAATTCTTTCTCTTCCCTTTCTTCTT
TCTAGATTTCTTGAGCT3’. The annealed sequence carried SacI and SpeI
compatible cohesive ends and was ligated into the corresponding sites of pBluescript
SK-II to generate pNOP1. The SacI-SpeI fragment was reisolated from this vector and
inserted into the compatible SacI and XbaI sites of the same vector to generate pNOP2
which carried a dimer of the 52bp repeat. This dimer was again isolated as a SacI-SpeI
fragment and inserted into the SacI and XbaI sites of pNOP2 to generate pNOP4 and
into the same sites of pNOP4 to generate pNOP6 which carried 4 and 6 copies of the
repeat respectively. The SacI and SpeI fragments from pNOP1 to pNOP6 were
inserted into the corresponding sites of pOp-GUS derivative pOpBK-GUS (Baroux et
al., 2004) replacing the original lac operator sequence of this plasmid and generating
pOp1-GUS to pOp6-GUS respectively. The position relative to the minimal promoter
of the most proximal operator in pOpBK-GUS and pOp1-GUS to pOp6-GUS is
identical.
Construction of pH-TOP and pV-TOP.
A fragment containing the 6 operator array was cut from pOp6-GUS with EcoRI and
Spe I and inserted into the same sites of pU-BOP (Samalova et al., submitted) to give
pU-6Op. The TMV  sequence was generated by PCR, using the pE6113-GUS
cassette (Mitsuhara et al., 1996) as a template with the following primers: For 5’GCG
TCT AGA CGC GCG TAT TTT TAC AAC AAT3’ and Rev 5’GCG CTC GAG
GTC GAC AAG CTT GCT AGC TGT AGT 3’. These primers introduced an XbaI
site upstream of the  sequence and NheI, HindII, SalI, and XhoI respectively,
downstream (underlining). The resulting fragment was digested with XbaI and XhoI
and ligated between the NheI and XhoI sites of pU-6Op to generate pU-6Op-The
GUS coding sequence and polyA was isolated from pRAP by digestion with XbaI and
HindIII and was then ligated between the NheI and HindIII sites of pU-6Op- to give
rise to pU-6Op--GUS. pRAP had been construced by ligating the pOp promoter as
an Ecl136II-HindIII fragment from pOp-GUS to the Ecl136II-XbaI sites of pUCAP
after rendering all ends blunt with Klenow fragment and then inserting the GUS
coding sequence and polyadenylation signal of pRT103 (Töpfer et al., 1987) as an
XhoI-HindIII fragment into the SalI-HindIII sites. The OCS polyadenylation signal
was excised from pBJ36 (Eshed et al., 2001) with NotI and XbaI and ligated into
pBluescript-SKII (Stratagene) digested with NotI and SpeI to give pSK-OCS. An
EcoRI/ BamHI fragment was isolated from pU-6Op- and inserted into the
corresponding sites of pSK-OCS to generate pSK-6Op--OCS. pGreen II 0129
(Hellens et al., 2000) was digested with KpnI and SalI and re-ligated in order to
eliminate KpnI, ApaI, XhoI and SalI restriction sites from the MCS, generating
pGreen  K/S. pGreen  K/S digested with HindIII and XbaI was ligated to a SpeI/
HindIII fragment from pU-6Op--GUS to give pGREEN-GUS. This was then
digested with PstI and HindIII, treated with Klenow fragment to eliminate these sites
generating pGREEN-GUSHP. Subsequently, the Ecl136 II fragment of pSK-6Op-OCS was ligated between the SacI and StuI sites of pGREEN-GUSHP to give rise to
pH-TOP clones -K and –M. The same Ecl136II fragment was also inserted into the
StuI site of pGREEN-GUSHP followed by digestion with with SacI and XbaI,
treatment with Klenow fragment, and re-ligation to give rise to pH-TOP clones -A
and -E (these differ from clones K and M only in the absence of SacI and XbaI sites
adjacent to the 6 operator array but are not known to differ in activity). To generate
pV-TOP, an EcoRI-BamHI fragment encoding the pOp6 promoter was isolated from
pU-6Op and inserted into the corresponding sites of pSK-OCS (see above). A SacI –
XbaI fragment containing the pOp6 promoter, polylinker, and OCS polyadenylation
signal was isolated from this plasmid and inserted upstream of the minimal promoter
in pOpBK-GUS (Moore et al., 1998) to give pV-TOP.
pOpBK-ipt, pOp6-ipt, and pH-ipt were all constructed as described in Samalova
et al. (submitted). pV-ipt was constructed by isolating the ipt coding region from pHipt as a SalI-SmaI fragment and inserting it into the SalI and Klenow-treated BamHI
sites of pV-TOP.
Transient expression
The transient expression protocol was adapted from previous procedures (Abel and
Theologis, 1994; Mass and Werr, 1989) for use with protoplasts derived from a
suspension culture of Arabidopsis thaliana Ler (gift of M. May, University of
Oxford). The suspension culture was maintained in a16 hour photoperiod as described
previously (May and Leaver, 1993) and was used for transformation 6 days after
subculturing 1:20. Cells from 25ml of culture were collected by centrifugation at 45xg
for 10 minutes then incubated in 30ml of plasmolysis solution (0.4M mannitol,
3%(w/v) sucrose, 8mM calcium chloride (pH 5.6-5.8).) at room temperature for 30
minutes. Cells were pelleted as before and resuspended in 40ml enzyme solution (1%
(w/v) cellulase, 0.25% (w/v) maceroenzyme, in plasmolysis solution (pH 5.6-5.8)) for
one hour without shaking, 30 minutes with gentle rocking and a further hour with no
agitation.
30ml of mannitol/W5 solution (0.4M mannitol, diluted 4:1 with W5
solution (5mM glucose, 154mM sodium chloride, 125mM potassium chloride, 1.5mM
MES, pH 5.6-5.8)) was added to each tube, mixed by rocking and centrifuged at 29 x
g for 10 minutes. The supernatant was removed and the two pellets combined in one
tube, washed twice with 30ml mannitol/Mg (0.4M mannitol, 0.1% MES, 15mM
magnesium chloride, pH 5.6-5.8) and resuspended in 5ml mannitol/Mg for use. For
transformation, 10g of reporter plasmid, 20g of each activator plasmid were used.
Plasmids were supplemented with 200g of sheared phenol/chloroform-extracted
herring sperm DNA, adjusted to 50 l and sterilised by votexing with 25l of
chloroform followed by centrifugation at 13,000 xg for 1 min before use. After
transformation, protoplasts were collected in 15ml polypropylene tubes and placed on
ice for 30 minutes to allow them to settle. The supernatant was replaced with 2ml
sucrose culture medium (0.4M sucrose, 250mgl-1 xylose, 1x MS salts pH 5.6-5.8) and
inducer. The tubes were incubated in the dark at 20C for approximately 36 hours.
For analysis of reporter activity, protoplasts were mixed with 6ml of mannitol/W5and
centrifuged at 3650xg for 10 minutes. The supernatant was removed and the pellet resuspended in 200l of GUS extraction buffer (50mM sodium phosphate buffer (pH
7.0), 10mM -mercaptoethanol, 10mM EDTA, 0.1% (v/v) sarcosyl, 0.1% (v/v) triton
x-100) and protein concentration was determined by Bradford assay (Bradford, 1976)
using Biorad Protein Assay Reagent (Biorad Ltd, Hemel Hempsted, UK) and a bovine
serum albumin standard in GUS assay buffer as a standard.