J Gen Plant Pathol (2011) 77:282–291
DOI 10.1007/s10327-011-0335-9
FUNGAL DISEASES
Quantitative nested real-time PCR detection of Verticillium
longisporum and V. dahliae in the soil of cabbage fields
Shinpei Banno • Hidenari Saito • Hiroshi Sakai •
Toshihiko Urushibara • Kentaro Ikeda •
Takeshi Kabe • Isao Kemmochi • Makoto Fujimura
Received: 18 March 2011 / Accepted: 28 July 2011 / Published online: 23 August 2011
Ó The Phytopathological Society of Japan and Springer 2011
Abstract Verticillium longisporum and V. dahliae, causal
agents of Verticillium wilt, are spreading through the
cabbage fields of Gunma Prefecture. Using the V. longisporum-specific intron within the 18S rDNA and differences between ITS 5.8S rDNA sequences in Japanese
isolates of V. longisporum and V. dahliae, we developed
three quantitative nested real-time (QNRT) PCR assays.
The QNRT-PCR quantification of V. longisporum or
V. dahliae in cabbage field soil was consistent with the
severity of Verticillium wilt disease in those fields. In field
trials of resistant cultivar YR Ranpo grown for three
The nucleotide sequence data reported here will appear in the DDBJ/
EMBL/GenBank databases under the accession numbers AB585937
and AB585938.
Electronic supplementary material The online version of this
article (doi:10.1007/s10327-011-0335-9) contains supplementary
material, which is available to authorized users.
S. Banno (&) H. Saito K. Ikeda M. Fujimura
Plant Regulation Research Center, Toyo University,
1-1-1 Izumino, Itakura, Ora, Gunma 374-0193, Japan
e-mail: banno@toyo.jp
S. Banno M. Fujimura
Faculty of Life Sciences, Toyo University,
1-1-1 Izumino, Itakura, Ora, Gunma 374-0193, Japan
H. Sakai T. Urushibara K. Ikeda T. Kabe I. Kemmochi
Gunma Agricultural Technology Center, 493 Nishi-Obokata,
Isesaki, Gunma 379-2224, Japan
H. Sakai I. Kemmochi
Gunma Prefectural Office, 1-1-1, Ote, Maebashi,
Gunma 371-8570, Japan
T. Urushibara T. Kabe
Agatsuma Agricultural Office in Gunma Prefecture,
664, Nakanojo, Nakanojo, Agatsuma, Gunma 377-0424, Japan
123
seasons in soil infested with the pathogen, disease severity
and pathogen density in the soil were significantly reduced
in a field moderately contaminated by V. dahliae, but only
slightly reduced in a highly contaminated field. These
results suggest that continuous cultivation of a resistant
cultivar is an effective way to reduce the pathogen population. QNRT-PCR assays provide a powerful analytical
tool to evaluate the soil population dynamics of V. longisporum and V. dahliae for disease management.
Keywords Verticillium longisporum qPCR Brassica
oleracea L. var. capitata Disease-resistant cultivar
Introduction
Verticillium wilt caused by soil-borne pathogens Verticillium dahliae, V. albo-atrum, V. longisporum, and V. tricorpus, is an economically important disease of many
kinds of plants (Klosterman et al. 2009; Sakai and Shiraishi
2003). Three species of Verticillium fungi, V. dahliae,
V. albo-atrum, and V. longisporum, are close molecular
phylogenetic relatives and form a cluster distinct from
V. tricorpus (Fahleson et al. 2004; Pantou et al. 2005),
although their host ranges differ. V. dahliae causes vascular
wilt in a vast number of crop plants, while the host ranges
of V. albo-atrum and V. longisporum are limited. The main
hosts of V. albo-atrum are hops, alfalfa, potato and tomato
(Barasubiye et al. 1995; Koike et al. 1997; Ligoxigakis
et al. 2002; Radišek et al. 2003; Tjamos 1981), and those of
V. longisporum include cruciferous plants such as oil seed
crops (Karapapa et al. 1997; Karapapa and Typas 2001).
In Tsumagoi, a highland area in Gunma Prefecture,
Japan, Verticillium wilt is the most serious disease of
cabbage crops (Brassica oleracea L. var. capitata).
J Gen Plant Pathol (2011) 77:282–291
Symptoms of vascular wilt were first found in 1993, and
the disease had spread widely in the Tsumagoi area by
2000 (Kemmochi et al. 1999, 2003; Kemmochi and Sakai
2004). Verticillium wilt in Tsumagoi cabbage crops is
caused by V. dahliae and V. longisporum (Sakai et al.
2001). Although the introduction of cultural control and
resistant cultivars prevent rapid expansion of Verticillium
wilt, newly contaminated fields are continuously reported,
and the disease potential remains high.
As rapid and convenient methods, polymerase chain
reaction (PCR) techniques are commonly used to detect
plant pathogens. The nucleotide sequences of the internal
transcribed spacer (ITS) regions surrounding the 5.8S
ribosomal DNA (rDNA) are used to specifically detect
many fungi including plant pathogens (Bryan et al. 1995;
Kageyama et al. 2003; Patzak 2005; Salazar et al. 2000;
Volossiouk et al. 1995). Various PCR primers to detect
Verticillium species have been designed for this region or
other species-specific nucleotide sequences (Kageyama
et al. 2003; Koike et al. 1997; Li et al. 1994, 1999; Nazar
et al. 1991; Usami et al. 2002, 2005, 2007; Volossiouk
et al. 1995). In addition, with the introduction of real-time
PCR technology, the amount of specific nucleic acids in a
sample can be determined. Several real-time PCR assays
have been reported for detection and quantification of
Verticillium pathogens, most often for quantification of
Verticillium DNA in inoculated plants used for selecting
Verticillium wilt-resistant cultivars (Atallah et al. 2007;
Gayoso et al. 2007; Larsen et al. 2007; Lievens et al. 2006).
Quantification of soil-borne pathogens in soil samples is
also very important for disease management.
Despite progress in the development of PCR methods
for detection and quantification of plant pathogenic fungi,
however, there are few reports of real-time PCR quantification of V. dahliae and V. longisporum DNA in field soil
(Lievens et al. 2006). Nested PCR with high sensitivity and
specificity has been used to detect V. dahliae in field soil
(Kuchta et al. 2008; Pérez-Artés et al. 2005; Volossiouk
et al. 1995). Although quantitative nested real-time
(QNRT) PCR, a combination of nested PCR and real-time
PCR, is a relatively familiar technology in medicine
(Halliday et al. 2005; Takahashi et al. 2007), few have
reported its use to detect soil-borne plant pathogens.
The aim of this work was to develop quantitative PCR
assays to estimate the risk of Verticillium wilt in cabbage
fields. We constructed QNRT-PCR assays to detect the
DNA of Verticillium pathogens in the soil of cabbage fields.
In all examined soils, the QNRT-PCR quantification of the
pathogen DNA was correlated with disease severity. Furthermore, we carried out two field trials on the suppression
of Verticillium wilt by continuous planting of a resistant
cultivar and another field trial to assess Verticillium wilt
risk before planting. These results suggested that sensitive
283
and reliable monitoring of soil pathogens by QNRT-PCR
will be useful in developing new disease control techniques.
Materials and methods
Strains
Seven Verticillium strains (Table S1) were used to design
QNRT-PCR assays to detect Verticillium fungi in soils.
Two strains, CA9 (V. longisporum) and CA39 (V. dahliae),
were previously isolated from cabbage fields in Gunma
Prefecture by Sakai et al. (1998). In addition, 44 field
isolates of Verticillium wilt fungus were collected from 20
cabbage fields in four areas of Tsumagoi, Gunma Prefecture in 2008. The Verticillium isolates were maintained on
potato dextrose agar (PDA) after single-conidium isolation.
DNA extraction
Verticillium isolates were cultured on cellophane sheets on
PDA at 18°C for 7 days. Mycelia were harvested and
homogenized with a bead beater (FastPrep; MP Biomedicals, Irvine, CA, USA) for 30 s in lysis buffer [10 mmol/L
Tris–HCl (pH 8.0), 0.1 mol/L EDTA, and 0.5% (w/v)
sodium dodecyl sulfate] and 0.4 g glass beads (1.0 mm
diameter). The sample was incubated at 65°C for 30 min.
Genomic DNA was isolated by phenol extraction and
isopropanol precipitation, then was used as a template for
PCR and sequencing.
Total DNA from soil samples was extracted from 0.4 g
soil with a FastDNA Spin Kit for soil (MP Biomedicals)
according to the manufacturer’s instructions, with modifications. Skim milk (Merck, Darmstadt, Germany) was
added to the soil sample (150 mg/g soil mass) to improve
the efficacy of DNA extraction, and the soil sample was
homogenized with a bead beater for 30 s at 5.5 m/s. The
extracted DNA was dissolved in 80 lL DES (DNase/
Pyrogen Free Water) and used for QNRT-PCR.
PCR amplification
PCR was performed in a 50 lL reaction volume containing
0.2 lmol/L each primer, 2.5 units DNA polymerase
(BIOTAQ DNA Polymerase; Bioline, London, UK),
0.3 mmol/L dNTPs (dATP, dCTP, dGTP, and dTTP), and
reaction buffer [containing 67 mmol/L Tris–HCl (pH 8.8),
16 mmol/L (NH4)2SO4, 2.5 mmol/L MgCl2, and 0.01%
stabilizer] in a 2720 thermal cycler (Applied Biosystems,
Foster, CA, USA). The oligonucleotide primers to detect
V. longisporum and V. dahliae are provided in Table 1. PCR
amplification employed four primer pairs, VlspF2 plus
VdspR2, VlspF1 plus VlspR4, VaF1 plus VaR1, and VdF1
123
284
J Gen Plant Pathol (2011) 77:282–291
Table 1 Oligonucleotide primers
Primer
Region
Sequence (50 ? 30 )
Nucleotide position
References
ITS5
18S
GGAAGTAAAAGTCGTAACAAGG
–
White et al. (1990)
ITS4
28S
TCCTCCGCTTATTGATATGC
–
White et al. (1990)
VaF1
50 -ITS
CCGCCGGTACATCAGTCTCTTTA
64–86a
This study
VdF1
50 -ITS
CCGCCGGTCCATCAGTCTCTCTG
70–92b
This study
VaR1
3 -ITS
GGGACTCCGATGCGAGCTGTAAT
403–381a
This study
VdR1
30 -ITS
GGGACTCCGATGCGAGCTGTAAC
409–387b
This study
VlspF2
18S intron
CTCTGAATTCACGGCATCTGCCTC
589–612c
This study
VdspR2
18S
GGCGTACTACCGGGGTAATACGGA
1978–1955d
This study
VlspF1
18S intron
AGCCTGAGTCACGAGAGATATGGG
661–684c
This study
c
This study
VlspR4
a
0
18S intron
CAAACCACGCCACTGCATTCTCGT
935–912
Accession AB585937 (5.8S rDNA-ITS of Verticillium longisporum CA9)
b
Accession EU627007 (5.8S rDNA-ITS of V. dahliae)
c
Accession AB585938 (the group I intron in the 18S rDNA gene of V. longisporum CA9)
d
Accession AF104926 (18S rDNA of V. dahliae)
plus VdR1, with an initial denaturation step (95°C for 3 min)
followed by 35 cycles of amplification (94°C for 1 min, 56°C
for 20 s, 72°C for 30 s) and final extension (72°C for 5 min).
PCR amplification with the ITS5 and ITS4 primers comprised an initial denaturation step (95°C for 3 min) followed
by 35 cycles of amplification (94°C for 1 min, 50°C for 30 s,
72°C for 1 min) and final extension (72°C for 5 min).
Quantitative nested real-time PCR
We used nested real-time PCR to detect Verticillium spp. in
soils. First-round PCR was performed in the 2720 thermal
cycler to amplify a wide region of interest from DNA
extracted from soil. The second PCR targeted an internal
region within the first PCR product and was performed
using a real-time PCR instrument (LightCycler 480; Roche
Applied Science, Penzberg, Upper Bavaria, Germany).
The first PCR amplification was performed in a 50 lL
reaction mixture containing 0.1 lL of soil-extracted DNA,
0.2 lmol/L each primer, 2.5 units DNA polymerase
(BIOTAQ DNA Polymerase; Bioline, London, UK),
0.3 mmol/L dNTPs (dATP, dCTP, dGTP, and dTTP),
reaction buffer (containing 67 mmol/L Tris–HCl (pH 8.8),
16 mmol/L (NH4)2SO4, 2.5 mmol/L MgCl2, and 0.01%
stabilizer). The first PCR to amplify the 18S rDNA intron
with primers VlspF2 and VdspR2 (Figs. 1a, S1; Table 1)
comprised an initial denaturation step (95°C for 3 min)
followed by 20 cycles of amplification (94°C for 1 min,
56°C for 20 s, 72°C for 30 s), then a final extension (72°C
for 5 min). The first PCR amplification of ITS 5.8S rDNA
with primers ITS5 and ITS4 (Fig. 1a; Table 1) comprised
an initial denaturation step (95°C for 3 min) followed by
20 cycles of amplification (94°C for 1 min, 50°C for 30 s,
72°C for 1 min) and final extension (72°C for 5 min).
123
The second-round amplification and the product detection were performed with a real-time PCR instrument
(LightCycler 480; Roche Applied Science) using SYBR
Green I. Primer pairs VaF1 and VaR1 or VdF1 and VdR1
were used to amplify 5.8S rDNA; primers VlspF1 and
VlspR4 were used to amplify the 18S rDNA intron
(Figs. 1a, S1, S2; Table 1). The real-time PCR amplifications were performed in 20 lL reaction volumes containing 5 lL of the first PCR product diluted 50-fold,
0.5 lmol/L each primer, 10 lL LightCycler 480 SYBR
Green Master Mix (Roche Applied Science). The PCR
conditions for quantitative detection comprised an initial
denaturation step (95°C for 5 min) followed by 45 cycles
of amplification (95°C for 10 s, 58°C for 10 s, 72°C for
15 s). Mean cycle threshold (Ct) values were calculated
from Ct data obtained from at least three replications of
soil DNA extractions.
Field trials to assess relation between quantity
of pathogen DNA in soil and severity
of Verticillium wilt
The soil samples were collected from two commercial
cabbage fields (field A [30a] and field B [25a]) in the Tashiro region of Tsumagoi, Gunma Prefecture, at harvest time
(29 August 2005). We selected four plots (A-1, A-2, A-3,
and A-4) from field A, and six plots (B-1, B-2, B-3, B-4,
B-5, and B-6) from field B that differed in the severity of
Verticillium wilt on the cabbage plants. Twenty cabbages
grown in each plot (0.9 m 9 3 m) were assessed for
severity of Verticillium wilt on a scale of 0–4; 0 = no
wilting, 1 = yellowing of the first to third lower leaves,
2 = yellowing of the fourth to sixth lower leaves,
3 = yellowing above the seventh lower leaves, 4 = yellowing
J Gen Plant Pathol (2011) 77:282–291
285
250 bp
(a)
18S
5.8S
VdspR2
ITS5
VlspF2
intron
VlspF1
M
ITS4
VaF1
VaR1
VdF1
VdR1
VlspR4
(b) 18S rDNA intron
V. l
28S
(c) 5.8S rDNA-ITS
V. d
V. l
V. a
84
84 Vaa 235 235
CA9 013 CA39 023 -HP 137 138
VlspF2
VdspR2
VlspF1
VlspR4
M
621 bp
275 bp
V. d
V. a
84
84 Vaa 235 235
CA9 013 CA39 023 -HP 137 138
ITS5
ITS4
VaF1
VaR1
VdF1
VdR1
565 bp
340 bp
340 bp
Fig. 1 Specificity of the designed primers. a Gene structure of the
nuclear rDNA gene of Verticillium dahliae and V. longisporum.
Positions and directions of the PCR primers are indicated with
arrows. PCR amplification of b the group I intron of the 18S rDNA
gene of V. longisporum and c the 5.8S rDNA-ITS region. Genomic
DNAs isolated from V. longisporum strains (CA9 and 84013), V.
dahliae strains (CA39 and 84023), and V. albo-atrum strains (VaaHP, 235137 and 235138) were used as template DNA. V. l, V.
longisporum; V. d, V. dahliae; V. a, V. albo-atrum. M: 100-bp ladder
marker (New England BioLabs, Ipswich, MA, USA)
of the head leaves. Disease severity was then calculated
using the following equation: [(number of plants in level
1 9 1) ? (number of plants in level 2 9 2) ? (number of
plants in level 3 9 3) ? (number of plants in level 4 9 4)]/
(4 9 total plants) 9 100. Soil samples were collected from
three randomly selected points (between-plant interspaces)
in each plot. Approximately 300 g soil at a depth of 15 cm
was dug from each point using a shovel, then mixed thoroughly in a plastic bag before DNA extraction.
Disease severity for 60 cabbages in each plot was calculated according to a 5-point scale: 0 = no vascular
browning, 1 = root browning, 2 = browning to the
ground, 3 = browning to the blade, 4 = minimal browning
of head leaves, 5 = heavy browning of head leaves. Disease severity was calculated as follows: [(number of plants
in level 1 9 1) ? (number of plants in level 2 9 2) ?
(number of plants in level 3 9 3) ? (number of plants in
level 4 9 4) ? (number of plants in level 5 9 5)]/
(5 9 total plants) 9 100. Marketable plant rates were
calculated as follows: (total plants with disease level 0–3)/
total plants 9 100. Soil samples were collected from three
randomly selected points (between-plant interspaces) in
each plot. Approximately 300 g soil at a depth of 15 cm
were taken from each point using a shovel.
Field trial to assess effect of cultivar rotation
In trials in cabbage fields C and D in the Hoshimata region
of Tsumagoi, Gunma Prefecture, we evaluated the efficacy
of rotations with resistant and susceptible cultivars to
reduce the incidence of Verticillium wilt of cabbage.
Moderate and heavy Verticillium infestations were investigated in fields C and D in 2002. Each field was divided
into four plots (2.7 9 3.3 m), and 60 cabbages of resistant
cultivar YR Ranpo or of susceptible cultivar YR Shinpu
(Kemmochi et al. 2000) were planted in each plot from
2003 (first season) to 2005 (third season) (Table 2). In
2006 (last season), susceptible cultivar YR Shinpu was
grown in all plots, and disease severity was assessed.
Field trial for risk assessment
In a third trial in field E in the Tashiro region of Tsumagoi,
Gunma Prefecture, where Verticillium wilt of cabbage was
found in 2005, we divided the field into 27 plots (0.5 9
6 m) and collected soil samples from each plot before
planting in 2006. Three cabbage cultivars, resistant cultivar
YR Ranpo, moderately resistant cultivar Teruyoshi, and
123
286
J Gen Plant Pathol (2011) 77:282–291
Table 2 Effect of rotation of resistant and susceptible cultivars on Verticillium wilt in cabbage
Plot
Cultivar grown in each season
1st
2nd
Verticillium wilt in 4th season
3rd
4th
Infected plants (%)a
Disease severityb
Marketable plants (%)a
Field C (Moderately contaminated field)
RRRS
R
R
R
S
58.1 d
36.2 d
77.6 d
RRSS
R
R
S
S
82.5 c
59.1 c
47.9 c
RSRS
R
S
R
S
93.3 b
68.5 b
36.7 b
SSSS
S
S
S
S
99.4 a
77.2 a
22.4 a
Field D (Heavily contaminated field)
RRRS
RRSS
R
R
R
R
R
S
S
S
100 a
100 a
72.8 b
81.0 a
41.1 b
15.0 a
RSRS
R
S
R
S
100 a
79.8 a
23.7 a
SSSS
S
S
S
S
100 a
80.6 a
17.8 a
R resistant cultivar YR Ranpo, S susceptible cultivar YR Shinpu
a
Values with different letters (%) differ significantly at P = 0.05 (Holm method for multiple testing)
b
Values with different letters differ significantly at P = 0.05 (Steel–Dwass test)
susceptible cultivar YR Shinpu, were planted 20 cabbages
in each plot. Disease severity was assessed for 20 cabbages
in each plot according to a scale of 0–4: 0 = no wilting,
1 = yellowing of the first to third lower leaves, 2 = yellowing of the fourth to sixth lower leaves, 3 = yellowing
above the seventh lower leaves, 4 = yellowing of the head
leaves. Disease severity of the three cabbage cultivars in
each plot was evaluated as follows: [(number of plants in
level 1 9 1) ? (number of plants in level 2 9 2) ?
(number of plants in level 3 9 3) ? (number of plants in
level 4 9 4)]/(4 9 total plants 9 100).
Results
Design of specific-primer for detection of V. longisporum,
V. dahliae, and V. albo-atrum.
To design primers specific to V. longisporum and V.
dahliae, we sequenced the 18S rDNA and 5.8S rDNA
regions of two Japanese isolates of V. longisporum (Gunma
isolate CA9 and 84013) and two V. dahliae (Gunma isolate
CA39 and Nagano isolate 84023). Karapapa and Typas
(2001) reported that V. longisporum has a group I intron
within the 18S small subunit ribosomal DNA. Two Japanese V. longisporum isolates also had an 839-bp group I
intron insertion in the 18S rDNA (GenBank accession
AB585938) that was essentially identical to the previously
reported V. longisporum-specific intron (GenBank accession AF153421), confirming the difference between
V. longisporum and other Verticillium species. Sequence
comparison of the ITS1-5.8S-ITS2 region revealed that
the Japanese V. longisporum isolates (GenBank accession
AB585937) and V. albo-atrum (GenBank accession
GU291258) sequences were identical to each other but
123
distinct from V. dahliae. The sequences of the 5.8S rDNA
region in Japanese isolates (CA39 and 84023) of V. dahliae
were identical to that (GenBank accession EU627007) of
V. dahliae reported by Garibaldi et al. (2008).
On the basis of the sequence analysis of the rDNA
region, we designed PCR primer pairs to detect V. longisporum and V. dahliae (Table 1; Figs. 1a, S1, S2). The
V. longisporum-specific group I intron was selectively
amplified by two sets of primer pairs (Figs. 1, S1); two
primer pairs, VlspF2 and VdspR2, and VlspF1 and VlspR4,
amplified 621- and 275-bp DNA fragments from V. longisporum (CA9 and 84013) genomic DNA templates
(Fig. 1b). On the basis of the sequence variety of the 5.8SITS region, we designed two sets of primers (Table 1; Fig.
S2). Primers VaF1 and VaR1 amplified 340 bp of the 5.8S
rDNA-ITS region of V. longisporum (CA9, 84013) and
V. albo-atrum (Vaa-HP, 235137, 235138) genomic DNA
(Figs. 1c, S2). In contrast, VdF1 and VdR1 amplified
the same-sized DNA fragment specifically in V. dahliae.
The primers did not amplify fragments from Fusarium
oxysporum, F. solani, Gibberella fujikuroi, Rhizoctonia
solani, Pythium ultimum, and Phytophthora infestans were
used as templates (data not shown).
We performed PCR on 44 isolates from 20 cabbage
fields in Gunma Prefecture in 2008 (Table S2). Seven
isolates were detectable with two primer pairs VlspF1 and
VlspR4, and VaF1 and VaR1. In contrast, the 37 other
strains were detected using primer pair VdF1 and VdR1.
Construction of QNRT-PCR to quantify Verticillium
spp. DNA
To detect and quantify Verticillium pathogen DNA in soil,
we extracted genomic DNA from soil samples of cabbage
J Gen Plant Pathol (2011) 77:282–291
287
18S rDNA intron
5.8S rDNA-ITS
Real-time PCR threshold
cycle (Ct value)
30
35
(a)
(b)
(Vl-18S)
25
30
20
25
15
20
10
15
5
1
10
102
103
104
105
Genomic DNA (fg)
10
1
Vl-Va-5.8S
Vd-5.8S
10
102
103
104
105
Genomic DNA (fg)
Fig. 2 Quantitative real-time (QNRT) PCR efficiency curves for
serial dilutions of Verticillium genomic DNA. a First round PCR
amplification with VlspF2 and VdspR2 using Verticillium longisporum DNA (strain CA9) as template. Real-time PCR amplification
with primers VlspF1 and VlspR4 using the first round PCR product as
template. b First round PCR amplification with ITS5 and ITS4 using
V. longisporum DNA (strain CA9) or V. dahliae DNA (strain CA39)
as template. Primers VdF1 and VdR1 were used for V. dahliae 5.8S
rDNA-ITS (black squares), and primers VaF1 and VaR1 were used
for V. longisporum 5.8S rDNA-ITS (open circles). Each Ct value is
the mean with the standard error bars from four replicates using each
Verticillium isolate DNA
fields heavily infected with Verticillium wilt in Gunma
Prefecture and performed three assays using real-time PCR
with three primer pairs, VlspF1 and VlspR4, VaF1 and
VaR1, or VdF1 and VdR1. Although Verticillium pathogens
were detected in soil DNA, the Ct values in three real-time
PCR assays was C35 with low reproducibility in most
samples (data not shown). To improve the sensitivity of
quantitative detection, we combined nested PCR and realtime PCR (Materials and methods). Three QNRT-PCR
assays were named Vl-18S for V. longisporum (18S rDNAintron), Vl-Va-5.8S for V. longisporum and V. albo-atrum
(ITS-5.8S rDNA), and Vd-5.8S for V. dahliae (ITS-5.8S
rDNA). Sensitivity and reliability of these QNRT-PCR
assays were estimated by using 10-fold serial dilutions of
Verticillium genomic DNA as template (Fig. 2). In Vl-18S
assay for V. longisporum (18S rDNA-intron), the calibration curve was linear between 10 fg and 105 fg of V. longisporum genomic DNA (Fig. 2a). The correlation
coefficients (r) was -0.99972 (P = 0.00001) for V. longisporum 18S rDNA intron. In similar fashion, the calibration
curves in Vl-Va-5.8S assay for V. longisporum DNA and
Vd-5.8S assay for V. dahliae DNA were also linear between
10 and 105 fg (Fig. 2b). The correlation coefficients (r) of
two assays were -0.99835 (P = 0.00008) and -0.99979
(P = 0.00000), respectively. We used these three QNRTPCR assays to detect Verticillium DNA in cabbage field soil
heavily infested with Verticillium wilt.
selected two cabbage fields (field A and field B) in Tsumagoi, Gunma Prefecture. After assessment of the severity
of cabbage Verticillium wilt disease, both fields were
divided into plots by disease severity, and soil samples
were collected from each plot. Field A was classified into
four plots (Fig. 3a): A-1 (very heavily infested: disease
severity 96.3, 100% of plants infected), A-2 (very heavily
infested: disease severity 83.8, 95% of plants infected), A-3
(heavily infested: disease severity 56.3, 85% of plants
infected), and A-4 (light infestation: disease severity 3.8,
5% of plants infected) (Fig. 3a). Field B was classified into
six plots (Fig. 3a): B-1 (very heavily infested: disease
severity 87.5, 100% of plants infected), B-2 (moderately
infested: disease severity 36.3, 60% of plants infected), B-3
(moderately infested: disease severity 30.0, 45% of plants
infected), B-4 (light infestation: disease severity 5.0, 15%
of plants infected), B-5 (no disease), and B-6 (no disease)
(Fig. 3a). Soil DNA was extracted for relative pathogen
quantification by QNRT-PCR.
In field A, Verticillium DNA was detected by the Vl-18S
and Vl-Va-5.8S assays but not by the Vd-5.8S assay
(Fig. 3b–d). The Ct values in Vl-18S and Vl-Va-5.8S were
lowest in soil samples from plot A-1 (most severely diseased plot) (Fig. 3b, c). In contrast, the Ct value was
highest in the Vl-18S and Vl-Va-5.8S assays in the
healthiest plot A-4. Reflecting the higher sensitivity of the
Vl-18S assay in comparison to the Vl-Va-5.8S assay
(Fig. 2), Ct values in the Vl-18S assay were always lower
than those in the Vl-Va-5.8S assay. However, the correlation coefficients (r) between disease severity and Ct values
in Vl-18S and Vl-Va-5.8S assays were -0.95946
(P = 0.04054) and -0.98122 (P = 0.01878), respectively.
Analytical results in both assays correlated well with disease severity in field A. On the other hand, the Vd-5.8S
Relationships between the quantity of Verticillium
pathogen DNA in soil and disease severity
of Verticillium wilt in cabbage fields
To examine whether QNRT-PCR assays could be used to
detect and quantify Verticillium pathogen DNA in soil, we
123
J Gen Plant Pathol (2011) 77:282–291
Vl-18S
Ct value
(b)
Vl-Va-5.8S
Ct value
(c)
Vd-5.8S
Ct value
(d)
a
35
a
a
80
b
60
b
40
20
c
0
35
c
a
a
a
d
d
a
a
a
100
b
a
a
30
a
a
b
b
c
a
25
a
a
c
b
20
a
a
25
0
SSSS RSRS RRSS RRRS
a
75
50
d
15
ab
25
20
cd
bc
30
bc
Ct value (Vd-5.8S)
Disease
severity
(a) 100
Disease severity
288
Field C
( Moderately contaminated )
SSSS RSRS RRSS RRRS
Field D
(Heavily contaminated)
15
45
40
35
30
25
20
45
40
35
30
25
20
c
a
a
a
a
a
a
b
b
b
b
ab
a
a
a
a
ab
a
ab
a
A-1 A-2 A-3 A-4
Field A
B-1 B-2 B-3 B-4 B-5 B-6
Field B
Fig. 3 Quantitative real-time (QNRT) PCR quantification of Verticillium dahliae and V. longisporum DNA in cabbage field. After
Verticillium wilt severity was assessed in two cabbage fields, soil in
fields with different disease severities were collected and assessed by
QNRT-PCR. a Verticillium wilt disease severity. Severity values with
different letters differed significantly at P = 0.05 (Steel–Dwass test);
b Vl-18S assay, specific to V. longisporum; c Vl-Va-5.8S assay,
specific to V. longisporum or V. albo-atrum; d Vd-5.8S assay, specific
to V. dahliae. Ct values with different letters for an assay differed
significantly at P = 0.05 (Tukey’s multiple comparison test)
assay yielded Ct values of more than 35 cycles in all plots
except in plot A-3 (Fig. 3d).
In field B, pathogen DNA was barely detected in the
Vl-18S and Vl-Va-5.8S assays; however, large amounts of
pathogen DNA were detected in the Vd-5.8S assay
(Fig. 3b–d). There was a strong correlation between Ct
values in the Vd-5.8S assay and disease severity in field B
(r = -0.94663, P = 0.00420) (Fig. 3d). The five Verticillium strains isolated from the infected cabbages in fields
A and B were identified as V. longisporum and V. dahliae
by conidial size and sclerotial morphology (data not
shown).
Effect of cabbage cultivar rotation on the soil pathogen
The effect of continuous cultivation of cultivars resistant to
Verticillium wilt on disease control and soil pathogen DNA
was examined in cabbage fields C and D (Table 2). In
2002, moderate and severe Verticillium wilt occurred in
field C and field D. Either resistant cultivar YR Ranpo or
susceptible YR Shinpu was then planted in these fields
123
Fig. 4 Effect of crop rotations with resistant (R) and susceptible
(S) cultivars on severity of Verticillium wilt and PCR cycle threshold
(Ct) values for soil pathogen populations after 4 years in fields
moderately contaminated (C) or heavily contaminated (D) with
Verticillium dahliae. SSSS: 4 years continuous planting of susceptible
cultivar YR Shinpu. RRRS: 3 years continuous planting of resistant
cultivar YR Ranpo. RSRS and RRSS: rotation of susceptible cultivar
and resistant cultivar. Ct values in the Vd-5.8S assay with different
letters differed significantly at P = 0.05 (Tukey’s multiple comparison test). Severity values with different letters differed significantly
at P = 0.05 (Steel–Dwass test)
from 2003 (first year) to 2005 (third year) (Table 2). In
2006 (fourth year), susceptible cultivar YR Shinpu was
grown in all test areas, and the severity of Verticillium wilt
on cabbage was examined in each plot. In moderately
contaminated field C, 3 years of continuous planting of
resistant cultivar YR Ranpo in plot RRRS reduced disease
severity and rates of infected cabbage and increased the
percentage of marketable plants when compared with plot
SSSS, which was continuously cultivated with susceptible
cultivar YR Shinpu (Table 2). Growth of the resistant
cultivar for two seasons in plots RRSS and RSRS also
yielded some suppression of Verticillium wilt. On the other
hand, continuous planting of resistant cultivar YR Ranpo
only slightly suppressed Verticillium wilt in the heavily
contaminated field D (Table 2). All plants in field D were
infected with disease severities [70.
To evaluate the effect of cultivar rotation on the level of
Verticillium DNA in the soil, we extracted DNA from soil
samples of field C and field D and quantified Verticillium
DNA by QNRT-PCR. The Vl-18S and Vl-Va-5.8S assays
were negative in both fields, because the Ct value was more
than 35 cycles in each plot in field C and field D. These
results suggested that V. longisporum was not the major
pathogen in these fields. In contrast, the Vd-5.8S assay
detected V. dahliae in most plots of field C and field D
(Fig. 4). In moderately contaminated field C, the Ct value
for plot RRRS was significantly higher than that for plot
SSSS, suggesting that suppression of Verticillium wilt by
continuous cultivation of the resistant cultivar was the
result of the reduction of the V. dahliae DNA in soil. A
good correlation between the intensity of disease and
pathogen DNA in soil was observed in field C. In contrast,
J Gen Plant Pathol (2011) 77:282–291
289
Disease severity
100
75
50
25
0
20
22
24
26
28
30
Ct value (Vd-5.8S)
Fig. 5 Risk assessments for severity of Verticillium wilt for three
cabbage cultivars. Three cabbage cultivars, resistant YR Ranpo (open
squares), moderately resistant Teruyoshi (black triangles), and
susceptible YR Shinpu (open circles), were planted after soil was
sampled and DNA was extracted to quantify Verticillium dahliae
using QNRT-PCR (Vd-5.8S). Ct value is the initial pathogen density
before planting, and disease severity were assessed at harvest.
Cultivars were planted in nine plots each (27 plots)
the Ct value in each plot was lower than 22 cycles in highly
contaminated field D. Although the Ct value for plot RRRS
was also highest in field D, a large amount of pathogen
DNA was present in each plot.
Risk assessment of Verticillium wilt
before cabbage planting
To investigate the utility of QNRT-PCR for risk assessment
of Verticillium wilt before planting, we carried out a third
field trial in field E. This field was divided into 27 plots,
and soil samples were collected just before planting. Three
cabbage cultivars, YR Ranpo (resistant cultivar), Teruyoshi
(moderately resistant cultivar), and YR Shinpu (susceptible
cultivar) were planted, and disease severity was assessed at
harvest. Ct values in the Vd-5.8S assay correlated well with
disease severity in YR Shinpu and Teruyoshi (Fig. 5). YR
Shinpu was very sensitive to Verticillium wilt, and a low
level of V. dahliae DNA (at Ct value 26) in the soil was
enough to cause serious Verticillium wilt. Teruyoshi was
clearly more resistant to Verticillium wilt than YR Shinpu,
because disease severity was still below 25 at Ct value 25.
In YR Ranpo, severe disease occurred only in the plot with
a large V. dahliae DNA (Ct value \22) (Fig. 5).
Discussion
We have developed a real-time PCR assay to detect relative amounts of V. longisporum and V. dahliae DNA in
soil. We combined the high sensitivity and specificity of
nested PCR with the quantification of real-time PCR to
detect Verticillium pathogen DNA in soil. Here we found
that QNRT-PCR can be used to detect V. dahliae and
V. longisporum in cabbage fields (Fig. 3).
We used five pairs of primers to detect and quantify
V. longisporum, V. dahliae, and V. albo-atrum (Table 1).
The Vl-18S assay to detect V. longisporum-specific group I
intron within 18S rDNA was highly sensitive and specific.
The species-specific PCR primers for the 5.8S rDNA-ITS
region were used for real-time PCR quantification in the
Vl-Va-5.8S and Vd-5.8S assays. VaF1 and VaR1 in the
Vl-Va-5.8S assay detected V. longisporum and V. alboatrum but not V. dahliae. Koike et al. (1997) reported that
essentially similar primer pairs could detect V. albo-atrum
but not V. dahliae. In contrast, the Vd-5.8S assay specifically detected V. dahliae. DNA sequences of standard
strains revealed that Japanese isolates of V. longisporum
with the 18S rDNA group I intron have a 5.8S rDNA-ITS
sequence identical with that of V. albo-atrum (Fig. 1). In
PCR assays of 44 strains from cabbage fields, seven isolates were detected by two assays, Vl-Va-5.8S and Vl-18S,
and 37 strains were detected by the Vd-5.8S assay. The
strains detected by the Vl-Va-5.8S assay but not by the
Vl-18S assay were restricted to standard strains of V. alboatrum (Fig. 1 and Table S2), supporting the limited geographical distribution of V. albo-atrum in Japan (Koike
et al. 1997).
In this study, we used Ct values from a QNRT-PCR
assay as a relative measure of Verticillium pathogen DNA
in field soil. However, we must mention that Ct values is
not an absolute quantification of pathogen DNA in soil,
because the efficiency of detection may be lower in the
extract from infested soil and vary depending on the soil. In
addition, we could not conclude that the amount of pathogen DNA detected with the QNRT-PCR assay represents
the actual Verticillium spp. population, because we did not
use a semi-selective medium to assess the amount of
Verticillium spp. However, the amount of Verticillium
pathogen DNA in soil determined by the QNRT-PCR assay
correlated well with disease severity in most field trials in
this study, suggesting that QNRT-PCR is good indicator
for disease severity in the field.
We indicated that three QNRT-PCR assays could detect
and quantify Verticillium pathogen DNA from soil DNA in
field trials A and B. In field A, the Vl-18S and Vl-Va-5.8S
assays detected the pathogen DNA, but the Vd-5.8S assay
barely detect the pathogen DNA from all plots expect plot
A-3 (Fig. 3b–d). In contrast, Verticillium DNA in field B
was detected by the Vd-5.8S assay but not by the Vl-18S
and Vl-Va-5.8S assays (Fig. 3b–d). Disease severity in
field A correlated well with the results of the Vl-18S and
Vl-Va-5.8S assays and in field B with the Vd-5.8S assay. In
addition, the five Verticillium strains randomly isolated
from the infected cabbages in field A and field B were
123
290
identified as V. longisporum and V. dahliae by conidial size
and sclerotial morphology. These results suggested that
V. longisporum and V. dahliae are major pathogens in field
A and field B, respectively (Fig. 3). However, QNRT-PCR
assay detected the V. dahliae DNA in plot A-3, but not in
the other plots in field A, suggesting that V. longisporum
and V. dahliae co-exist in some case.
We also showed uses for the QNRT-PCR assay in the
management of Verticillium wilt. QNRT-PCR in field trials
C and D showed that continuous cultivation of a resistant
cultivar reduced the pathogen population in soil if the
initial pathogen density was relatively low (Fig. 4); however, this effect was limited when pathogen density was
high (Ct \ 22), most likely because the resistant cultivar
YR Ranpo then became infected and developed disease
(Fig. 5). To verify the effectiveness of Verticillium wilt
suppression by cultivating a resistant cultivar, however, we
need to repeat the field trials. In the trial in field E, we
demonstrated that initial pathogen density was correlated
with Verticillium wilt severity. These results suggest that
QNRT-PCR assay will be a useful tool to assess the risk of
Verticillium wilt before cabbage planting and to determine
cultivar susceptibility to Verticillium wilt. Although further
analyses must be conducted continuously, sensitive and
reliable monitoring of soil pathogens by QNRT-PCR may
pave the way to new approaches in the management of soilborne diseases.
Acknowledgments This work was partially supported by the
University Industry Joint Research Project for Private Universities,
with a matching fund subsidy from MEXT.
References
Atallah ZK, Bae J, Jansky SH, Rouse DI, Stevenson WR (2007)
Multiplex real-time quantitative PCR to detect and quantify
Verticillium dahliae colonization in potato lines that differ in
response to Verticillium wilt. Phytopathology 97:865–872
Barasubiye T, Parent J-G, Hamelin RC, Laberge S, Richard C,
Dostaler D (1995) Discrimination between alfalfa and potato
isolates of Verticillium albo-atrum using RAPD markers. Mycol
Res 99:1507–1512
Bryan GT, Daniels MJ, Osbourn AE (1995) Comparison of fungi within
the Gaeumannomyces–Phialophora complex by analysis of ribosomal DNA sequences. Appl Environ Microbiol 61:681–689
Fahleson J, Hu Q, Dixelius C (2004) Phylogenetic analysis of
Verticillium species based on nuclear and mitochondrial
sequences. Arch Microbiol 181:435–442
Garibaldi A, Bertetti D, Gullino ML (2008) First report of Verticillium wilt caused by Verticillium dahliae on Rudbeckia fulgida
(orange coneflower) in Italy. Plant Dis 92:1367
Gayoso C, Martı́nez de Ilárduya O, Pomar F, Merino de Cáceres F
(2007) Assessment of real-time PCR as a method for determining the presence of Verticillium dahliae in different Solanaceae
cultivars. Eur J Plant Pathol 118:199–209
123
J Gen Plant Pathol (2011) 77:282–291
Halliday C, Wu QX, James G, Sorrell T (2005) Development of a
nested qualitative real-time PCR assay to detect Aspergillus
species DNA in clinical specimens. J Clin Microbiol 43:5366–
5368
Kageyama K, Komatsu T, Suga H (2003) Refined PCR protocol for
detection of plant pathogens in soil. J Gen Plant Pathol
69:153–160
Karapapa VK, Typas MA (2001) Molecular characterization of the
host-adapted pathogen Verticillium longisporum on the basis of a
group-I intron found in the nuclear SSU-rRNA gene. Curr
Microbiol 42:217–224
Karapapa VK, Bainbridge BW, Heale JB (1997) Morphological and
molecular characterization of Verticillium longisporum comb.
nov., pathogenic to oilseed rape. Mycol Res 101:1281–1294
Kemmochi I, Sakai H (2004) Verticillium wilt of plant species in
cabbage field infested with Verticillium longisporum and
V. dahliae (in Japanese with English summary). Jpn J Phytopathol 70:99–105
Kemmochi I, Sakai H, Shiraishi T (1999) Pathogenicity of Verticillium longisporum and Verticillium dahliae isolated from cabbage
(Brassica oleracea L. var. capitata) to some crops (in Japanese).
Ann Rep Kanto-Tosan Plant Prot Soc 46:31–34
Kemmochi I, Kobayashi I, Tsuchiya M, Sakai H, Shimizu M (2000)
Breeding materials for resistance to Verticillium wilt in Japanese
cabbage (Brassica oleracea L. var. capitata) (in Japanese with
English summary). J Jpn Soc Hort Sci 69:483–491
Kemmochi I, Hinoto M, Sakai H (2003) Pathogenicity of Verticillium
dahliae and V. longisporum on broccoli and cauliflower and
control of Verticillium wilt of cabbage with broccoli residues (in
Japanese with English summary). Jpn J Phytopathol 69:189–197
Klosterman SJ, Atallah ZK, Vallad GE, Subbarao KV (2009)
Diversity, pathogenicity, and management of Verticillium species. Annu Rev Phytopathol 47:39–62
Koike M, Itaya Y, Hoshino K, Nagao H, Ohshima S (1997) PCR
detection of Japanese isolates of Verticillium dahliae and
V. albo-atrum using European subgroup-specific primers.
Microbes Environ 12:15–18
Kuchta P, Jecz T, Korbin M (2008) The suitability of PCR-based
techniques for detecting Verticillium dahliae in strawberry plants
and soil. J Fruit Ornam Plant Res 16:295–304
Larsen RC, Vandemark GJ, Hughes TJ, Grau CR (2007) Development of a real-time polymerase chain reaction assay for
quantifying Verticillium albo-atrum DNA in resistant and
susceptible alfalfa. Phytopathology 97:1519–1525
Li KN, Rouse DI, German TL (1994) PCR primers that allow
intergeneric differentiation of ascomycetes and their application
to Verticillium spp. Appl Environ Microbiol 60:4324–4331
Li KN, Rouse DI, Eyestone EJ, German TL (1999) The generation of
specific DNA primers using random amplified polymorphic
DNA and its application to Verticillium dahliae. Mycol Res
103:1361–1368
Lievens B, Brouwer M, Vanachter ACRC, Cammue BPA, Thomma
BPHJ (2006) Real-time PCR for detection and quantification of
fungal and oomycete tomato pathogens in plant and soil samples.
Plant Sci 171:155–165
Ligoxigakis EK, Vakalounakis DJ, Thanassoulopoulos CC (2002)
Weed hosts of Verticillium dahliae in Crete: susceptibility,
symptomatology and significance. Phytoparasitica 30:511–518
Nazar RN, Hu X, Schmidt J, Culham D, Robb J (1991) Potential use
of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of Verticillium wilt pathogens. Physiol
Mol Plant Pathol 39:1–11
Pantou MP, Strunnikova OK, Shakhnazarova VY, Vishnevskaya NA,
Papalouka VG, Typas MA (2005) Molecular and immunochemical phylogeny of Verticillium species. Mycol Res 109:889–902
J Gen Plant Pathol (2011) 77:282–291
Patzak J (2005) PCR detection of Pseudoperonospora humuli and
Podosphaera macularis in Humulus lupulus. Plant Prot Sci
41:141–149
Pérez-Artés E, Mercado-Blanco J, Ruz-Carrillo AR, Rodrı́guezJurado D, Jiménez-Dı́az RM (2005) Detection of the defoliating
and nondefoliating pathotypes of Verticillium dahliae in artificial
and natural soils by nested PCR. Plant Soil 268:349–356
Radišek S, Jakše J, Simončič A, Javornik B (2003) Characterization
of Verticillium albo-atrum field isolates using pathogenicity data
and AFLP analysis. Plant Dis 87:633–638
Sakai H, Shiraishi T (2003) Soilborne diseases caused by Verticillium
sp. (in Japanese). Plant Protect 57:80–83
Sakai H, Shiraishi T, Suwa S, Kemmochi I, Ohtsuka K, Urushibara T
(1998) The occurrence of Verticillium wilt of cabbage in Gunma
Prefecture and the pathogenic group of its pathogens (abstract in
Japanese). Jpn J Phytopathol 64:331
Sakai H, Shiraishi T, Urushibara T (2001) Occurrence of Verticillium
wilt of cabbage by Verticillium longisporum and V. dahliae
(abstract in Japanese). Jpn J Phytopathol 67:160–161
Salazar O, Julian MC, Rubio V (2000) Primers based on specific
rDNA-ITS sequences for PCR detection of Rhizoctonia solani,
R. solani AG 2 subgroups and ecological types, and binucleate
Rhizoctonia. Mycol Res 104:281–285
Takahashi T, Tamura M, Takahashi SN, Matsumoto K, Sawada S,
Yokoyama E, Nakayama T, Mizutani T, Takasu T, Nagase H
291
(2007) Quantitative nested real-time PCR assay for assessing the
clinical course of tuberculous meningitis. J Neurol Sci
255:69–76
Tjamos EC (1981) Virulence of Verticillium dahliae and V. alboatrum isolates in tomato seedlings in relation to their host of
origin and the applied cropping system. Phytopathology
71:98–100
Usami T, Abiko M, Shishido M, Amemiya Y (2002) Specific
detection of tomato pathotype of Verticillium dahliae by PCR
assays. J Gen Plant Pathol 68:134–140
Usami T, Shishido M, Ebihara Y, Kamigahira Y, Amemiya Y (2005)
Retrotransposon-like elements in the genome of Verticillium
dahliae may be used as DNA markers for fungal species and
pathotypes. J Gen Plant Pathol 71:117–123
Usami T, Ishigaki S, Takashina H, Matsubara Y, Amemiya Y (2007)
Cloning of DNA fragments specific to the pathotype and race of
Verticillium dahliae. J Gen Plant Pathol 73:89–95
Volossiouk T, Robb EJ, Nazar RN (1995) Direct DNA extraction for
PCR-mediated assays of soil organisms. Appl Environ Microbiol
61:3972–3976
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics.
In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR
protocols: a guide to methods and applications. Academic Press,
San Diego, pp 315–322
123