Republic of Iraq
Ministry of Higher Education and Scientific Research
The University of Mustansiriya
College of Science
Investigation of some genes responsible for Biofilm
Formation in Staphylococcus epidermidis Isolated From
clinical samples
A Dissertation
Submitted to the council of the College of Science
AL-Mustansiriyah University in Partial Fulfillment of the
Requirements for the Degree of ph.D of science in microbiology/
pathogenic bacteria
By
NIHAD KHALAWE TEKTOOK
B.Sc.(1995) College of Science/ University of AL-Mustansiriyah
M.Sc. (2005) College of Science/ University of AL-Mustansiriyah
Supervised by
Dr.Rajwa Hasan Essa
Dr. Suzan Saadi Hussain
Prof.
asst.prof
2015 A.D
1436 A.H
1
“Committee certification”
We, the examining committee, certify that we have read this thesis entitled
(Investigation of genes responsible for Biofilm Formation in Staphylococcus
epidermidis Isolated From clinical samples), and have examined the Ph.D. student
(NIHD KHALAWE TEKTOOK ) in its contents, and that in our option it is
accepted as a thesis for the degree of Doctor of Philosophy in: Microbiology /
immunology .
Advisor
Dr. Rajwa Hasen Essa
Professor in Immunology
department
College of Science
University of Al-Mustansiriyah
Date:
/
/ 2015
Advisor
Dr. Suzan Saadi Hussain
Assistant Professor Biology
Biology department
College of Science
University of Al-Mustansiriyah
Date: /
/ 2015
In view of the available recommendations, we forward this thesis for debate by the
examining committee.
Signature
Dr. Rajwa Hasen Essa
Head of Department of Biology / College of Science
The University of Al-Mustansiriyah
Date:
/
/ 2015
2
Examination Committee Certification
We certify that we have read this thesis entitled " Investigation of genes
responsible for Biofilm Formation in Staphylococcus epidermidis Isolated
From clinical samples " as examining committee examined the student ( Nihad
Khalawe Tektook ) in its contents and that in our opinion, It is adequate with
(Excellent) Rank as a thesis for the Degree of Doctor of philosophy in
Microbiology / Pathogenic Bacteria.
Signature
Dr. Khalil H. Zenad
Professor
Dept. of Pathology
College of Veterinary Medicine
Baghdad University
Chairman
Date:
/
/ 2015
Signature
Signature Dr.
Majid M. Mahmood
Dr.Ghanim H.Majeed
Professor (Immunology)
Assist Professor (Bacteriology)
Member
Member
Date:
/
/ 2015
Date:
/
/ 2015
Signature
Sabba T. Hashem
Assist Professor (Bacteriology)
Member
Date:
/
/ 2015
Signature Dr.
Dr. Leeqa H.Mahde
Assist Professor (Bacteriology)
Member
Date: /
/ 2015
Approved by the council of the college of Science
Signature
Dr. Yousif Kadhim Al-Haidarie
Assistant Professor
Dean of the College of Science
Al-Mustansiriyah University
Date:
/
/ 2015
3
ACKNOWLEDGMENT
Praise is to Allah, Lord of the whole creation, and would like to thank Allah
for his care and support throughout my life and especially through the
accomplishment of this research.
I would like to express my deepest appreciation and gratitude to my
supervisors Dr. Rajwa H. Esaa and Dr. Suzan S. Hussen for their valuable
scientific advice, encouragement, guidance, and support that made it possible for
me to accomplish this study.
I wish to express my sincerest gratitude to Dean of Science and Head of the
Biological Department Dr. Rajwa H. Esaa / College of Science / University of Almustensiriyah.
Sincerely I feel a great urge to present my deepest thanks indebtedness to Dr.
Mohamed Faraj , Dr. Ali Abd Alhussen, Dr.Munaeem Redhuan , Dr .Sawsan
Hassan Othman , Dr .Sawsan Sajed ,Dr. Abdulamer Naser Alrekabi , Dr. Rami
Mahmoud Edan , Dr Raya Izat , Dr. Batool al-Haedary , Dr. Ali Razak for assisting
me in Biofilm measurement, discussion on P.C.R techniques and other
microbiological methods.
I would like to thank the other members of my doctoral reading committee, Dr.
Khalid Ibrahim, Dr. Leka Hammed, Dr. Muna Fadhil Abbas and Dr. Raghad Latif
for their assistance and discussion during this work. Their reviews and questions
kept me focused on searching fundamental understanding of my research topic.
Deepest gratitude to all doctors and staff of bacteriology laboratories at ALKindy,
Ibn Al-Balade , Al Imam Ali, Baghdad , Al Wasety Hospitals especially Dr. Mazen
Kaes Ammen, Dr.Salma Abd Al-Rhdah, Sarab Abd AL- Mutaleb , kaseem
Ibrahim, Sawsan, Saeed , Aetemad Hamed Abed, Hadea Naef , Alla Fawze ,
Abed Allah Abed Almuhsen Ali Kasem Saeed , Fawze hade , Aleaa , Ahmed Abed
Alhusen ,Nessren Suhbet , Fattma Sabeh, Yassen Muhsin , Hussen Ali , Hawraa
Kadhem , Abdulla Ibrahim , Ebtehal Kadhem , Emman Suffe , Ashuak Harbe,
Ali Muhsen , Haeder Sadaa, Deana Jassem , Lubna Muheb Al- Ennas Mahmud ,
Deen , Ghufraan Gamal , Shamam Mufleh , Abu Hawrra for kind and scientific
assistance during period study.
I would like to thank members of my research group and my friends at College of
Science, Al-Mustansiryiah University for their friendship and daily discussions.
I extremely appreciate the continuous support from my sister and brothers and my
family through my education. Finally, I feel grateful to my husband, Saad Abed,
4
for his help, love, encouragement, and support. Without his understanding, I
would not have finished it.
Nihad
5
DEDICATION
To My GOOD and Prophet Muhammad (may Allah bless him
and his family)
To The homeland of grief and martyrs and the beloved Iraqi orphans
to all people carrying the heart love others.
To My mother, husband and beloved kids: Shams, Manhal and Mawada
whom I can't force myself to stop loving.
To all my family, the symbol of love and giving (My brother and sister),
my friends who encourage and support me.
To All the people in my life who touch my heart,
I dedicate this research.
Nihad
6
Summary
10
Summary
Staphylococcus.epidermidis is one of coagulase negative staphylococci
(CONS) are now well established as major nosocomial pathogens associated with
infections of indwelling medical devices.
A total of 645 clinical samples, taken from different sources include blood,
catheter urine specimen, wound and burn swabs and swabs of skin and nasal
hospital staff, these sample had been cultured then isolated and identified pure
isolates of different genus of bacteria, results show
85 (19.9%) were Pseudomonas spp isolates, 73 (17%) belong to Coagulase
Negative Staphylococci (CONS) (S. epidermidis ,S. saprophyticus , S.Lentus , S.
haemolyticus and S.hominis constituted 68.5%, 13.7%, 6.85%, 6.85%, and 4.1%
Respectively), followed by both S. aureus and E. coli (n = 70 ,16.4%), followed
by Klebsiella sp. (n = 68 , 16%), Proteus sp. (n = 55 ,12.9%), Serratia marcescens
(n = 6 , 1.4%) isolated from study clinical samples.
Most predominant pathogen was Pseudomonas spp (n = 85 ,19.9%), Also, the
second most important microorganism which isolated were Coagulase negative
Staphylococci (n = 73 , 17%) ,Staphylococcus epidermidis was mainly isolated
from study patients group (68.5%)
All isolates of
CONS
species
are positive gram stain , produce white
pigment except S.saprophyticus which produced yellow pigment, and all isolates
gave negative result of oxidase test , coagulase and catalase test was performed for
all the isolates and all of them produced catalase enzyme that differentiates
Staphylococcus from the genus Streptococcus , so Staphylococcus spp. reduce
nitrate to nitrite , and all isolates were identified by using epi staph and VITEK-2
system within 6 h., CONS are novobiocin resistance except S.saprophyticus.
11
staph.epidermidis isolated were none fermented xylose , sorbitol , melibiose
while fermented many sugar as positive results for glucose, fructose, sucrose ,
maltose, lactose and mannose, in addition to produce urease, lipase and alkaline
phosphatase while it cannot produce DNase and lecithinase.
Blood samples occupied the first place in isolation S.epidermidis from it a
percentage of 60%, followed by catheter urine in the second place 22% .
Most of the Staphylococcus epidermidis was isolated from male patients (58 %)
compare to female (42%), prevalence of Staphylococcus epidermidis with age
were peaked in the t h i r d g r o u p (4 6 - 65) years, followed (32%) in fourth age
group (> 65) so the most bacterial isolated from four study group (blood, catheter
urine specimen, wound and burn swabs , as well as swabs of skin and nasal
hospital staff) were (50, 25, 15, 10) % respectively, there was male preponderance
in all years age group, excepted in third group, the proportion of females (65%)
appeared higher than it is in males (35%).
Results of phenotype were shown 16 % of the isolates were biofilm producers
with Congo red agar method (CRA), although production level varied. In the
biofilm positive S. epidermidis strains on CRA , modified
CRA
and new
modified CRA were 6, 4, 2 ,% respectively of isolates were strong producers,
while 10 ,10 ,4% and 84, 86 , 94 % respectively were moderate and weak .
In this study results show no differences between CRA and modified CRA and
new modified CRA strong biofilm formation was 6% in CRA compare to (4, 2) %
to modified CRA and new modified CRA respectively; also moderate produced
biofilm was 10% in CRA and modified CRA with 4% in new modified CRA, slime
producing which detected by three phenotyping methods 60% of bacterial isolate
were positive biofilm produced by microtiter plate , while ( 38, 16%) respectively
were positive for both tube and CRA methods, in the same time table 3.10 showed
12
negative result as ( 84 , 62 , 40%) respectively for CRA, tube and microtiter plate
method.
When compare three phenotype methods congo red agar method showed little
correlation with TCP(MTP ) assay and high biofilm formation in TCP 18%
compare to both methods ( tube and Congo red agar) as 12 , 16 % respectively,
S. epidermidis isolates, which gained from blood , urine catheters, wound and burn
swab as well as from swab of skin and nasal hospital staff by (60 , 54.5 , 83.3,33.3)
% respectively of the isolates produced biofilm phenotypically while (24, 10,
2,4)% respectively no biofilm phenotypically.
Twenty two (44) % of S. epidermidis has PIA gens while 28(56)% negatively
for PIA gens, so 10, 8 of 30 S. epidermidis which isolated from blood culture were
found to be positive for both IcaA and IcaD , most positive both PIA gene (Ica A,
Ica D) and biofilm produced were 17 (77.3%) while negative for both of them and
negative biofilm were 15(53.6%)Whilst 5(22.7%) were positive for PIA gene and
negative for phenotype (biofilm produce).
So prevalence of IcaA, IcaD genes were 44%, 38% respectively , the results
indicated that the IcaA gene had the highest rate in blood culture (33.3 %) and
catheter urine specimen (45.4%) followed by IcaD gene which was detected in
26.7 % of blood culture while 36.3% of catheter urine specimen.
All S. epidermidis slime positive isolates did not reveal any correlation between
both PIA genes (icaA and icaD); nonetheless, a correlation was noticed between
icaD alone and slime layer production, also seven isolates were potential biofilm
producers and positive for both ica genes (A and D) whilst 15, 12 isolate of
S.epidermidis were positive for both PIA genes (Ica A and Ica D) and produced
biofilm by tube method while 17, 15 strain were positive to both IcaA and IcaD by
Mtp methods.
13
So results of this study indicated that presence of PIA genes did not always
correlate with biofilm production and hemagglutinin of S.epidermidis may play a
major role in the adherence of this organism to microtiter plate. Thus, the
hemagglutinin of S.epidermidis may be a virulence factor in the pathogenesis of
infection, However, no statistically significant differences were found between the
amounts of biofilm formed among the isolates, so founded a good correlation
between amount of biofilm formed and the haemagglutination, as well as 13, 18 of
the 30 isolate, were the relationship between positive both (Macroscopically and
microscopically) hemagglutination assay respectively and biofilm formation
S o Mean of Dry weights of biofilm w h i c h f o r me d b y S.epidermidis which
isolated from blood was equal to 2.7 mg, and 6 out of 18 isolates have positive
macroscopically
hemaglutination
assay
and
8
isolates
have
positive
microscopically hemaglutination assay ,whilst ( 5, 6 and 2,3) isolates have positive
macroscopically and microscopically hemaglutination assay respectively with 2.8
mg were the mean of dry weights of biofilm w h i c h f o r me d b y S.epidermidis
which isolated from both catheter urine and wound and burn swabs while only
one isolate isolated from swab of skin and nasal hospital staff has positive
microscopically hemaglutination assay but negative macroscopically with mean of
dry weights biofilm were equal to 2.7 mg, these results indicate no relationship was
founded between the amount of biofilm formed and form of biofilm but increasing
when increased age of biofilm.
Sera from patients with S. epidermidis infections showed reactivity with S.
epidermidis antigens (whole cells ) as: six of S. epidermidis antigens agglutinated
in titer 1: 2 , 1: 4 , 1: 32 and 1: 128 of patients sera ( antibodies ) while 5, 9 , 11 of
S. epidermidis antigens agglutinated in the patients sera in titer ( 1: 16 , 1: 64 , 1:
256) respectively .
14
Also concentration of sera protein (5.032) µg/ ml gave 90% inhibition but
concentration of sera protein (1.394) µg/ ml gave 30% inhibition ,and normal level
both for immunoglobulin M and A (90.23±44.23, 124.4±41.20 and 220.8±90.209,
200.10±79.004) mg / dl respectively(p>0.001), but IgG increased level is highly
elevated (1535±812.333, 1521.3±475.440) mg / dl respectively(p< 0.001) in sera
of patients with produced and non-produced biofilm, and normal levels of (C3)
(120±36.5, 120±36.49) mg/dl respectively (P> 0.001), in sera of patients with
produced biofilm compare to non-produced biofilm whilst elevated levels of (C4)
(41.9±14.09, 42±14.28) mg/dl respectively (p>0.001)to each two groups (produced
and non-produced biofilm), so level of cytokines (IL-6, IL-8) appear variations
between patients and controls, levels of IL-6 (24.8 ±18.20 , 24.5 ±19.09) pg/ml
respectively in sera of infected patients by S.epidermidis (produced and nonproduced biofilm) respectively compare to the control (15.88±6.8) pg/ml(P<
0.001), while serum level of IL-8 (38±9.52,37±7.13) pg/ml respectively in sera of
infected patients by S.epidermidis (produced and non – produced biofilm)
respectively compare to the control(20.3±7.07) pg/ml (P< 0.001).
15
List of Contents
Index
Summary
List of Contents
List of Tables
List of Figures
List of Abbreviations
Titel
Page
I
iv
viii
xvi
xvii
List of Appendix
Xviii
Chapter One: Introduction & Literature Review
Introduction
Aims of Study
1
4
1
Staphylococcus epidermidis
5
1.1
General characteristics of Staphylococcus epidermidis
5
1.2
Classification of bacteria
5
1.3
Virulence factors in S.epidermidis
6
1.4
Toxins
8
1.5
Hemagglutination
11
1.6
Exopolymers
1.7
12
Structure of polysaccharide intercellular adhesion (PIA) and
Related Polysaccharides
12
1.8
Poly-N-Acetyl-Glucosamine (PNAG)
13
1.9
Biofilm
16
1.9.1
Biofilm structure
19
1.9.2
Formation of Biofilm
1.9.2.1
Attachment
1.9.2.2
Formation of Microcolonies
1.9.2.3
Detachment and dispersal of biofilm organisms
1.9.3
20
22
Quorum Sensing [QS]
16
22
23
24
1.10
1.10.1
1.10.2
1.10.3
1.10.4
1.10.4.1
1.10.4.2
Immune Defense
26
Antibodies (immunoglobulin)
26
Complement system
27
C-reactive protein (CRP)
28
Cytokine
28
Interleukin 6 (IL-6)
29
Interleukin 8 (IL-8)
30
1.10.5
Resistance of biofilm to immune system
1.10.5.1
Immune modulation by biofilms
1.10.5.2
Mechanism of biofilm resistance to body immune systems
1.10.5.3
Immune response to biofilm formation
1.11
Treatment and Prevention of S.epidermidis biofilm-associated
infections
30
31
32
32
34
Chapter two: Materials and Methods
2.1
Materials
37
2.1.1
Apparatuses and equipment used in the present study.
37
2.1.2
Chemicals and biochemical materials:
2.1.3
Medium used in the present study.
2.1.4
DNA primers design
39
2.2
Methods
39
2.2.1
Sterilization
39
2.2.2
Preparation of Media used for isolation and identification of
bacteria
40
17
38
38
2.2.3
Media used for detection of biofilm production
40
2.2.4
Reagent and solution
42
2.2.4.1
Reagents: API staph
42
2.2.4.2
Solution
42
2.3
Patients
44
2.3.1
Groping of patients and control
44
2.3.2
Collection of samples
44
2.3.2.1
Catheter urine
44
2.3.2.2
Burn and wound swab
44
2.3.2.3
Blood sample
44
2.3.2.4
Control group
45
2.4
Culturing of the samples.
45
2.4.1
Urine sample
45
2.4.2
Swab
45
2.4.3
Blood culture
45
2.4.4
Bacterial isolated
45
2.5
Identification of Isolated Bacteria
45
2.5.1
Macroscopic observations (Culture Characteristics)
45
2.5.2
Gram Stain For The Isolated Bacteria
45
2.5.3
Growth on mannitol salt agar
46
2.5.4
Catalase test
46
2.5.5
Coagulase test (slide method)
46
2.5.6
IMVIC Test
46
2.5.7
Kligler iron agar
47
2.5.8
Urease activity
47
2.5.9
DNase production
47
2.5.10
Novobiocin sensitivity test (5µg/disc)
48
18
2.5.11
Sugars fermentation
48
2.5.12
API Staph Micro Tubes System
48
2.5.13
Vitek 2 system
49
2.5.13.1
Reagent cards
49
2.5.13.2
Culture requirements
50
2.5.13.3
Suspension Preparation
50
2.5.13.4
Inoculation
51
2.5.13.5
Card sealing and incubation
51
2.6
51
Isolates storage
2.7
Microscopic examination
52
2.8
Biofilm study
52
2.8.1
Culturing the strains on plates
52
2.8.1.1
Culturing the strains on Congo red agar plates
52
2.8.1.2
Culturing the strains on Modified Congo Red Agar (M.CRA )
52
2.8.1.3
Culturing the strains on New modified Congo
red agar plates ( new M.CRA)
52
2.8.2
Tube Method (TM)
52
2.8.3
Quantitation of biofilm by tissue culture plate method (TCP) or
microtiter plate (M.t.p)
53
2.9
Biofilm dr y weight determination
54
2.10
immune assay
52
2.10.1
Extracted biofilm and estimation protein
52
2.10.2
Preparation Bacterial Antigen (Heat Killed Whole Cell)
52
2.10.3
Production of antibodies
55
2.10.4
Determine concentration of protein in sera of patients by Sp 3000
Nano System.
55
2.10.5
Agglutination antigens with antibodies
55
2.10.6
Effect of protein sera of pateints on biofilm formation
56
2.10.7
Immunoglobulin And Complement Determination
56
2.10.8
C-Reactive Protein
57
2.10.9
2.11
Estimation Serum Level of Interlukine (IL-6,
IL-8)
Hemagglutination assays
19
58
60
2.11.1
Erythrocytes
60
2.11.2
Hemagglutination assay
60
2.12
61
Genetic Techniques
2.12.1
The DNA extraction method
61
2.12.2
P.C.r
61
2.13
Analysis of data
62
Chapter Three : Results and Discussion
3
Isolation of Bacteria
63
3.1
Number and percentage of bacteria isolated from different
patients.
63
3.2
Biochemical test and Novobiocin test for Coagulase negative
Staphylococci and Staph.aureus
65
3.3
Coagulase negative Staphylococci groups isolated from different
66
clinical specimens.
3.4
Prevalence of Staph.epidermidis in this study groups.
68
3.5
Sugar fermentation for Coagulase negative Staphylococci.
69
3.6
Identification of Staphylococcus epidermidis by API Staph
system.
70
3.7
virulence factors
71
3.7
virulence factors which produce by Coagulase negative
Staphylococci.
72
3.8
Distribution of staph.epidermidis isolates among gender and age
in relation to specimen types
73
3.9
Number and percentage of biofilm form by S.epidermidis
76
detection by Congo red agar , modified Congo red agar and new
modified Congo red agar.
3.10
Detection biofilm of S.epidermidis by phenotyping methods.
77
3.11
Biofilm produced by three phenotype method according to
Source of S.epidermidis.
80
20
PCR detection of IcaA, IcaD
81
3.12
Relationship of phenotype and genotypic biofilm production
82
3.13
Presence and absence of each Ica gene in clinical and nonclinical strains.
84
3.14
Relationships between phenotype (biofilm production in three
methods) and genotype (presence of Ica A, Ica D genes)
85
3. 15
Relationship between biofilm formation ,hemagglutination assay and
dry weight of biofilm in S.epidermidis
89
3.16
Agglutination of antigens (whole cells of S. epidermidis which
93
formed Biofilm) against antibodies in sera of patients.
3.17
Percent Inhibition of concentration sera protein on biofilm
95
formation
3.18
Mean values of immunoglobulin’s and Complement Level (C3
96
and C4) in sera of infected Patients by S.epidermidis (produced
and non – produced biofilm).
3.19
Mean of interleukins (6 and 8) and C- reactive protein (C-RP)
99
in sera of infected Patients by S.epidermidis (produced and
non – produced biofilm)
Conclusions and Recommendations
I
Conclusions
100
II
Recommendations
101
References
102
Appendix
Summary in Arabic
21
List of Tables
Table
Table 1.1
Table 1.2
Table1.3
Title
Page
Virulence factors of S. epidermidis related to biofilm
formation.
Exotoxins and extracellular enzymes of S. epidermidis
Factors contributing to biofilm resistance
7
10
18
Table 1.4
Composition of biofilm .
19
Table 1.5
Novel antibiofilm approaches .
36
Table 2.1.1
Apparatuses and equipment used in the present study.
37
Table2.1.2
Chemicals and biochemical materials:
38
Table 2.1.3
Medium used in the present study
38
Table 2.1.4 DNA primers used in the present to amplify Ica A, Ica D
39
Table 2.1.5
Composition type of biofilm
41
Table 2.1.6 Classification of bacterial adherence by tissue culture
plate method .
Table 2.1.7
PCR amplification parameters .
54
Table 3.1 Number and percentage of Bacteria isolated from
different patients.
Table 3.2 Biochemical test and Novobiocin test for Coagulase
negative Staphylococci and Staph.aureus.
Table 3.3 Coagulase negative Staphylococci gropes isolated from
different clinical specimens.
Table 3.4 Prevalence of Staph.epidermidis in this study groups.
Table 3.5 Sugar
fermentation
for
Coagulase
negative
Staphylococci.
Table 3.6 Identification of Staphylococcus epidermidis by API
Staph system.
Table 3.7 virulence factors which produce by Coagulase negative
63
22
61
65
66
68
69
70
72
Table 3.8
Staphylococci.
Distribution of staph.epidermidis isolates among gender
and age in relation to specimen types
73
Table 3.9 Number and percentage of biofilm form by S.epidermidis
detection by Congo red agar , modified Congo red agar
and new modified Congo red agar
76
Table 3.10 Detection biofilm of S.epidermidis by phenotyping
methods
77
Table 3.11 Biofilm produced by three phenotype method according
to Source of S.epidermidis.
Table 3.12 Relationship of
phenotype and genotypic biofilm
production
Table 3.13 Presence and absence of each Ica gene in clinical and
non-clinical strains.
Table 3.14 Relationships between phenotype (biofilm production in
three methods) and genotype (presence of Ica A, Ica D
genes).
Table 3.15 Relationship between biofilm formation,
hemagglutination assay and dry weight of biofilm in
staph.epidermidis
Table 3.16
Agglutination of antigens (whole cells of S.epidermidis
which formed Biofilm) against antibodies in sera of
patients
80
Table 3.17 Percent Inhibition
95
of concentration sera protein on
biofilm formation
Table 3.18 Mean values of immunoglobulin’s and Complement
Level (C3 and C4) in sera of infected Patients by
S.epidermidis (produced and non – produced biofilm).
Table 3.19 Mean of interleukins ( 6 and 8 ) and c- reactive protein
(C-RP)in sera of infected Patients by S.epidermidis
(produced and non – produced biofilm) .
23
82
84
85
89
93
96
99
List of Figures
Figures
page
Figure 1.1
Schematic overview of PIA synthesis (a) and the
gene arrangement in the ica operon (b)
14
Figure 1.2
S.epidermidis as a commensal and infectious
microorganism
15
Figure 1.3
Diagrammatic representation of various components
of bacterial biofilms
Various stages of biofilm formation and
development
20
Biofilm forming by S. epidermis on a glass
surface.
Schematic overview of agr QS system in S.
epidermidis [Novick and Geisinger 2008].
different genes composing the agr complex and
the adjacent hld gene, with the transcripts RNAII
and RNAIII marked[Gopal etal., .2014].
Code for Staphylococcus epidermis (6706113) by
API staph system.
(a) Biofilm producer and no producer on Congo-red
agar, modified Congo-red agar and new M.Congored agar, (b) Biofilm production by tube method and
(c) Tissue culture plate method for detection of
biofilm production.
Congo red agar, microtiter plate, and tube methods
for detection of biofilm produced by Staph.
epidermidis.
22
Gel electrophoresis of PCR product for detection of
Ica A gene (188bp) and Ica D gene (198bp) using
1%agarose for 90 min at 70 volt .
hemagglutination among staph.epidermidis isolates
responsible for infection.
81
Figure 1.4
Figure 1.5
Figure 1.6
Figure 1.7
Figure 3.1
Figure 3.2
Figure 3.3
Figure 3.4
Figure 3.5
24
21
25
25
71
75
78
87
Figure 3.6
Dry weight of biofilm of staph.epidermidis.
88
Figure 3.7
Antigen - Antibodies titration with control (control 1:
Only BHI broth Control 2: BHI + Bacteria Control
3: BHI + Serum)
93
List of Appendix:
No. of Appendix
Title
Page No.
1
Patients information list
2
API 20 staph “Analytab products "
consist
3
The PCR reaction mix (25 µl).
4
Standard curve of immunoglobulins
(IgG, IgM, IgA) and complement
components (C3, C4
5
Standard curve of IL-6 and IL-8
serum level.by using ELISA.
25
Chapter One
Introduction
and
Literatures Review
26
Introduction
Staphylococci are common cause of nosocomial infection and biofilm is one of
its important microbial virulence factors, Staphylococcal infections are of
particular concern because of the causative agent offering resistance to a wide
range of antibiotics,
multiple drug resistant strains are becoming more
critical due to their capacity to produce biofilm. S.epidermidis is a versatile agent ,
a commensal and a nosocomial pathogen usually with an opportunistic role
association with implanted foreign body materials ,it’s recognized as important
cause of disease in the world and generally hospital-acquired , through ability to
form potent biofilms on adherent surfaces , thereby giving way to catheter related
infections and heart valve associated infections as medical devices can get easily
contaminated with these bacteria from the skin of hospital staff and visitors [Prag
etal., 2014].
S.epidermidis
has
emerged
as an
important nosocomial
especially associated with individuals of compromised
cancer patients and neonates and with implanted
pathogen,
immune system a s
foreign body materials as
heart valves . Biofilms play a key role in bacterial resistance against antibacterial
agents an issue
that
causes
multiple
problems
in medical fields
,
particularly with Staphylococcus biofilms that colonize medical indwelling devices
, formation of biofilm are development by bacteria has been suggested to be an
important stage in the pathogenesis of numerous bacterial species by helps the
bacteria to form stable communities of protection rather than live as free
27
planktonic cells , make bacterial infections of long duration and difficult to be
removed , as well as is the most important factor for the establishment of
S.epidermidis as a nosocomial pathogen [Abdel-Aziz, 2014].
Biofilms were defined as the structural phenotype of microbial communities
enclosed in the self-produced polymeric matrix mainly composed of extracellular
polysaccharides (EPS) , its heterogeneous mixtures of bacteria that are held
together by a secreted matrix called EPS , major part of the biofilm is called
polysaccharide intercellular adhesion (PIA) encoded by the icaADBC operon,
Intercellular adhesion (ica) locus consisting of the genes icaADBC encodes
proteins mediating the synthesis of polysaccharide intercellular adhesion (PIA)
and polysaccharide/adhesion (PS/A) in staphylococci species[ Seanghuoy,2014].
New molecular techniques based on PCR for identification of virulent biofilmforming strains, the detection of the genes governing the production of such
extracellular polysaccharide and, in particular, the icaA and the icaD genes are a
rapid and accurate technique for strain characterization [Muhammad ,2013] , as
well as established methods as the Congo red agar test and modified Congo red
agar test .
Bacteria communicate with each other by production of chemotactic particles or
quorum sensing which consider as a
key behavior coordination mechanism to
regulate gene expression in accordance with population density through the use of
signal molecules, known as auto inducers , the pathways of are composed of
several main parts, including bacteria populations, signal molecules, protein
activators and target genes, which influence biofilm formation [Moghaddam
etal.,2014].
According to The National Institute of Health (NIH) 65-80% of all microbial
28
diseases are biofilm-based, causing many deaths and high health costs worldwide
, establishment of biofilms by pathogenic bacteria on the tissues of susceptible
hosts is believed to inhibit the effectiveness of antibiotic treatment , protect against
host defense mechanisms , and bacterial communication leading to expression of
virulence determinants, Insertion sequence element called IS256 has the capacity
to influence expression of the Ica operon, and subsequent biofilm formation
[lachachi et al., 2013]
The other very important factor in establishment of S.epidermidis
as
nosocomial pathogen is methicillin resistant , in this bacteria resistance to
methicillin is known to be associated with the presence of the mecA gene, which
encodes a penicillin-binding protein with low affinity for b-lactam antibiotics
(PBP2A) [ Wan,etal.2014].
As well as hemagglutination of erythrocytes is a property of S.epidermidis
bacteria, that related to biofilm formation and also essential for pathogenesis of
biomaterial-associated infections which is causing by S.epidermidis [Dietrich etal.
1999].
The immune system are a large and complex series of elements which distributed
in body, the immune
humoral
immunity
response is highly specific for a particular pathogen ,
including antibodies and complement,so cytokines are
produced mainly by immune cells and cytokines are involved in almost every
aspect of immunity and inflammation . Among proinflammatory cytokines, IL-6 is
a pro-inflammatory cytokine which has an important
role in immunity also
Interleukin-8 is a pro-inflammatory chemokine, It is secreted from a range of cell
types including leukocytes, fibroblasts, endothelial cells and malignant cancer
cells[Campbell et al., 2013].
29
Aims of this study:
In recent years many studies focused on S.epidermidis because of its ability
of to adhere to the surfaces and form biofilm , which are the most important
virulence factor in S.epidermidis and essential step in the pathogenesits of this
bacteria therefore this study aimed to :-
1- Isolated bacteria from different source ( blood, catheter urine, wound and burn
swabs as well as skin and nasal swabs from hospital staff ) and identificated by
using varies methods ( culturing, Api system , Vitek 2 System as well as Bact for
bacteria which isolated from blood).
2- Study of biofilm forming by S.epidermidis with different methods
A- Quantitative of biofilm assay which includes: - Congo red agar, modified
Congo red agar, new modified Congo red agar and Tube method
B- Qualitative Formation of biofilm on microtiter plates.
And comparative between these methods as well as measurements weight of
biofilm formation on surfaces.
3-Determine of the presence of the icaA and icaD in S. epidermidis isolated from
different clinical source by P.C.R and specific primers .And study correlation
between the presence of both Ica (A, D) and biofilm production.
4- Estimate the presence and level of poly-N-acetylglucosamine (PNAG)
produced by S.epidermidis isolate through haemagglutination assays (By solution
erythrocytes).
5- Extraction of biofilm and used as antigens against sera of patients’ infected by
30
S. epidermidis.
6- Study the effect biofilm of these bacteria on non- specific immune response
through estimate levels of IL 6 & IL 8 and C- reactive protein and on specific
immune response through determine Immunoglobulins (IgG, IgM, IgA and
Complement concentration (C3& C4).
1. Staphylococcus epidermidis
1.1General characteristics of Staphylococcus epidermidis
Staphylococci are Gram-positive cocci, which often stick together in grape-like
clusters; Biofilm formation is a key factor in the establishment and persistence of
Staphylococcal infections in humans, animals, and on medical devices [Karaolis et
al., 2005].
The genus can be separated into two groups based on the ability to produce
coagulase, an enzyme that causes clotting of blood plasma: The coagulase-positive
staphylococci (Staphylococcus aureus and a few others) and the coagulasenegative staphylococci (CoNS), S.epidermidis together with S. aureus, have rank
second as cause of surgical site infection [Rogers et al. 2009].
S.epidermidis is the main bacteria among the CoNS . It’s a member of the
microbiota of the human skin and wet mucosa, but may act as a pathogen
causing infections which may have a significant incidence especially in the
immune compromised patients [Kools and Bannerman 1994].
In general, S. epidermidis is not produced enterotoxin but mostly limited to
phenol-soluble modulins (PSMs), which are short, α-helical peptides, amphipathic,
with pro-inflammatory and sometimes cytolytic functions[Otto, 2009].
However this bacterium can become an opportunistic pathogen and associated
with bacteremia and hospital acquired infections, particularly in patients with
31
catheters or others medical devices [Wang, 2007] and the main cause of their
pathogenicity by the ability to adhere and form biofilms on the surfaces of the
medical devices formerly mentioned [ Fey and Olson, 2010].
1.2 Classification of bacteria:According to
“Bergey’s Manual
classification (2004) of
Systematic
Bacteriology, this bacterium is placed under:
Kingdom
:
Bacteriae
Phylum
:
Firmicutes
Class
:
Bacilli
Order
:
Bacillales
Family
:
Staphylococcaceae
Genus
:
Staphylococcus
Species
:
epidermidis
1.3 Virulence factors in S.epidermidis
S.epidermidis
has few virulence factors which directly cause damage to the
host, compared to its more virulent relative S.aureus. The ability to form biofilms
is a major virulence factor for S.epidermidis during an infection [Wojtyczka etal.,
2014].
Many virulence factors that have been described in S.epidermidis , it is
summaried in table 1.1 , we will in this thesis mainly focus on important
S.epidermidis virulence factor is biofilm formation, furthermore, some of the
abilities to invade the human immune defence that S.epidermidis
uses when
causing an infection also have a different, non-damaging function when the
bacteria
live as a commensal
on, for example,
32
the human
skin. This
capability, to cause an infection in certain environments, is still not fully
understood and therefore S.epidermidis
is sometimes referred to as “the
accidental pathogen [Male 1998].
Table 1.1 Virulence factors of S. epidermidis related to biofilm formation [Otto
et al. 2004, 2009]
33
Virulence factors
Function
Stage 1: Primary attachment to abiotic surfaces
AtlE (autolysin E)
Aae (autolysin/adhesin)
SSP1 and SSP2 (staphylococcal surface proteins)
Teichoic acids
Adhesin: affects surface hydrophobicity
Adhesin
Fimbria-like proteins: attachment to polystyrene
Affecting attachment through the binding of
autolysins
Stage 1: Attachment to conditioning film (host matrix proteins)
Fbe (fibrinogen-binding protein)/SdrG (serine-
Fibrinogen binding, inhibition of phagocytosis
aspartate dipeptide repeat protein G)
SdrF
Binding collagen
SdrH
Putative binding function only
34
Ebp (elastin-binding protein)
Binding elastin
AtlE and Aae
Binding various matrix proteins, including fibrinogen,
fibronectin and vitronectin
Embp (extracellular matrix-binding protein)
Binding fibronectin, preventing the macrophage
phagocytosis and binding albumin.
GehD
Collagen binding
Stage 2: Formation of microcolonies
PIA (polysaccharide intercellular adhesin)
Exopolysaccharide: cell-cell adhesion,
haemagglutination, protects the bacteria from IgG,
AMPs, phagocytosis and complement attack
Bap/Bhp (biofilm-associated protein)
Intercellular adhesion, independent of PIA
Aap (accumulation-associated protein)
Intercellular adhesion, independent of PIA, requiring
proteolytic processing for its activation
Teichoic acids
Components of biofilms
Global regulation of biofilm production
35
Sar
Positive regulator of PIA production
Alternative transcription factor SigB
Positive regulator of PIA production, via negatively
regulating icaR
RsbU
Positive regulator of PIA production, via positively
regulating SigB
Quorum-sensing systems
Agr
Agr: reduce the bacterial adherence/enhance biofilm
detachment.
LuxS
LuxS: negatively regulate PIA production.
RNAIII activating protein/target of RNAIII- activating
A regulatory system of agr QS system
protein (RAP/TRAP)
Other Biofilm related factors
Poly-gamma-glutamic acid (PGA)
Component of EPS, and protects bacteria from
antimicrobial proteins and phagocytosis
Lipoproteins can be involved in a large variety of physiological functions, i.e.
adhesion , transport , receptors , enzymes or virulence factors [Sutcliffe and Russe,
1995] , ABC (ATP binding cassette )transporter systems belong to a family of
proteins which in gram-positive bacteria performs important roles as substrate-
36
binding proteins, in antibiotic resistance , in cell signaling, in protein export and
folding , in sporulation and germination , in conjugation, in biofilm formation and
various other functions[Sutcliffe and Harrington 2002].
1.4 Toxins
Unlike many bacteria , S.epidermidis
does not produce many toxins, it is not
an enterotoxin producer , the only toxins described in S.epidermidis are the
Delta- toxin( PSMγ)
that
have
pro inflammatory
and
cytolytic
function[Cogen etal., 2010].
Its toxin production is mostly limited to PSMs , which are short, amphipathic and
α-helical peptides with pro-inflammatory and sometimes cytolytic functions [Otto,
2009]( table 1.2) ,under strict regulation . These toxins by the agr
quorum sensing ( QS)
system ,
PSMγ which be involved in necrotizing
enterocolitis [Cheung, 2010],while the function of the other PSMs is not
fully understood though they are suggested to have an important role in the
regulation of biofilm, many of the virulence factors in S.epidermidis
may
also have a non-damaging function. Delta-toxin have antimicrobial activity
against, as group A streptococci, when colonizing the human s k i n , t hus deltatoxin cooperates with the human cutaneous immune defence, also the gene for
delta-toxin (hld ) is located adjacent to the agr complex and is transcribed
by RNAIII [Cuong & otto,2002] .
37
Table 1.2 Exotoxins and extracellular enzymes of S. epidermidis [Otto, 2009]
Name
Staphylococcal
cysteine
Category
Effects
Cysteine proteases
Tissue damage
protease staphopain B (SspB)
38
Extracellular
cysteine
Cysteine proteases
Tissue damage
Metalloprotease or elastase
Lipase maturation, AMP resistance and
protease (Ecp)
Staphylococcal efflux pump
tissue damage.
(SepA)
Glutamyl endopeptidase, S.
Glutamylendopeptidase
factor c5
epidermidis (GluSe)
Staphylococcal
serine
Degradation of fibrinogen
Serine protease
And complement factor c5
protease (SspA )
Extracellular serine protease
Degradation of fibrinogen and complement
Serine protease
factor C5
(Esp)
Glycerol
Degradation of fibrinogen and complement
ester
hydrolase
Persistence in fatty acid
Lipases
Secretions
(GehC and GehD)
Fatty acid modifying enzymes
Unidentified
Detoxification of bactericidal fatty acids
Urease
Ureolysis, pH changes and bacterial
(FAME)
Urease
invasiveness
Phenol-soluble
modulins
Tissue-damaging toxins
Pro-inflammatory cytolysins, e.g. causing
(PSMs), e.g. Delta (δ) toxin
necrotizing enterocolitis
D-alanylation of teichoic acids AMP-related proteins
D-alanylation of teichoic acid
(Dlt)
Multiple peptide resistance AMP-related proteins
Lysylation of phospholipids
factor protein (MprF)
Vancomycin
resistance AMP-related proteins
Putative AMP exporters
associated (VraF and VraG)
Antimicrobialpeptide-sensing
AMP-related proteins
Senses AMPs and regulates AMP
resistance mechanisms
system (APS)
Staphyloferrins
Iron importer
Bacterial iron acquisition
Siderophores
Iron importer
Bacterial iron acquisition
iron Iron importer
Bacterial iron acquisition
Staphylococcal
transporter ABC (SitABC)
1.5 Hemagglutination
Hemagglutination
plays a direct role in adherence to polymers and thus
prosthetic-device infection or serves as an easily demonstrable marker for
39
adherence and biofilm formation as well as essential for the pathogenesis of
biomaterial-associated infections caused by S.epidermidis also, hemagglutination
was not affected by heat , pH , cation concentration, proteolytic enzymes, biologic
detergent, serum proteins, or sub inhibitory antibiotics and the hemagglutination
was abolished by periodate oxidation and digestion with glycosidases, it was
markedly inhibited by beta-lactose and its monosaccharide constituents in a
concentration dependent fashion[Dietrich etal.,1999].
Hemagglutinin expression depended on the presence of glucose. Chemical
analysis of a partially purified hemagglutinin preparation and cell-free
hemagglutinating supernatants revealed little or no protein and small quantities of
reducing sugars, pentose, ketose, hexosamine, uronic acid, and phosphate , so
hemagglutinin of S.epidermidis appears to be a polysaccharide distinct from other
known adhesins of S.epidermidis , when the proteins on the outer surface of the
bacterium bind specifically to carbohydrate residues on the surface of erythrocytes
and other eukaryotic cells, as well as autolysin which acts as a hemagglutinin, in S.
saprophyticus [Hell etal.,1998] , this protein has been shown not only to mediate
adherence to proteins found on sheep erythrocytes but also to bind fibronectin
[Rupp etal.,1995].
The hemagglutinin of S.epidermidis is carbohydrate in nature and is nonspecific,
in that a wide variety of erythrocytes can be agglutinated. In contrast, as purified
PIA inhibits hemagglutination, PIA might interact with a specific receptor for the
hemagglutinin on the erythrocyte surface, PIA is necessary for the functional
activity of the hemagglutinin of S.epidermidis , as the icaADBC operon contains
only a single gene homologous to a glycosyltransferase and no additional synthetic
genes related to sugar precursor biosynthesis[Heilmann etal.,1996] whose
40
interruption could lead to impaired synthesis of a polysaccharide different from
PIA.
1.6 Exopolymers
S.epidermidis produces
(PIA) and
exopolymers, Polysaccharide intercellular adhesion
poly-γ-glutamic
acid [PGA],which p l a y i m p o r t a n t r o l e a s
protection against the innate host defence of neutrophil phagocytosis and
antimicrobial peptides also important for survival both as a commensal on
the skin and infectious agent in biofilm , promotes growth during high salt
concentrations by increased osmotolerance[Otto,2009],
as
well as it the
formation of biofilm, has similar functions as poly-γ-glutamic acid , in the
protection of S.epidermidis and defence against complement deposition and
immunoglobulins[Vuong etal., 2004].
Cell-to-cell adhesion on non-living surfaces are mediated by adhesins
S.epidermidis produces a PIA, it is considered to be the major functional component
mediating intercellular adhesion in S.epidermidis
biofilms and it’s a major
virulence factor in experimental biomaterial- associated infection [Spiliopoulou,
2012].
1.7 Structure of polysaccharide intercellular adhesion (PIA) and
Related Polysaccharides
Polysaccharide intercellular adhesion is a homoglycan of β -1,6- linked Nacetylglucosamine, with a fraction of free 2-amino groups (no N-acetylation)
conferring positive charges and O-succinoyl ester residues conferring negative
charges. In spite of variations in the degree of non-acetylated, free amino groups,
O-succinoylation, and possibly molecular size, PIA; P/SA and PNAG are generally
40
accepted to represent same of chemical entity [Mack etal., 2009].
The first described in biofilm-forming S.epidermidis RP62A was PIA which
extracted from the cells by sonication after the strains culture in trypticase soy
broth, which revealed existence of both a major polysaccharide I (>80%), and a
minor polysaccharide II (<20%), the active PIA molecule requires expression of all
icaADBC genes [ Gotz, 2002].
IcaA belongs to the glycosyl- transferase two family , it is an integral membrane
protein with 412 a.a (amino acid) and four transmembrane domains ,and directs the
synthesis of b-1,6-linked GlcNAc oligosaccharides of up to 20 GlcNAc units but
IcaD is required for full activity of IcaA in vitro, It is a 101 a.a (amino acid)
integral membrane protein with two potential membrane spanning domains: it may
be a chaperone directing folding and membrane insertion of IcaA and may act as a
link between IcaA and IcaC ,so essential for the synthesis of fully functioning PIA
is IcaC, a 355 a.a integral membrane protein with ten predicted transmembrane
domains, which may be involved in externalization and elongation of the growing
polysaccharide [Gerke etal.,1998] also IcaB is member of family of polysaccharide
deacetylase, its mature forming , a 259 aa( amino acid) secreted protein with a
predicted signal sequence, which responsible for deacetylation of the poly-Nacetylglucosamine molecule[Christoph etal., 2014].
1.8 Poly-N-Acetyl-Glucosamine (PNAG)
Poly-N-Acetyl-Glucosamine is play important
role in S.
epidermidis
pathogenesis[ Mckeney,1998] , if the PNAG homologous on the gram negative
pathogens was immunological similar to staphylococcal pathogen , PNAG seemed
of great importance, since it could mean that a vaccine against PNAG could
potentially protect against several major human pathogens, the PNAG is
41
synthesized by proteins encoded by the icaADCB locus [Hogan and kater ,2002],
PNAG have several functions: it acts as an intercellular adhesion promoting cellto-cell aggregation, and its responsible for biofilm maturation [Vuong, 2004], in
Staphylococcus epidermidis, PNAG
synthesis, shown the IcaB inducing
deacetylation of PNAG , which was necessary for formation of biofilm and for its
association with bacterial cells surface [Otto,2009]( figure1.1).
Figure [1.1] Schematic overview of PIA synthesis (a) and the gene
arrangement in the ica operon (b) [ Otto,2009].
Poly-N-Acetyl-Glucosamine also plays a crucial role in the protection of
planktonic S.epidermidis cells from antibody-independent phagocytosis [Vuong,
2004].
S.epidermidis biofilms reached thicknesses of approximately 100 μm , however
42
the well-known increase in synthesis of PNAG associated with the formation of
biofilms by S.epidermidis
did not establish a barrier to antibody diffusion
throughout the biofilm, which indicates that this potential mechanism of resistance
to opsonic killing was unlikely to account for the reduced killing of cells, rather the
increased production of PNAG within the biofilm appeared to overwhelm the
antibody added and was able to inhibit killing of planktonic cells when the biofilm
matrix was mixed with antibody prior to use in a phagocytosis assay[cerca.2005].
Poly-N-Acetyl-Glucosamine also detecting in Staphylococcus. aureus, which
have new functions as enhanced the resistance of bacteria to antibody-independent
phagocytosis, while S.epidermidis
first PNAG identified was called PIA, as
polysaccharide intercellular adhesion, is based on acetylation of PNAG by icaB
gene, where partial deacetylation of PNAG results in its retention on bacterial cell
surface while secreted the highly-acetylated PNAG, acting as a decoy to adaptive
response of the immune system [cerca.2005](figure1.2).
43
Figure (1.2) S.epidermidis as a commensal and infectious microorganism
[Otto, 2009]
The PNAG molecule using as a target for vaccine development discovery of an
immunologically similar molecule to staphylococcal PNAG in several major
human pathogens indicates that these anti-staphylococcal vaccine might be using
against other infectious diseases agents, this character is the most important
virulence factors found in S.epidermidis and in biofilm form, bacteria are protected
from antimicrobial agents and the host immune system contributing to the
persistence of biofilm infections [Gomes etal., 2011].
1.9 Biofilm
Biofilm formation is a key factor in the establishment and persistence of
Staphylococcal infections in humans, animals, and on medical devices [Karaolis et
44
al., 2005], the ability to form biofilms on plastic devices is an important virulence
factor for S.epidermidis [Raad et al., 1998] or defined as “a structured community
of bacterial cells enclosed in a self-produced polymeric matrix and adherent to an
inert or living surface”[Costerton et al., 1999].
Bacterial biofilms are described as polymer-dipped communities of cells which
accumulate, in a precisely controlled manner, on the abiotic or biotic surfaces
[Boles et al., 2004] also Mohammad et al.,(2013) define biofilm as organized
communities of microorganisms embedded in a self-produced EPM , often
with great phylogenetic variety . So can be defined as a notoriously resistant to
immune system attack and antimicrobial agents, they are a huge problem in
medicine and industry, responsible for ≈65% of all bacterial infections [Del Pozo
and Patel , 2007] , so biofilm formation is the most important virulence factor of
S.epidermidis [Granslo, 2012] , these infections of S.epidermidis are dependent
on the species ability to adhere to artificial surfaces and to assemble biofilm
consortia [Mack et al., 2006] as well as biofilms are defined as the self-produced
extra polymeric matrices that comprises of sessile microbial community where the
cells are characterized by their attachment to either biotic or abiotic surfaces
[Vasudevan, 2014] , and its define as microorganisms encased in an extracellular
matrix consisting of components produced by the microorganism and derived from
the environment they grow in , while Fox and Vancraeynest ( 2006) have been
known biofilm as a
exopolysaccharide, a slime matrix around multiple layers of
cells .
Formation of biofilm is the most important factor for the establishment of
S.epidermidis
as a nosocomial pathogen [Hansen et al., 2007], When foreign
body material, as a prosthetic joint , is implanted, a thin biofilm like matrix is
formed
by the human
defense system, this matrix
consists
of different
extracellular matrix proteins [such as fibrinogen, fibronectin, and collagen
45
that allow the human tissue cells to adhere to the foreign body material ,
Device-associated biofilms are difficult to eradicate with sessile populations being
up to 1000-fold more resistant than planktonic (free-floating) [Gilbert etal., 1997] ,
this is attributable to a number of factors observed in biofilm populations (Table
1.3), including restricted penetration, decreased growth rate, a distinct genetic
phenotype [Fitzpatrick etal., 2005; O’Gara 2007], the expression of resistance
genes and the presence of biofilm persister cells [Roberts & Stewart 2005].
46
Table 1.3 Factors contributing to biofilm resistance [McCann etal.2008]
Restricted
Biofilms are enclosed within a protective
penetration
extrapolymeric substance matrix (composed of a
variety
of
components
including
exopolysaccharide, proteins and nucleic acids).
This acts as a physical barrier that restricts
access and penetration of some antimicrobial
agents.
Decreased
growth Antimicrobials designed to target metabolic
rate
pathways are more effective in killing rapidly
growing cells. Slow growth of biofilm cells
significantly
contributes
to
decreased
susceptibility of sessile populations to growthrate-dependent antimicrobials.
Distinct phenotype
Gene expression in biofilms characterises a
including
distinct
expression of
resistance to antimicrobials and the host immune
resistance genes
defence, thus enabling bacteria to persist through
physiological
status
that
confers
infection. Furthermore, acquisition of resistant
traits through lateral transfer of genetic material
occurs more efficiently in biofilm cells as
47
compared with their planktonic counterparts.
persister cells
The presence of persister cells and their
contribution
relatively
to
biofilm
resistance
is
a
new phenomenon. Persister are a
unique class of inactive but highly protected
cells that withstand a wide range of
Antimicrobial agents [Spoering&Lewis 2001],
providing greater antimicrobial protection in a
biofilm compared with a growing planktonic
population (Roberts & Stewart 2005).
Alteredchemical
Conditions present within a biofilm, including altered pH,
microenvironment
pO2, pCO2, divalent cation concentration, hydration level and
pyrimidine concentration, compromises the activity of certain
antimicrobials, including aminoglycosides, macrolides and
tetracyclines [Dunne,2003].
1.9.1 Biofilm structure
Basic structural units of a biofilm are microcolonies, separate communities of
bacterial cells embedded into EPS , these microcolonies are in most cases mushroom
shaped or rod like and they can consist of one or more types of bacteria [Macleod and
Costerton, 1990],depending on bacteria type, microcolonies consist of 10–25% of cells
and 79–90% of EPS matrix [Costerton, 1990],The quantity of extra polymeric
48
substances increases as the age progresses , In addition to polysaccharides and
metal ions, the bacterial biofilms comprises of bio molecules like DNA, protein,
lipids and organic substances (table 1.4), Very large amount of carbon and low
rates of nitrogen, phosphates and potassium inhibits the production of biofilms and
in contrast, slow bacterial growth enhances the formation of biofilms [Vasudevan,
2014].
Table 1.4Composition of biofilm [Vasudevan, 2014].
No.
1
Component
Water
Percentage of Matrix
Up to 97%
2
3
Microbial cells
Polysaccharides
2-5%
1-2%
4
Proteins
<1-2% (includes enzymes)
5
DNA and RNA
<1-2%
6
Ions
Bound and free
These different components signify the integrity of biofilms and protects biofilm
cells from (i) variety of environmental stress factors as pH change, UV radiation,
desiccation and osmotic stress. (ii) a physical barrier against diffusion of
antibiotics, defense substances, or other important compounds from the host
[Sutherland, 2001], as well as access of the nutrients for the enclosed
microorganisms.
Micro colonies of bacterial cells are separated by water channels that allow the
flow of nutrients, oxygen and microorganisms from one site to other through fluid
circulation and maintain the hydrated condition which provides a natural
environment for the survival of the enclosed microbial community[ Tolker, 2000].
Biofilms are heterogeneous in nature which comprises of thin base deposits
ranging from monolayer to several layers of cells consisting of water channels
49
[Oliveira and Cunha ,2008] , also biofilms not only comprises of microbial cells
and polymeric matrices but it consists of a variety of biomolecules including
proteins, enzymes and ions (Figure 1.3).
Figure 1 . 3: Diagrammatic representation of various components of bacterial
biofilms [Vasudevan , 2014]
1.9.2 Formation of Biofilm
Development of biofilm is considered a three-step process involving several
genes , most bacteria grow in a free living planktonic state( motile) , but
some are able to exhibit different phenotypes which differ in physiological
characteristics including metabolic changes and structure[Sauer etal., 2002].
Biofilm formation is a multifactorial process which is a collective product of
a variety of interactions and adaptive responses of the organisms within the
biofilms[ Olusola ,2010] , as well as biofilm is a complex process that requires
coordinated activities, the development of biofilm occurs in several steps. In the
50
first step, attachment, the bacteria, in a planktonic phase, contact with a surface,
either of foreign body material or human matrix, and try to adhere to it
(Figure 1.4).
Figure
1.4:Various
stages
of
biofilm
formation
and
development
[Vasudevan.2014]
S.epidermidis uses different cell wall associated adhesins called microbial
surface components recognizing adhesive matrix molecules[Davis etal., 2001],
which recognize specific polymers or proteins
a s the fibronectin binding
protein(Embp) [Rachel ,2002] and lipase GehD that binds to collagen, Another
cell surface located protein involved in the formation of S.epidermidis biofilm
is the autolysin AtlE, which acts as a promoter in the release of extracellular
DNA for the second step, growth or development of a mature biofilm
[Theerthankar etal.,2010 ].
Biofilm formation is more likely to be dependent on cell-to-cell adhesion rather
51
than on the amount of cells initially attached to the surface, cell-to-cell adhesion is
probably promoted by specific interactions and not influenced by the
physicochemical interactions of the bacteria and the attachment substrate [Nuno,
2005].
Matured biofilm has a three-dimensional structure( figure 1.5),built of the
extracellular substances
with an irregular
shapeof mushrooms,
often
connected to each other in the top, and channels, this form allows for a flow of
fluid, containing nutrients and oxygen, which can access bacteria deeper in the
biofilm layers, detachment of the biofilm begins When the mature biofilm and
cell density reaches to certain level, this s t e p is an important in the sense
that
it allows
the
bacteria
to
spread
and
colonies
other sites. In
staphylococci this mechanism is controlled by the agr Q.S system [ Otto, 2008] .
Figure 1.5 Biofilm forming by S. epidermis on a glass surface[Otto, 2002]
1.9.2 .1 Attachment
Planktonic bacteria (Motile) transform to sessile form prior to biofilm formation
as they adhere to a favorable surface; such as medical device or host tissue, in
some cases adhesins located on specialized organelles such as pili (fimbriae)
[Lasaro etal., 2009] , there are two stages of attachment; the reversible attachment
occurs when the organisms are able to revert back to the planktonic form and move
away from the surface of attachment but at the irreversible stage the organisms are
52
attached and biofilm formation is initiated[ Olusola,2010].
1.9.2.2 Formation of Microcolonies
Aggregate cells adhesion on the surface then divide in to daughter cells,
multiply upward and outward from the point of attachment to form cell clusters,
the dividing
cells
produce EPS , and
quorum
sensing
molecules, so
aggregating cells in microcolonies and biofilms attaches to surface on which it
is formed [Watnick and Kolter, 2000] , increasing number of organisms c a u s e
Micro colonies which become larger and increase of quantity of EPS produced
also increasing of signaling molecules and EPS are produced within microcolonies
i n this stage [Malic etal., 2009].
The fully mature biofilm structure comprises of bacterial cells, the polymer
matrix, and interstitial water channels that facilitate the exchange of nutrients and
wastes in and out of the biofilm into the surrounding environment [Sauer et al.,
2004].
1.9.2.3 Detachment and dispersal of biofilm organisms
High population density within a mature biofilm induced programmed
detachment of bacteria from biofilm by secretion of chemical substances by
bacteria or organisms [O’Toole et al., 2000], detachment occurs when the
organisms respond to chemical substances secreted by them such as signaling
molecules, proteins, degradative enzymes, and oxidative or nitro stress-inducing
molecules as nitric oxide (NO) produced from metabolic processes within a
biofilm [Schlag et al., 2007].
The degradative enzyme which is produced by biofilm organisms cleaves
polymer matrix into short oligosaccharides, increased detachment of biofilm
organisms [Barraud et al., 2006] ,optimal amounts of nutrients are inducing factor
53
for dispersal of bacterial biofilm by increasing the growth of bacteria and
production of Quorum sensing, which usually aid the dispersal processes within
the biofilm [Abdel-Aziz and Aeron.2014], also detachment of biofilm due to
nutrient starvation ,so detachment processes enhance the sloughing of biofilm and
switching of sessile organisms within biofilm to the planktonic, detached
bacteria disperse to other locations to recommence biofilm formation [Coulon
etal.,2012] , spread of biofilm infections within a host and sometimes this
might cause thromboembolism which could lead to death [Wenzel, 2007].
1.9.3 Quorum Sensing [QS]
Quorum sensing are one of the regulatory mechanisms which are similar to
types of decision-making process in which behavior is coordinated through a
"chemical vocabulary" and it used to cell-cell signaling, even between species [
Melke et al., 2010].
Cell-to-cell communication between bacteria involving the small
like molecules
called
auto inducers (AIs) ;
hormones
organism within environment
through production of signaling molecules, which required for full biofilm
formation ,It’s found i n d e ficient strains were able to cause infections and were
less susceptible to antimicrobials [Favre etal., 2003] although many virulence
factors do not depend on quorum sensing molecules [Schaber etal,2007 b] , QS
dependent phenotypes vary according to the site of isolation of the organisms, AIs
is a peptide in staphylococci, when t he level of AIs molecule reaches a
certain threshold, gene expression of this bacteria changes its ( figure 1.6) ,
most of research in Quorum Sensing done for S.aureus , but similar gene
complexes have been found in other staphylococci, as S. epidermidis [Dan
etal.,2012].
54
Quorum sensing system by staphylococci is the accessory gene regulator (agr)
gene complex agr gene. In Staph.aureus found to up regulate the synthesis of
exoproteins and down regulate surface proteins, so accessory gene regulator
system regulates in S.epidermidis is a significant part (approximately16%) of
the chromosomal genes as genes involved in cell division, virulence, and
metabolic adaptation.
Figure 1.6 Schematic overview of agr QS system in S. epidermidis [Novick and
Geisinger 2008].
The size of agr gene complex i s approximately 3.5 kb and comprises four
accessory gene regulator genes (agrB, agrD, agrC, and agrA), all transcribed
by RNAII. agrC and agrA regulate the expression of this autoinducing
peptide while AgrD encodes an autoinducing peptide (AIP), which is modified
55
and exported by agrB, the gene for delta-toxin ( hld) is located adjacent to
the agr complex and RNAIII is transcribed this gene [ figure 1.7].
Figure 1.7 different genes composing the agr complex and the adjacent
hld gene, with the transcripts RNAII and RNAIII marked [Gopal etal.,
2014].
Quorum sensing molecules production depends on the site of infection [Favre
etal.,2003] , also quorum sensing dependent phenotypes vary according to the site
,Various differences have been observed amongst the biofilms from the dental
plaque , from the wound, and from natural ecology like rocks or water especially
in their microbial population [Reardon etal.,2004] . Their extracellular matrix and
production of virulence factors [Favre-Bonte etal.,2007] , because QS play
important role of in the regulation of virulence factors via biofilm formation,
blockage of quorum sensing in pathogenic organisms has novel treatment strategy
especially in the control of biofilm infections [Bjarnsholt and Givskov, 2007].
1.10 Immune Defense
The immune system is a large and complex series of elements widely distributed
throughout the body, it has many functions, including protection against pathogens,
and reactions against foreign substances
[Peakman and vergani ,1997], two
categories of immune responses : innate or non-specific immune response and
adaptive or acquired immune response, highly specific of immune response to
particular pathogen humoral immunity involves molecules in solution of
biological fluids [Schwartz , 2003; Ravindar etal.,2015] , humoral immunity (also
56
called the antibody-mediated system) is the aspect of immunity that is mediated by
macromolecules found in extracellular fluids such as secreted antibodies,
complement proteins and certain antimicrobial peptides [Janeway , 2001]),
immunoglobulin bind and inactivate infectious agents, So the Cellular immunity
involves the development of immune cells that are able to recognize, bind, and kill
other cells that have previously been infected by foreign infectious agents [Thao
Doan et al.,2013].
1.10.1 Antibodies (Immunoglobulins)
Antibodies are defined as glycoprotein's (Immunoglobulin's) , synthesized by
lymph reticular system ( b-cell ) and released to the plasma and other body
fluids [Roitt and Male , 2002], they are produced after antigenic stimulus and react
specifically with that Ag induced their synthesis , Immunoglobulin's that react
specifically with antigen produced Ab-Ag complex [Roitt et al., ,2002], the most
important group is IgG, accounting for 70-75 % of the total immunoglobulin pool,
and about 80% from the immunoglobulins in the serum [ Cruse & Lewis, 2000],
during inflammatory process the IgG concentration in respiratory secretions can be
increased by more than 100 folding, It is essential in the secondary immune
response and plays an important role in killing of the microorganisms and toxin
neutralization, by binding to the bacteria or toxin and activated the classical
pathway which leads to destruction of bacteria[ Benjamini , et.al., 2000 ]. So
second isotype is IgM ( pentamer ) , accounts for approximately 5-10% of the
immunoglobulin pool , activity against organisms , rheumatoid factors and
natural antibodies as the ABO blood group [Cruse & Lewis , 2000], I.g.M is
essential in the primary immune response (early immunoglobulin) especially
bacterial
infection [Ehrenstein and Notley,2010], which it is more active in
classical pathway of the complement system[Litvack et al.,2011], as well as the
57
other Immunoglobulin is A is a major component of secretions which constitutes
5-15% of the total immunoglobulins in the serum , found in two forms : monomer
and dimmer, dimmer is associated with secretory component [Cruse & Lewis ,
2000 ].
1.10.2 Complement system:
complement system is an important part of the body defense mechanism
against infection [Fischbach,2000], that consists of about 30 proteins ; most of
these proteins ( glycoprotein ) are synthesized in liver [Matsushita etal.,2000] ,
the complement is a group of proteins which act in order to destroy invading
bacteria or other foreign cells , therefore complement test may be help diagnose
the cause of recurrent microbial infections , and acute or chronic autoimmune
disease ,increased total complement values are associated with most inflammatory
responses; but these concentration returns to normal
when the situation
is
resolved [Mary et al.,2009]
Complement system responds to bacterial infection much earlier than other
immunologic responses[ Sakamoto and Nishioka, 1992], Complement activation
by three pathway as classical, alternative and lectin pathway, cleavage of C3 and
C5 conceder a central of step pathways [Abe et al., 2001] , Acute phase responses
are major physiological phenomenon that associated with inflammation, which can
activation of complement system [Wolbink et al., 1996] , the essential component
for complement activation in all three pathways resulting
in bacterial lysis or
bacterial opsonization is C3 , which constitutes 70%of the total proteins in the
complement system [Rotllant et al.,2009], C3 may be used up in reactions that
occur in some antigen antibody reactions , it is synthesized in the liver ,
macrophages , fibroblasts , lymphoid cells , and skin [Thao Doan et al.,2013]
58
whilst C4 may be passed in the alternative complement pathway when immune
complexes are not involved, or it may be used up in very complicated series of
reactions that follow many antigen-antibody reactions[ Janssen et al.,2005].
1.10.3 C-reactive protein (CRP)
Is a member of a group of proteins called acute phase reactants , it is important
in activating complement , non-specific protein elevated in sera of patient´ during
acute stage of infection .It can be detected in the serum of normal people at low
levels , but increased when infection and inflammation as burns, trauma, active
inflammatory arthritis [Pitiphat et al., 2005]. C- reactive protein was originally
named because it reacts with the c-polypeptide of Pneumococci, its synthesized by
the liver in response of acute tissue damage , So CRP take part in innate immunity
in human [Chapel and Haeney , 1995],
1.10.4 Cytokines
Cytokines are low-molecular-weight soluble protein messengers ,involved in all
aspects of innate and adaptive immune responses, as cellular growth ,
differentiation, inflammation, and repair [Mahajan and Mehta, 2006],Cytokines
can be classified into two major categories, Th1 cytokines that drive cellular
immunity and Th2 cytokines that promote humoral immunity ,Th1/Th2 cytokine
balance reflects the type of immune responses that occur in the immune system
[Kidd , 2003], interleukins have many important functions by regulating cell
growth, differentiation, cell survival and apoptosis in several diseases [ Brumatti
et al.,2010]
Cytokines are produced by a variety cells which affect the behavior of other cells,
Cytokines are involved in almost every aspect of immunity and inflammation,
from acute phase response to all component of acquired immunity,they are not
59
specific for antigens [Fireman, 2006], these soluble mediators may locally bind to
receptors on the membrane of the same cell (in autocrine ); or on a target cell in
close proximity to producer cell (in paracrine ) or may exert (endocrine ) , when
they binding to specific cell surface receptor on the cell membrane, cytokines
initiate a cascade that leads to induction, enhancement or inhibition of a number of
cytokine-regulated genes [ Narin and Helbert, 2007, Murakami et al.,2015].
1.10.4.1 Interleukin 6
IL-6 is a pro-inflammatory cytokine which play important role in immunity,
which it induces growth and terminal differentiation of B cells; secretion of
immunoglobulins; activation differentiation T cells and macrophages[Lauta, 2003]
, role of interleukin-6 (IL-6) is very important because among proinflammatory
cytokines, IL-6 is reported to have a central role in the pathophysiological process
of adverse effect of inflammation in patients with renal failure[ Abass,2006].
IL-6 promotes the antitumor activity of macrophages, helps produce
lymphokine-activated killer cells, and protects neutrophils from apoptosis ,which
may increase their cytotoxic effect on tumor cells. Also, stimulated to increased
synthesis of CRP, also IL-6 indirectly influences binding to the phospholipids on
tumor cells, and activating C1q of the complement system , that may leading to
lysis tumor cell [Mohit et al., 2003], Overexpression of IL-6 play a role in
pathogenesis of many cancers, as malignancies [Lee and Margolin ,2011]
It plays a central role in host defense mechanisms as a major response against
inflammation, infection, and tissue injury [ Kindt et al., 2007], So it participates in
both innate and specific immunity and responses to microbes and to other
cytokines [Abbas., 2006], It also takes part in elimination of pathogens , IL-6 can
be detected in healthy individuals with a normal range, elevated levels of IL-6 in
60
the bloodstream are usually chronic rheumatoid factor (CRF) patients , severity of
diseases, associated with increased mortality , So elevation of IL-6 play a central
role relationship between inflammation, malnutrition and cardiovascular disease
[Kaysen, 2001] .
1.10.4.2 Interleukin 8
Interleukin 8 (or CXCL8) is a pro-inflammatory chemokine produced by
macrophages and other cell types such as epithelial cells, smooth muscle cells and
endothelial cells, a molecular weight of approximately 8 KDa. Furthermore,
CXCL8 can exist in monomer or dimer forms, which are capable of differentially
activating and regulating its two cell surface receptors [Nasser et al., 2009].
IL-8 has been implicated in a number of inflammatory diseases, including
rheumatoid arthritis and inflammatory bowel disease [Campbell et al., 2013].
1.10.5 Resistance of biofilm to immune system
The chemical substances produced by bacteria within biofilm resistance to body
immune mechanisms and antimicrobials , biofilm organisms grow at slow rate
which is factor enhances their ability to resist host immune mechanisms, and
antimicrobial interventions[ Rrohde,2007] . Biofilm organisms cause infections by
their resistance to the body immune mechanism and antimicrobials [Webster etal.,
2006],bacterial of biofilm were less susceptible to phagocytic killing after
opsonization with normal human serum [Mack etal., 2013].
Many demonstrative studies have confirmed the important role of biofilm in
compromising an individual’s immune system and it’s capable of resisted the
factors of host immune system, this is one of the reasons that infections as a
consequence of biofilms are rarely resolved by an individual’s own immune
system. The extra polymeric matrix is the first means of defense in favor of the
pathogen and the presence of exopolysaccharide alginate protects the microbial
61
cells from the process of phagocytosis where the macrophages and neutrophils fail
to engulf the microbial cells [Leid etal, 2009].
The lower level of phagocytic killing by polymorphonuclear(PMNs) in biofilm
positive wild-type bacteria by the inadequate opsonization of biofilm bacteria in vivo
[Kristian etal., 2008], Biofilm grow cell of S.epidermidis was kill less efficiently
than planktonic grow cells opsonized with antibodies raised against de-Nacetylated PIA/PNAG [Cerca etal., 2006].
Anti-PIA/PNAG antibodies diffused into S.epidermidis
biofilms sufficiently to
allowed opsonization, when observed by confocal microscopy [Cerca etal., 2006],
irrespective of mechanism of biofilm accumulation, polysaccharide intercellular
adhesion , accumulation associated protein, extracellular matrix bindig protein,
aggregated biofilm S.epidermidis
cells induce a lower inflammatory response in
macrophages than the disperse biofilm formed bacteria or biofilm negative mutants
,which may indicated another mechanism of how S.epidermidis remain below the
immune system in chronic infection[Schommer etal., 2011].
1.10.5 .1 Immune modulation by biofilms
Ability of biofilms to protect bacteria against host innate immune system is
important in S.epidermidis pathogenesis, PIA protects S.epidermidis from
effective phagocytosis by reducing opsonization of C3b and IgG binding on the
bacterial surface, also activation of the complement cascade mediated by PIA
biofilm [Kristian etal., 2008] and S.epidermidis
induce cytokine production by
human mononuclear cells (such as monocytes) in vitro [Härtel etal., 2008].
Both PIA and non-PIA biofilms protects S.epidermidis
from phagocytosis, by
lacking the contact between bacteria and PRRs (pattern recognition receptors) on
the leukocytes, and the induction of a poor NF-ĸB mediated macrophage
inflammatory response, lacking of contact between the macrophages and the
62
bacteria, also events modifying the macrophage function seem to take part in the
host failure to eradicate S.epidermidis during infections [Schommer etal., 2011].
1.10.5.2 Mechanism of biofilm resistance to body immune systems
The components of EPS of biofilm prevents phagocytosis of biofilm organisms,
older biofilm are high resistant than the younger biofilm to phagocytic actions of
poly morphonuclear neutrophils (PMNs) [Günther etal., 2009] , Some enzymes as
protease is virulence factor which causing damage host tissue and interfere
with host
antibacterial defence mechanisms [Ołdak and Trafny, 2005] , also
leucocytes( W.B.Cs) have able to penetrate and responded to biofilm of
Staphylococcus but the immune resistances and phagocytic organisms are high
in biofilm and protection by the EPS[Leid etal., 2005].
S. epidermidis had little susceptibility to phagocytic destruction by neutrophils,
supposedly due to higher mechanical biofilm stability[Gunther
etal., 2009],
neutrophils form a physical barrier on the surface of biofilms, at these sites of
neutrophil accumulation and frustrated phagocytosis, neutrophil intracellular
contents such as AMPs, and proinflammatory substances are often released,
harming the superficial layers of the biofilm [Scott and Krauss, 2012] ,also
S.epidermidis biofilms expressing poly-N-acetylglucosamine seem to be protected
against opsonic phagocytosis and can reduce IgG and complement component C3b
binding, allowing these bacteria to escape from neutrophil assault [Cerca, 2006;
Kristian, 2008], so extra polymeric matrix is the first means of defense in favor of
the pathogen and the presence of exopolysaccharide alginate protects the microbial
cells from the phagocytosis [Percival etal., 2011].
1.10.5.3 Immune response to biofilm formation
When bacteria form biofilm phenotype, they have different characteristics from
planktonic growth, as enhanced resistance to antimicrobials and differential gene
63
expression, as well as biofilm can protecting resident bacteria from the attack by
immune system [Otto, 2008].
Mature biofilm it can release antigens and stimulate production of antibodies, but
bacteria which stay within the biofilm are resistant to these defense mechanisms also
PNAG protects planktonic S.epidermidis bacteria against antibody independent
phagocytosis, PNAG is enhanced by opsonization, that involves antibody and
complement mediated phagocytosis [Kropec etal.,2005].
In order to understand the mechanisms of bacterial resistance of bacteria in biofilms
to immune system, evaluated antibodies penetration throughout biofilm and antibodymediated phagocytic killing of planktonic versus biofilm cells of S.epidermidis by
using a rabbit antibody to PNAG, these antibodies are opsonic and protect against
infection with planktonic cells of PNAG-positive S.epidermidis, the antibody to
PNAG readily penetration biofilm and bound to the same areas in biofilm, a lectin
known to bind to components of biofilms. However, the biofilm cell was more
resistant to opsonic killing than planktonic counterparts although producing more
PNAG per cell than planktonic cells, Biofilm extracts inhibited opsonic killing
mediated by antibody to PNAG, the PNAG antigen within biofilm matrix prevents
antibody binding nearly to bacterial cell surface, which needed for efficient opsonic
killing[Cerca etal., 2006].
Increasing resistance of biofilm cells to opsonic killing mediated by another
protective antibody was due not to a biofilm-specific phenotype, while high levels
of antigen within bacterial biofilm that prevented bacterial opsonization by the
antibody, the matrix of biofilms of S.epidermidis are composing mainly of large
exopolysaccharide , PNAG [Maira,2002],Production of PNAG a r e crucial for
S.epidermidis biofilm formation and are synthesis by gene product of the
icaADBC genecluster , so the production of pNAG/pIA
64
and
biofilm
formation are regulated by alternative sigma factor, sB [Gomes etal., 2011]
, opsonic antibodies to PNAG mediate protection against systemic infection by
S.epidermidis
where it’s called capsular polysaccharide/adhesion[kropec, 2005],
so the biofilm matrix can protecting bacteria from antibodies mediated
phagocytosis in presence of antibodies opsonically active against the planktonic
cells, by
large amount of PNAG antigen present within matrix,when the
minimizing antibodies binding to the bacterial cell surface, which it needs to
promote opsonic killing as well as found more PNAG produced per cell within
biofilm matrix, supporting conclusion that this large amount of antigen can inhibit
antibody binding to the bacterial cell surface, While PNAG is protect planktonic
bacteria against antibody-independent phagocytosis ,it appear that even in presence
of opsonic antibodies to PNAG and excess production of the target antigen within
the biofilm which can preventing efficient opsonic killing[Watnick and koiter
,2000; Lawrence etal.,2003].
1.11 Treatment and prevention of S.epidermidis
biofilm-associated
infections.
Biofilms act as a shield that protect bacterial cell from severe environmental
conditions such as metal toxicity, UV exposure, dehydration and salinity, acid
exposure and antibiotics or other antimicrobial agents as well as phagocytosis
[Hall-Stoodley etal., 2004].
The central problem with bacterial biofilm infections are propensity to resist
clearance by host immune system and antimicrobial agents ,when compared to
their free floating (planktonic) counterparts, bacteria within a biofilm (sessile)
are up to a 1000 times more resistant to antimicrobial agents[Stewart and
Costerton, 2001], so the factors which contribute to general resistance of biofilms
are:
65
- Decreasing growth rate of bacteria in a biofilm making them less susceptible
to antimicrobials through targete metabolic pathways.
- Restrict penetration of antimicrobial compounds.
A distinct phenotype that confers resistance to antimicrobials, host immune
defence and facilitates horizontal gene transfer, many strategies which using to
combat the biofilm infections can be summarized in table 1.5
The preventive strategies target functional molecules, gene systems and
regulatory, which controlling early stage of biofilm development, before
establishment of mature biofilms. Therapeutic strategies by the disintegration of
established biofilms and the quorum system perturbation, which leading to down
regulation of molecules stabilizing the biofilm architecture , or using the
enzymes in order to dissolve the biofilm matrix [Speziale et al. 2008] , or
modification of biomaterial surface to overcome
bacterial
colonization,
development of biomaterial ability to exerting antimicrobial action, all these
strategy is based on prophylactic using of antibiotic and including immersion,
coating and matrix loading, preventing microbial contamination from occurring
on the surface of the medical device in the first instance and therefore preventing
bacterial colonization and biofilm formation, so antimicrobial agents can reducing
the biofilm layer at sub inhibitoryconcentrations
, the Sub inhibitory
concentrations of various antibiotics is showing to both stimulate and impede
CONS biofilm formation, appearing of these effects to depend on the particular
strain and antimicrobial agent combination [Frank et al., 2007].
66
Table 1.5 Novel antibiofilm approaches (McCann et al., 2008)
67
Chapter Two
Materials and Methods
68
2- Materials and Methods
2-1Materials
Table 2.1.1 Apparatuses and equipment used in the present study.
Id
Equipment
Company ( origin)
1
Auto Elisa reader
beackman(Austria)
2
BACT
Biomericux (France )
3
Centrifuge
Hermle (Germany)
4
Digital camera
Disposable syringes
Canon (Japan)
Unolok-U.K.
4
Drying oven
Memmert (Germany)
5
Eppendorf tubes
Fischer( USA)
6
Electric Sensitive balance
Glass test tubes
(10ml)
Sartorius ( Germany)
Sterilin- U.K.
8
Light microscope
Olympus( japan)
9
Sp 3000 Nano system
Agung Suradiyo- Indonesia
10
Micro centrifuge
Biofuge(Germany)
11
Micro titer plate (96 well)
Sero-Wel(UK)
12
Microcentrifuge
Hettich (Germany)
13
Micropipette
Brand (Germany)
14
Microwave oven
Siga / USA
3
7
69
15
Thermo cycler
Techne TC-512(U.K)
16
Water bath
Memmert (Germany)
17
Vitek 2 system
Biomericux ( France )
18
Vortex mixer
plastic test tubes
Gallenhamp(USA)
Esplf(Germany)
PH meter
Jenway (England)
19
19
Table 2.1.2 Chemicals and biochemical materials:
Material
Acetic acid
Bovine serum albumin
Bradford protein assay
Cacl2
Congo Red Dye
C-reactive protein
Endo plat S.R.I.D
Ethanol alcohol
Glucose
Glycerol
HCl
Company ( Origin)
Riedel-Dehaeny (Germany)
CDH(India)
CDH(India)
BDH ( England )
Alfa Aesar ( America)
CDH(India)
Saofi diagnostics pasteus (U.S.A)
BDH ( England
Oxoid (England)
Himedia (India)
Oxoid (England)
Hydrogen peroxide
Interleukins kit ( IL6 and IL8)
Kcl
KH2PO4
Master mix
McFarland Standard set
N,N,N’,N’-tetramethyl
phenylenediamine dihydrochloride
BDH/ England
Immunotech( France)
BDH ( England )
BDH ( England )
Promeqa ( U.S.A)
Bio- merieux ( Francs)
BDH ( England )
70
Na2Hpo4
Nacl
NaoH
Sucrose
Tween 80
Vancomycin
Vitamins
BDH ( England )
BDH ( England )
Oxoid (England)
BDH ( England )
(India)
Oxoid (England)
2-1-3 Medium
The Medium used throughout the present study were shown in table 2-1-3.
Table 2.1.3: Medium used in the study.
Medium
Company ( Origin)
Agar agar
Baird – parkar medium
Blood agar base
Brain heart infusion agar
Brain heart infusion broth
DNase agar
Urea agar
Trypticase Soy Agar
Trypticase Soy Broth
Simmon citrate
Kligler iron agar
MacConkey Agar
Mannitol Salt Agar
Muller-Hinton Broth
Nutrient agar
Nutrient broth
Novobiocin disk (5 µg)
Himedia (India)
Himedia( India)
Oxoid (England)
Oxoid (England)
Oxoid(England)
Oxoid(England)
MAST
Biolife (England)
Oxoid(England))
Oxoid (England)
Oxoid (England)
Oxoid (England)
71
2.1.4 DNA primers design:
The primers used in this study in this table:
Table 2.1.4 DNA primers used in the present to amplify Ica A, Ica D
Prim
Sequence
er
type
ica
5′A-F TCTCTTGCAGGAGCAATCAA′3
ica
A-R
ica
D-F
5′TCAGGCACTAACATCCAGCA′3
5′ATGGTCAAGCCCAGACAGAG′3
Product
size (p.b)
Company
188
Takara
biotechnology
(China).
198
Takara
biotechnology
(China).
ica
D- R
5′CGTGTTTTCAACATTTAATGCA
A′3
The Gene Ruler 100 bp DNA ladder was used as a DNA
size marker, and visualized under ultraviolet
transillumination
72
Takara
biotechnology
(China).
2.2 Methods
2.2.1 Sterilization
Sterilization was achieved by heating; wet heat sterilization by autoclave at
121˚C/15 pound for 15 min. One more method used is filtration using 0.22 μm
filter unit. All equipment and materials used in this study were sterilized through
these two methods.
2.2.2 Preparation of Media used for isolation and identification of
bacteria:
All media (blood agar, Macconkey agar, Mannitol salt agar, Nutrient agar, and
Nutrient broth) were prepared according to the instructions fixed on its container.
They were brought to boil in a water bath to dissolve all constituents completely,
then sterilized by autoclaving at 121˚C for 15 min at 15 pound..The media were
incubated at 37 ˚c for 24 hours, to insure sterility.
2.2.3 Media used for detection of biofilm production:
Trypticase soy broth:
This media used for activating bacterial growth and enhance it to produce slime
layer.
Congo red agar (CRA) [Handke et al., 2004] :
This medium used for detection and identification slime production by
staph.epidermidis. It is composed in table 2.1.5
Modified Congo Red Agar (CRA) [Freeman etal., 1989]:
This media used for the detection and identification slime production by
staphylococcus epidermidis. It is same composed of Congo red agar (CRA) but
some modified as in table 2.1.5
73
Culturing the strains on New modified Congo red agar plates (new M.CRA or
vancomycin-modified CRA) [Kaiser etal., 2013]
The new CRA formula that gave the best results, which compositin showed in
table 2.1.5
Table 2.1.5: composetion of type of biofilm media
Composition (g/l)
brain–heart
broth
Blood
(BAB)
sucrose
agar
Type of biofilm media
Congo red agar
M.Congo red agar
infusion 37g/L
base 36 g/L
Glucose
agar
agar
15
g/L
Cong
red
0.8
g/L
-
New
M.Congo
red agar
37g/L
40 g/L
-
-
5%
10 g/L
-
2%
-
0.4
g/L
0.08%
NaCl
vancomycin
1.5%
0.5 mg/mL
All these ingredients were dissolved in distille water and complete to 900 ml of
D.W. excepted Congo red stain and autoclaving. Congo red stain was dissolved in
100 ml of D.W and autoclaving, it was added when the agar had cooled to 55C and
poured in sterile petri dishes, and plates with Congo red medium were incubated
aerobically for 24 hours at 37°C to obtain single bacterial colonies.
74
2.2.4 Reagent and solutions
2.2.4.1 Reagents: Api staph
Indicators
TDA Reagent
James Reagent
IND Reagent
VP1Reagent
VP2Reagent
Manufacturing company
( origin )
Biomerieux ( France )
Biomerieux ( France )
Biomerieux ( France )
Biomerieux ( France )
Biomerieux ( France )
Terta - Methyl-P-pheneylene- Fluka ( Germany)
BDH (England )
diamine.
Phenol red
2.2.4.2 Solution
Phosphate Buffer Saline (PBS):
Buffer solution was used in washing plate before staining. PBS components
from: 8 g NaCl , 0.2g KCl , 1,44g Na2HPO4, 0.27g KH2PO4 Were dissolved in
800 ml of deionized H2O ( dH2O). PH was adjusted to 7.4 with HCl or NaOH.
Final volume was completed to one liter by adding d H2O. Subsequently, the
solution was autoclaved and stored at room temperature [Sambrook et al., 1989].
Catalase reagent [Harley and Prescott, 2002]:
Hydrogen peroxide (H2O2) 3% was prepare to detected of catalase production,
Catalase is the enzyme that breaks hydrogen peroxide (H2O2) into H2O and O2.
1-Place a small amount of growth from bacterial culture on clean microscope slide.
If using colonies from a blood agar plate, be very careful not to scrape up any of
75
the blood agar, blood cells are catalase positive and any contaminating agar could
give a false positive.
2-Add a few drops of H2O2 onto the smear. If needed, mix with a toothpick ( Do
not use a metal loop or needle with H2O2 ; it will give a false positive and degrade
the metal.
Oxidase test
Basically, this is a test to see if an organism is an aerobe. It is a check for the
presence of the electron transport chain that is the final phase of aerobic
respiration. Normally, oxygen is the final electron acceptor for this system. In the
oxidase test, an artificial final electron acceptor (N, N,N’,N’-tetramethyl
phenylenediamine dihydrochloride) is used in the place of oxygen. This acceptor is
a chemical that changes color to a dark blue/purple when it takes the electron from
the last element (cytochrome oxidase) in the electron transport chain.
A piece of filter paper placed in a clean Petri dish and 2-3 drops of
freshly prepared Oxidase reagent (1%N,N,N,N-tetramethyle-p- phenylenediamine
dihydrochloride) were added to the filter paper. A colony from tested organisms
was transferred to the filter paper and rubbed onto the reagent with an applicator
stick.
McFarland standards are extensively used as turbidity standards for the
preparation of suspensions of microorganisms. The McFarland 0.5 standard has
various application in the preparation of bacterial inocula .
Agarose gel (1.6 %)
The procedure of Sambrook and Russell (2005) was followed. In brief, agarose
gel powder (1.6%) was prepared by dissolving 1.6 gram of agarose in 100 ml of
1X TBE buffer, heated in boiling water bath. then cooled to 50ºC.
Then, gel was mixed with 5µl of ethidium bromide at final concentrations reached
76
0.5 µg/ml was added thoroughly by gentle swirling. Subsequently, agarose solution
was poured into the chamber ; appropriate comb with 25 teeth was set on the
chamber and soaked in agarose gel ; the gel was left to set for 30 minutes at room
temperature; After final solidification the comb was carefully removed, the jar was
put in the electrophoresis tank and filled with TBE buffer.
The isolated DNA samples were electrophorized by loaded into the dedicated
wells, then exposed to an electric field (85 V for 1 hr.). Finally, The DNA bands
were examined under the UV light (300 nm) transmitted through the gel .
2.3 Patients
Six hundred and forty five (645 ) patients were included in this study which was
carried out in ( AL-Kindy , Imam Ali , Al- Wasete , Baghdad , Ibn Al- Balade )
Hospitals and teaching laboratories of Medical City Hospitals in Baghdad from
February -2014 to September -2014.
2.3.1 Grouping of patients and control
Patients were divided into three groups according to the following: bladder
catheter, septicemia, wounds - burns infections and skin and nasal swab from
hospital staff.
2.3.2 Collection of samples
2.3.2.1 Catheter Urine Sample
Catheter urine specimen was taken from patients, whom suffering from
indwelling bladder catheter.
77
2.3.2.2 Burn and Wound Swab
Direct swab were taken from patients whom suffering from burns or wounds
infections.
2.3.2.3 Blood Sample
Blood collected were taken from patients whom suffering from septicemia
(Diagnostic by physicians)
When blood is drawn from patients by using a syringe (10 ml), 2 ml each was
injected into blood culture bottles for indicated found bacterial pathogenic by using
Bact system, and others it is immediately transferred to a clean dry tube after the
needle has been removed, the blood is then allowed to clot for at least 10 to 15
minutes at room temperature and longer it allowed to stand in a refrigerator. After
that, the tube is centrifuged and the supernatant (serum) is removed and kept it in a
sterile container for laboratory investigation.
2.3.2.4 Control group
Blood and Direct swab were taken from skin and nasal healthy person as control
group.
2.4 Culturing of the samples.
2.4.1 Urine samples
Under aseptic conditions using standard bacteriological disposable plastic loop,
10 µl of uncetrifuged urine were streaked on MacConkey and Blood agar plates
and incubated at 37ºC for 24 hours, if no growth was detected, plates were reincubated for another 24 hours before reported negative cultures.
78
2.4.2 Swabs
Swabs from skin and nasal from hospital staff and from burn or wound infection
were cultured by streaking on blood and MacConkey agar, plates were incubated
aerobically overnight at 37ºC , if no growth was detected, plates were re-incubated
for another 24 hours before reported negative cultures.
2.4.3 Blood culture
For blood samples, 2 ml each was injected into blood culture bottles and
incubated at 37°C in an automated blood culture system (Bactec 9120 system).
2.4.4 Bacterial isolates
In this study isolated S. epidermidis isolates from four group study.
2.5 Identification of Isolated Bacteria:
They were identified as follows:
2.5.1 Macroscopic observations (Culture Characteristics)
Colonial morphology of grown bacteria on culture media, Colony size , color ,
elevation , edges , hemolysis on blood agar ( Fischbach, 2001).
2.5.2 Gram stains for isolated bacteria.
According to Fischbach (2001) were staining the isolated bacteria .
2.5.3 Growth on mannitol salt agar.
It is a selective and indicator medium for isolation of staphylococci. This
medium is used for motility and mannitol fermentation test.
2.5.4 Catalase test [Harley and Prescott, 2007].
79
Pure isolated colonies (suspected S.epidermidis) picked up by sterile wooden
stick, on microscope slide, using a dropper, place 1 drop of 3% H2O2 onto the
organism on the microscope slide, and observe for immediate bubble formation (O2
+ water = bubbles), indicating a positive test , negative result is no bubbles or only
a few scattered bubbles. Beark down of H2O2 into O2 and H2O is immediate by
catalase enzyme that produced by staphylococci, this test performed to differentiate
between staphylococci (positive) and streptococci (negative).
2.5.5 Coagulase test (slide method) [Vandepitte , 2003].
This method was used for rapid diagnosis, as the following:
1. Divide the slide into two sections with grease pencil. One should be labeled as
“test” and the other as “control
2. One drop of distilled water was placed on each area of divided slide.
3. Emulsify one or two colonies of Staphylococcus isolated on blood agar plate on
each drop to make a smooth suspension
4. The test suspension is treated with a drop of citrated plasma and mixed well ,
Clumped within 5-30 seconds is taken as positive results.
2.5.6 IMVIC Test
Indole test
This test was performed by inoculating the microorganism into peptone water,
incubated for 24-48 hours at 37ºC; 0.5 ml of Kovac s reagent was then added. The
broth was shaken well and examined after one minute. The formation of a red color
ring in the reagent layer indicates indole positive, and yellow ring indicates a
negative result.
80
Methyl red test
This test is employed to detect the production of sufficient acid during the
fermentation of glucose, after incubation period at 37ºC, 5 drops of the reagent
were added, the red color indicates a positive test.
Voges-proskauer (VP) test
This test is used to detect acid accumulation during glucose fermentation; a
positive reaction was indicated by presence of a pink color during 15 minutes.
Citrate utilization test.
A positive citrate utilization test indicated by the change of indicator color
(bromothymol blue)from green to blue color after inoculation of the Simmon´s
citrate agar with the tested microorganism.
2.5.7 Kligler iron agar
A positive fermentation of dextrose and lactose was indicated by the change of
phenol-red indicator color from red to yellow and raised the medium as a result of
gas production, and some microorganisms produce hydrogen sulphide (H2S) from
thiosulphate. The H2S reacts with iron-salts to produce a black precipitate.
2.5.8 Urease activity
Urease production was tested by inoculating the tested bacteria onto the tube
containing urea agar slant and incubated at 37ºC for 18-24 hours, a pink color is an
indicator for positive urease activity.
2.5.9 DNase production [Collee et al., 1996]
DNase agar was heavily streaked with the bacteria then incubated for 18- 24hrs
at 37°C. Flood the plate with Hydrochloric Acid. Leave the plate to stand for a few
81
minutes to allow the reagent to absorb into the plate. Decant excess hydrochloric
acid and then examine the plate within 5 minutes.
2.5.10 Novobiocin sensitivity test (5µg/disc) [Collee et al., 1996]
This test was used to distinguish among Staphylococcus spp. An overnight
bacterial culture broth was spread over a plate of Mueller-Hinton agar (2-1-5) by
sterile swab. A disc of Novobiocin 5µg was placed on the agar medium. Then the
plates were incubated at 37ºC for 24 hours and the inhibition zone around
the disc was measured (large zone of inhibition over 15 mm in diameter or
smaller inhibition zone )
2.5.11 Sugars fermentation [Kloos and Schleifer, 1994]
Determine the utilization of the sugars glucose , fructose, sucrose, maltose,
lactose, xylose, mannose, sorbitol, melobiose, nitrate reduction, presence of urease
,For the sugar fermentation test, commercially available disks specific for each
sugar were placed in tubes containing 2.5 ml Purple Broth Base medium.
Readings after 24, 48, and 72 h of incubation at 37oC.
2.5.12 API staph System:
Is an identification system for staphylococci, The API staph strip consists of 20
micro tubes containing dehydrated substrates.
These tubes were inoculated with bacterial suspension which reconstitutes the
media, during incubation ,metabolism produces color change either spontaneously
or revealed by the addition of reagents ( Fischbach, 2001).
Performance of the tests :
1- Preparation of the strips : 5 ml of water distributed into the hony combed wells
of the tray to create a humid chamber.
82
2- Performance of bacterial suspension : 5 ml of sterilized distilled water were put
into sterile ampoule , by using loop , a single well – isolated colony was removed
from an isolation plate and emulsified to give a suspension medium by rubbing
against the slide of tube , and well mixed , thoroughly with the water .
3- Inoculation of the strips : with a sterile Pasteur pipette , the twenty microtubes
were inoculated.
According to the manufactures instructions both the tube and the cupel section of
CIT , VP and GEL microtubes were filled, after inoculation the cupule section of
the ADH, LDC, ODC and URE microtubes were completely filled with sterile
mineral oil.
4- Incubation of strips : after inoculation ,the plastic lid was placed on the tray and
the galleries were incubated for (24 ) hours at 37 ˚C.
5- Reading the galleries : all the reactions not requiring reagent were recorded first
, then the following reagents were added to the corresponding microtubes .
A-One drop of TDA reagent to TDA microtubes the result appears immediately.
B - One drop of VP1, then of VP2 to the VP microtubes , the result appears after
10 minutes.
C- One drop of kovac ُ◌◌s reagent to IND microtubes , the result appears after 2
minutes.
Fermentation of the carbohydrates by Enterobacteriaceae being in the bottom of
the tube, while oxidative utilization of CHO in other bacteria ( pseudomonas and
acinetobacter ) being in the aerobic portion (top of the tube ).
A yellow color in the upper portion of the tube and a blue color in the bottom of
the tube indicates oxidative utilization of the microorganisms : by using the
analytical profile index , the biochemical profiles obtained have to be transformed
into numerical profile and compared it with those listed in the index.
83
2.5.13 Vitek 2 system
All S. epidermidis isolates were characterized using vitek 2 compact .The VITEK
2 is an automated microbial identification system . With its colorimetric reagent
cards, and associated hardware and software advances , the VITEK 2 offers a stateof the art technology platform for phenotypic identification methods.
2.5.13 .1 Reagent cards
The reagent cards have 64 wells that can each contain an individual test substrate.
Substrates measure various metabolic activities such as acidification, alkalinization,
enzyme hydrolysis, and growth in the presence of inhibitory substances. An
optically clear film present on both sides of the card allows for the appropriate level
of oxygen transmission while maintaining a sealed vessel.
That prevents contact with the organism-substrate admixtures.
Each card has a pre-inserted transfer tube used for inoculation (described below).
Cards have bar codes that contain information on product type, lot number,
expiration date, and a unique identifier that can be linked to the sample either
before or after loading the card onto the system. Figure 2.1 shows the GPcard.
84
Figure 2.1 VITEK 2 GP Colorimetric Identification
Card.
There are currently four reagent cards available for the identification of different
organism classes as follows:
1. GN - Gram-negative fermenting and non-fermenting bacilli
2. GP - Gram-positive cocci and non-spore-forming bacilli
3. YST - yeasts and yeast-like organisms
4. BCL - Gram-positive spore-forming bacilli
2.5.13 .2 Culture requirements
Culture requirements for appropriate culture and inoculum preparation ,these
parameters include acceptable culture media, culture age, incubation conditions, and
inoculum turbidity.
2.5.13 .3 Suspension Preparation
A sterile swab or applicator stick is used to transfer a sufficient number of
colonies of a pure culture and to suspend the microorganism in 3.0 mL of sterile
85
saline (aqueous 0.45% to 0.50% NaCl, pH 4.5 - 7.0) in a 12 x 75 mm clear plastic
(polystyrene) test tube.
The turbidity is adjusted accordingly and measured using a turbidity meter called
the DensiChekTM or macferland.
2.5.13 .4 Inoculation
Identification cards are inoculated with microorganism suspensions using an
integrated vacuum apparatus. A test tube containing the microorganism suspension
is placed into a special rack (cassette) and the identification card is placed in the
neighboring slot while inserting the transfer tube into the corresponding suspension
tube. The cassette can accommodate up to 10 tests into a vacuum chamber station.
After the vacuum is applied and air is re-introduced into the station, the organism
suspension is forced through the transfer tube into micro-channels that fill all the
test wells.
2.5.13 .5 Card Sealing and incubation
Inoculated cards are passed by a mechanism, which cuts off the transfer tube and
seals the card prior to loading into the carousel incubator. The carousel incubator
can accommodate up to 30 or up to 60 cards. All card types are incubated online at 35.5 + 1.0ºC. Each card is removed from the carousel incubator once
every 15 minutes, transported to the optical system for reaction readings, and then
returned to the incubator until the next read time.
2.6 Isolates storage
Isolates were stored frozen at −70 °C in nutrient broth containing 20 % glycerol.
Organisms were recovered from frozen stocks by plating out a 5 μl loop-full of
86
frozen broth onto horse blood agar and into 10 ml brain heart infusion broth then
incubating at 37 °C in air overnight.
2.7 Microscopic examination
The isolates were stained by gram stain to detect their response to stain, shapes
and their arrangement (Schleifer and Bell, 2009).
2.8 Biofilm study
Phenotypic characterization of slime-producing bacteria (qualitative method)
Qualitative detection of the phenotypic production of biofilm formation for all
strains was studied by:
2.8.1 Culturing the strains on plates
2.8.1.1Culturing the strains on Congo red agar plates [Handke etal., 2004]
2.8.1.2 Culturing the strains on Modified Congo Red Agar (M.CRA ).
2.8.1.3 Culturing the strains on New modified Congo red agar
plates (new M.CRA) [ Kaiser, 2013]
CRA, M.CRA and new M. CRA- the positive strains appeared as black colonies
with a rough, dry and crystalline consistency on media , while negative strains
remained red , smooth colonies with a darkening at the center.
87
2.8.2 Tube Method (TM) [Christensen etal., 1985]:Ten ml trypticase soya broth with 1% glucose was inoculated with the test
organism on nutrient agar individually. Broths were incubated at 37 ºC for 24
hours. The cultures were aspirated and the tubes were washed with phosphate
buffer saline pH 7.3. The tubes were dried and stained with 0.1% crystal violet.
Excess stain was removed. Tubes were dried in inverted position.
In positive biofilm formation, a visible stained film was seen along the walls and
bottom of the tube.
2.8.3 Quantitation of biofilm by tissue culture plate method (TCP)
or microtiter plate (M.t.p) [Christensen etal., 1985]:Quantitation of biofilm was performed by a spectrophotometric method
(microtiter plate or tissue culture plate as TCP), which measures the total biofilm
biomass, including bacterial cells and extracellular matrix.
In the present study, we screened the fifty clinical isolates of S.epidermidis for
their ability to form biofilm by microtiter plate method according to the works of
Christensen et al. (1985) with some modification
Staph. epidermidis isolated from fresh agar plates were inoculated in in 3 ml of
brain heart infusion ( BHI) with 1% glucose ( Mathur et al., 2006), broths
incubated at 37ºC for 24 h.
1. Individual wells of sterile 96 well-flat bottom polystyrene tissue culture treated
plates were filled with 200 µL of the diluted cultures and 200 μl aliquots of
only BHI + 1% glucose were dispensed into each of eight wells of the column
88
12 of microtiter plate to serve as a control ( to check non - specific binding and
sterility of media).
2.
After incubation (24 h at 37°C), the microtiter plates content of each well
was removed by tapping water or washed four times with 200 μL of phosphate
buffer saline (1 × PBS pH 7.2) to remove planktonic bacteria.
3. The plates were then inverted and blotted on paper towels and allowed to air
dry for 15 min.
4. Adherent organisms forming biofilms in plate were fixed with sodium acetate
(2%) and stained with crystal violet (0.1% w/v), and allowed to incubate at
room temperature for 15 min.
5. After removing the crystal violet solution, wells were washed three times with
1 × PBS to remove unbound dye.
6. Finally, all wells were filled by 200 μl ethanol (95%) to release the dye from
the cells and Optical density (OD) of stained adherent biofilm was obtained by
using micro ELISA auto reader at wavelength 550 nm.
To correct background staining, the OD values of the eight control wells were
averaged and subtracted from the mean OD value obtained for each strain. The
experiment was repeated three times separately for each strain and the average
values were calculated with standard deviation (SD) , Classification table 2.1.6
based on OD values obtained for individual strains were used.
89
Table 2.1.6: Classification of bacterial adherence by tissue culture plate
method [Christensen, 1985].
Mean 550 n.m
Adherence
Biofilm formation
< 0.120
Non
Non/ Weak
0.120 – 0.240
Moderately
Moderate
> 0.240
Strong
High
* multiply
2.9 Biofilm dry weight determination
The dry weight determination is one of the techniques to calculate the total
amount of biofilm biomass according to the works of Chandra etal., (2001) with
some modification, biofilm growing on plates for 24 h was scraped into 5 ml of
sterile water. Bacteria suspension was filtered through (0.45 μm) filter. Sample was
dried in the incubator at 105°C by 2 h and was again weighted; dry weight of
biofilm was calculated based on weight differences.
2.10 immune assay
2.10.1 Extraction of biofilm and estimation protein
2.10.2 Preparation Bacterial Antigen (Heat Killed Whomle Cell)
[Agren etal., 1998]
90
Heat killed whole cell bacterial antigen prepared as the following
1-Tube of 10 ml nutrient broth media were inoculated with 2-4 of a young
bacterial isolates a n d incubated at 37oC for 24 hours.
2-Centrifuged culture at 4000rpm for 15min, then discarded the supernatant and
washed the sediment three times in 5ml of phosphate buffer saline (PBS) by using
centrifuge at (3500) rpm for five min after mixing by vortex.
3- Re-suspended the sediment in 5ml of PBS by vortex and put the suspension in
water bath at 70oC for 1hour.
4-To make sure all bacteria was killed, cultured bacterial suspension on nutrient
agar media at 37oC for 24 hour.
5-Centrifuged killed bacterial suspension at 4000rpm for five min then sediment
was suspension in three ml of normal saline and used or stored in -20oC until use.
2.10.3 Production of antibodies
Blood was collected from patients and serum was separated [Rehman et al., 2002].
1. Collected blood and allowed it clot in an upright position for at least 30
minutes.
2. Centrifuge for 15 minutes at 1500 RPM.
3. Transfer the serum to a plastic screw-cap vial for transport to the laboratory and
serum was stored (frozen at −20°C) until needed.
2.10.4 Determine concentration of protein in sera of patients by Sp
3000 Nano System.
2.10.5 Agglutination antigens with antibodies [Reaper et al., 2010]
1- Coating all wells by 50 µl (1.5 × 10 ^8 CFU/mL) of S. epidermidis antigen
2- Add serial dilutions of patient’s serum antibodies (1:2, 1:4, 1:8, 1:16, 1:32, 1:64,
1:128, 1:256) to all wells.
3- Recorded the macroscopically agglutination titers, also evaluated microscopically
agglutination. all experiments were done in duplicate with 3 repeats.
91
2.10.6 Effect of protein sera of pateints on biofilm formation
[shahrooei, 2010]
1- The cultures diluted to an 0.005 at 600 nm were mixed with 10 µg/ml of sera
of patients and incubated for 2 h at 4°C.
2- Add 200 µ l of the mixtures (106 cells) to each well of 96-well polystyrene
microtiter plates, t h e n incubated overnight at 37°C without shaking.
3- Washed the plates three times with PBS then stained with 200 µl of 1%
(wt/vol) crystal violet for 10 min, t h e n washed the plates 3 times with water
and dried.
4- Added 1 6 0 µ l of 30% (vol/vol) acetic acid for quantification to each well to
dissolve the stain.
5- Then Measured the dissolved stain at 595 nm by an automated ELISA
microplate reader .
6- Percent inhibition of biofilm formation was calculated by using the following
formula:
Inhibition Percent of biofilm formation = (A595, positive - A595, antibody) /
(A595, positive - A595, negative) × 100% (Sun et al. 2005). S. epidermidis in
BHI without any added serum was used as positive control, and BHI without
bacteria was used as negative control.
92
2.10.7 Immunoglobulin and complement determination [Fahey and
Mchlevey, 1965]:
Single redial immunodiffusion (SRID) of Fahey and Mchlevey (1965) was
used to determine the serum concentration of (Igs and Complement component).
Endoplates were used to determine I.g.G, I.g.M, I.g.A, C3 and C4.
Performed as indicated by the producer.
Five μl serum from patient was used for each test. The plates were partly opened
for 5 minutes to eliminate moisture droplets.
- The plates were closed tightly and left on the bench at room temperature on
a level surface for 48 – 72 hours.
- The immunoprecipitation ring diameter was measured to the nearest
(0.1) mm by specific ruler.
- For each immunoglobulin and complement component a standard curve was
prepared by plotting the results of human reference sera of high, medium
and low concentration as shown in figure ( 1&2 ) in appendix 4
- The patient sample was determined by plotting the result on appropriate
standard curve, in figure ( 1&2 ) in appendix 4
Normal value:
IgG: 710 – 1520 mg / dl
IgM: 40 – 250 mg / dl
IgA: 90 – 310 mg / dl
C3 : 84 – 193 mg / dl
C4 : 20 – 40 mg / dl
2.10.8 C-Reactive Protein:
The principle of C.R.P:
When C.R.P that is present in serum reacts with IgG coated latex particles,
agglutination will occur, starting with the formation of a web between them. When
93
the latex reagent is mixed with the serum, a clear agglutination appears if the
serum contains approximately more than 6 mg/l of C- reactive protein.
Method:
- Place 50 μl of the serum on one section of the disposable slide.
- Place a drop of reagent next to the drop of serum.
- Mix both drops with a stirrer covering the whole surface of the slide section
.
- Gently rotate the slide for 2 minutes manually or on a rotary shaker( 80- 100
rpm ).
Look for the presence or absence of agglutination.
Positive reactions :
Strong positive (+++ ) : large clumping with clear background .
Moderate positive (++): moderate clumping with fluid slightly opaque in
background.
Weak positive (+): weak clumping with opaque fluid in background.
Negative reactions: no visible clumping; uniform suspension.
2.10.9 Estimation Serum Level of Interleukin (IL-6, IL-8)
Sera of patients (produced and non-produced biofilm) were estimated for level of
cytokines (IL-6, IL-8) by sandwich ELISA method that was based on similar
principles.
A. Kit Contents
I.
II.
ELISA plate: Blank 96-well plate
Capture antibody: Goat anti-human IL-6, IL-8 antibody.
III.
Detection antibody: Biotinylated anti-human IL-6, IL-8 antibody.
IV.
Standards: Recombinant human IL-6, IL-8
94
V.
VI.
VII.
VIII.
IX.
Avidin-HRP conjugate.
ABTS liquid substrate solution.
Washing buffer: 0.05% Tween-20 in phosphate buffer saline (PBS).
Block buffer: 1% bovine serum albumin (BSA) in PBS.
Diluent: 0.05% Tween-20 and 1% BSA in PBS.
B- Principles of Assay:
immunosorbent assay designed for quantitative measurement of IL-6, IL-8 in
human serum, This test is a one immunological step, sandwich type enzyme-linked
immunosorbent assay ,in which an anti-human IL-6, IL-8, coating antibody
(Capture Antibody) is adsorbed onto wells of 96-well plate. Human cytokine
present in the sample or standard binds to antibodies that were adsorbed to the
wells. A biotinylated anti-human cytokine antibody is added and binds to human
cytokine captured by the first antibody (Detection Antibody). Following
incubation, unbound biotinylated anti-human cytokine antibody is removed during
a wash step, and avidin horseradish peroxidase (HRP) conjugate is then added and
binds to the biotinylated anti-human cytokine antibody. Following incubation,
unbound avidin-HRP conjugate is removed during a wash step, and a substrate
solution reactive with HRP is added to the wells. A colored product is formed in
proportion to the amount of human cytokine present in the sample or standard. The
color development is monitored with ELISA plate reader and absorbance is
measured at a wave length of 450 nm, a standard curve is prepared from standard
dilutions and human cytokine sample level is determined from a curve fitting
equation.
95
C: Assay Procedure
Before carrying out the assay procedure of IL-6 & IL-8 determination, the
kit was left at room temperature (20-25ºC) for 20 minutes to equilibrate, as
suggested by the manufacturer. After that, the assay was carried out following the
instructions in the kit's leaflet, which are summarized in the following steps:
-One hundred microliters of standards or serum sample were added to
appropriate well of antibody pre-coated micro-titer plate and incubated for 1
hour at room temperature.
-Fifty micro liters of Anti-Human IL-6 or IL-8 polyclonal antibody conjugated
to
Biotin added to the wells, without discarding the standers or samples. Mixed
well, covered and incubated for 1 hours at room temperature.
-The contents of wells were aspirated, and each well was washed 5 times with
0.4 ml of washing solution, and then 100 µl of Avidin conjugated to Horseradish
peroxidase (HRP) were added to each well. Mixed well, covered and incubated for
1 hour at room temperature.
- Substrate solution was prepared no more than 15 min before the end of
incubation.
-Repeated wash procedure as in step 3, and then 100 µl of substrate solution were
added to each well. Covered and incubated for 15min at room temperature
One hundred micro liters of stop solution were added to each well and mixed well
,the absorbance was read at a wave length of 450 nm using ELISA reader.
D- Calculation of results:
The samples results were calculated by interpolation from a calibrator curve that
was performed in the same assay as that of the sample. By curve fitting equation
(Figure 2 &3 in appendix 5), drawn by plotting the IL-6, IL-8 concentration of the
96
calibrators on the horizontal axis and the absorbance on the vertical axis. By using
the computer.
2.11 Hemagglutination assays
2.11.1 Erythrocytes
Human blood collected with heparin was used to retrieve erythrocytes, by adding
5 ml of blood to 45 ml of saline solution which was then centrifuged twice at 2500
rpm for 10 min. Next, 100 µl of the pellet was added to 10 ml of a saline solution,
obtaining a 1% erythrocyte solution to be used in the hemagglutination assays.
2.11.2 Hemagglutination assay
The hemagglutination assay was performed as described Mack etal., with some
modifications. Briefly, S. epidermidis cells from an overnight culture in 37°C in
trypticase soy broth were grown in fresh TSB supplemented with 0.25% glucose
for 18 h. were harvested by centrifugation and washed once with PBS containing
0.1% bovine serum albumin, The bacterial re-suspended in saline, were adjusted to
a McFarland standard of 3.0 in PBS with 0.1% BSA, which correlated with ∼108
bacteria/ml.
Each cell suspension were made (100 µl) in 96 well (U-shaped) microtiter plates,
then 100 µl of the 1% erythrocyte solution solution (in PBS with 0.1% BSA) was
added to each well and to ensure thorough mixing of the bacteria and erythrocytes,
the total volume of each well was pipetted in and out with a micropipette.
Incubated at room temperature for 2 h. Hemagglutination titer were evaluated
macroscopically, Erythrocytes that appeared to be negative for macroscopic
hemagglutination were also evaluated microscopically. All experiments were done
in duplicate with 3 repeats.
97
2.12 Genetic Techniques
2.12.1 The DNA extraction method
After overnight culture on brain-heart infusion agar plates, one or two colonies
from a S. epidermidis isolate were suspended in 20 ml of sterile distilled water, and
the suspension was then heated at 100ºC for 20 min [Martin etal., 2002].
Table 2.1.7 PCR amplification parameter for the
conditions (Arciola et al., 2002)
Primers
(Forward
and
Reverse)
of icaA and icaD and
Cycling conditions
Initial
Final
Denaturation Annealing Extension
incubation
extension
icaA-For
icaA-Rev
94°C
5 min
94°C
30 sec
55.5°C
30 min
72°C
30 min
PCR Repeated for 35 cycles
icaD-For
icaD-Rev
94°C
5 min
95°C
30 sec
55.5°C
30 min
PCR Repeated for 35 cycles
72°C
30 min
72°C
1 min
72°C
1min
2.12.2 P.C.R
The presence of icaA and icaD, DNA were detected by polymerase chain
reaction using forward and reverse primers for icaA and icaD as described
previously.
A five μl aliquot (used a template for PCR amplification) .The sequences of
icaA and icaD were taken from the GenBank sequence database of the National
Center for Biotechnology Information [Arciola etal., 2002].
98
The reaction volume was 25 μL containing; forward and reverse primers (1 μL
each), together with 5 μL of the extracted DNA, 12.5 μL of master mix, and 5.5μL
of double distilled H2O (ddH2O) as in appendix 3. A thermal step program was
used, including the following parameters: incubation at 94°C for 5 minutes,
followed by 35 cycles at 94°C for 30sec. (denaturation), 55.5°C for 30 minutes
(annealing), and 72°C for 30 minutes after conclusion of the 35 cycles.
Amplification products were analyzed using 1.6% agarose gel during 50 min at
80V.The bands were stained with ethidium bromide (0.5 µg/ml) and after
electrophoresis; gels were seen under UV light.
2.13 Analysis of data Statistical analysis was performed by means of SPSS(
statistical package for social sciences ) 17.0 (SPSS Inc., Chicago, USA) software.
Comparisons between groups were performed using the chi-square test.
99
Chapter three
Results
and Discussions
100
3. RESULTS
3.1 Isolation of Bacteria
Many of pathogens are part of endogenous flora but some may have been
acquired by contamination from hospital staff or by contaminated solutions or
non-sterile equipment or from other patients.
Table 3.1: Number and percentage of bacteria isolated from different patients.
BACTERIAL ISOLATED
NUMBER AND PERCENT OF BACTERIA
ISOLATES( FROM 645 PATIENTS )
Number
%
Pseudomonas spp
85
19.9
Coagulase negative
73
17
Staphylococcus.aureus
70
16.4
Escherichia .coli
70
16.4
Klebsiella sp.
68
16
Proteus. Sp.
55
12.9
Serratia marcescens
6
1.4
Staphylococci
culture isolated
427
Non-culture isolated
218
Total
645
Results in table 3.1 showed samples cultures revealed 427 had bacterial isolates
from 645 pateints (while 218 non- culture isolate).
The most predominant pathogen was Pseudomonas spp (n = 85 ,19.9%), the
101
second most important microorganism which was isolated Coagulase negative
Staphylococci (n = 73 , 17%) followed by both S. aureus and E. coli (n = 70 ,
16.4%), followed by Klebsiella sp. (n = 68 , 16%), Proteus sp. (n = 55 , 12.9%)
and Serratia marcescens (n = 6 ,1.4%) isolated from study groups ( blood samples
, urine catheters and wound and burn swab as well as swab of skin and nasal of
hospital staff ).
Pseudomonas spp were the most common pathogen isolated from this study
groups (n = 85, 19.9%), which had became as important causing of infections,
especially in patients with compromised host defense mechanism, these study
results were fully in line with the results of Nwankwo(2014) who founded bacteria
appeared Pseudomonas spp. was commonest pathogen isolated from urine of
patients with indwelling urethral catheter .
These results also agreed with Singh etal., (2003) whom found Pseudomonas
species was most commonly isolated organisms from burn patients were
followed by S. aureus and Klebsiella species so these results were also in agree
with other studies [Ozumba and Jiburum 2000],while Mama etal., (2014) showed
the predominant bacteria isolated from infected wounds were Staphylococcus
aureus 47 (32.4%) followed by Escherichia coli 29 (20%), Proteus species 23 (16%),
Coagulase negative Staphylococci 21 (14.5%), Klebsiella pneumoniae 14 (10%) and
Pseudomonas aeruginosa 11 (8%) .
These bacteria may enter the bladder
through contamination of the tip during insertion with the flora of the distal
urethra or from bacteria ascending outside or the inside of catheter ,also
Getliffe (2008) showed in his study residual urine in the bladder of catheterized
patients increases the risk of bacteriuria , so wound infection is one of the health
102
problems that are caused and aggravated by invasion of pathogenic organisms
[Mama etal., 2014].
Bacteria, which ranked second in this study, were the Coagulase negative
staphylococcus 73(17%) from 427 isolated as follows Staphylococcus epidermidis
was mainly isolated from Coagulase negative staphylococcus represented 68.5%.
3.2 Biochemical tests
A series of biochemical tests that can be used to identification of bacteria
morphology, staining properties and can use selective or differential media to
aid in identifying bacterial species, motility and others various tests were
identify various metabolic properties of different bacterial species, as well as
biochemical test allows quickly identify an unknown isolate based on the color
changes that occur in the various tests.
Table 3.2: Biochemical tests and Novobiocin test for Coagulase negative
Staphylococci and Staph.aureus
BIOCHEMICAL TESTS
COAGULASE
NEGATIVE AND
S.AUREUS
Pigment
produce
Catalase Coagulase Oxidase
Nitrate
Novobiocin
reducing
resistance
Staph.epidermidis
White
+
-
-
+
-
Staph.saprophyticus
Yellow
+
-
-
+
+
Staph.lentus
White
+
-
-
+
-
103
Staph.heamolyticus
White
+
-
-
+
-
Staph.hominis
White
+
-
-
+
-
Staph. aureus
White
+
+
-
+
In table 3.2 the results showed all isolates of CONS species were produced
white pigment excepted S. saprophyticus which produce yellow pigment, and all
isolated gave negative result of the oxidase test , coagulase and novobiocin
resistance excepted S. saprophyticus, the catalase test was performed for all the
isolates and all of them produced catalase enzyme that differentiates
Staphylococcus from the Genus Streptococcus which gives negative result of the
catalase test, additionally nitrate reduction test was performed for further
identification because Staphylococcus spp. often reduce nitrate to nitrite. The
biochemical features of CONS species were corresponding with the
identification table of API Staph system, while Piccolomini etal.,(1994) Showed in
his study that low agreement between the API Staph and biochemical test for
identification of CONS which can be explained by the use of different incubation
times, substrate concentrations and/or sensitivity markers.
Couto etal.,(2001)and Thorberg etal.,(2009) showed that the conventional
biochemical analysis for the determination of staphylococcus at the species level
appears to be expensive, laborious and time consuming although it is considered as
gold standard for the identification of staphylococcus species. So all Isolates were
identified by using API Staph and VITEK-2 system according to the
104
manufacturer's instructions (see in material and methods), within 6 h., Vitek 2
correctly identified the commonly isolated strains; however, the limitations of the
method may lead to ambiguous findings [Thiago etal., 2014].The ability of the
VITEK 2 system to accurately give a rapid identification of clinically significant
bacteria by Garrote etal., ( 2000) ,the results of Layer etal., (2006) showed API
STAPH revealed more correct for identification of CNS, compared to VITEK
systems , moreover the results indicated by Matthews etal.,(1990) showed that
agreements of Vitek and API systems with conventional methods were 44.6% and
80.8% respectively , although additional tests were also required for final
identification.
Table 3.3: Coagulase negative Staphylococci groups isolated from different
clinical specimens.
BACTERIAL ISOLATED
NUMBER
%
S.epidermidis
50
68.5
S.saprophyticus
10
13.7
S.lentus
5
6.85
S.heamolyticus
5
6.85
S.hominis
3
4.1
Total
73
100
Results in table (3.3) indicated that S. epidermidis was mainly isolated
from study patients group (68.5%) ,Staphylococcus saprophyticus 13.7%, both
S.Lentus and S. haemolyticus were 6.85 % while S.hominis was 4.1%.
S.epidermidis is most commonly CONS isolated but other CONS species have
been shown to cause nosocomial, This variation in the frequency rates may be due
to variations in both environmental conditions and attitudes toward management
105
also geographical variations, or the types and severity of infection included in the
studies.
Coagulase negative staphylococci (CONS) have been identified as the
etiological agent in various infections so among the microorganisms most
frequently isolated in nosocomial infections also it cause wound and urinary tract
infections [Cunha et al.,2006].
While Al- Muhanna etal., (2014) reported that (53%) of S. haemolyticus, (26%)
S. epidermidis and (21% ) S. hominis were the most commonly isolated CONS
species from different clinical samples obtained from Iraqi patients undergoing
catheter related infections, while Al-Dahmoshi etal., (2013) demonstrated that
common type of bacterial CONS species from Patients in Hilla City were both
Staphylococcus epidermides and Staphylococcus saprophyticus (35.7%) , While
Begum etal. (2007), study showed S. haemolyticus (28.33%), S.epidermidis
(26.67%) and S. saprophyticus (18.33%) were the most commonly isolated CONS
species and this result is not significantly different from other reports where S.
epidermidis was the highest isolated followed by S. haemolyticus in clinical
infections, but Ali etal.,(2009) showed in his study 60% Coagulase negative
Staphylococci , which showed 27 isolates (45% ) regards S. epidermidis , 13
isolates (21.66%) S. saprophyticus, 10 isolates (16.67%) S. xylosus, 3 isolates
(5%) S. lentus ,two isolates (3.33%) S. heamolyticus and one isolate (1.67%) S.
simulans and other one isolate of S. hominis, this is similar to a work done by
Adeleye etal., (2010); Akinkunmi and Lamikanra,(2010) who showed isolated
similar CONS species from clinical samples.
S. epidermidis was the most isolated specie of CONS implicated in wound
infections and this is in accordance with similar works earlier reported [Duran et
al.,2010] , whilst study of Azuka and Idahosa ,(2013) Showen most commonly
isolated species were S.haemolyticus (28.3%), S. epidermidis (26.7%) and S.
106
saprophyticus (18.33%),others were S. simulans (10%), S. xylosus (10%), S.
chromogenes (15%) and S. schleiferi (1.67%).
Staph. epidermidis has more frequency 68.5%than other CONS bacteria , this
results is similar to Gad etal.,(2009) who show S. epidermidis represented 12.3%
while S. aureus represented 6.3%, also it is fully CONS is fully consistent with
the results of Arciola etal., (2001) who explained that 60 strains of S. epidermidis
were isolated from infections associated with the vascular catheter and 10
strains of S.epidermidis were isolated from the skin and mucous membranes of
healthy subjects.
Table 3.4: Prevalence of Staph.epidermidis in the study groups.
NO. OF
STUDY GROUPS
BACTERIAL
%
ISOLATED
Blood culture
30
60
Catheter urine specimen
11
22
Wound and burns swab
6
12
3
6
50
100
Swab of Skin and nasal
Hospital staff
Total
S.epidermidis is the most common cause of infections associated with catheters
and other indwelling medical devices, these bacteria are most prevalent bacteria of
the human skin and mucous membrane microflora, present unique problem in
diagnosis and treatment infections involved biofilm formation.
The results in table 3.4 showed blood samples occupied the first place in isolation
of Staph.epidermidis froming 60%, followed by catheter urine in the second 22% ,
107
Wound and burns swab (12%) as well as (6%) from swab of Skin and nasal hospital
staff. This is almost similar to the results of Mertens and Ghebremedhin (2013)
whom showed that 75% of the S. epidermidis isolates from blood culture, While
Donlan (2001) report found S.epidermidis is the most common cause of infections
associated with catheters and other indwelling medical devices, these bacteria are
most prevalent bacteria of the human skin and mucous membrane microflora, present
unique problem in diagnosis and treatment infections involved biofilm formation.
Mulu etal., (2012) showed in his study these organism i s a commensal or
normal flora on the skin, several investigations have reported these organisms
as common contaminants of wounds, and burns .Wound can contaminated by
microorganisms that migrate from
the urinary, respiratory and gastrointestinal
tract [Bowler etal.,2001],this indicates the idea of autoinfection that burns patients
suffer from in addition to the infection acquired from the burns unit itself [Collier,
2003]. As well as Gil etal., (2013) showed the biofilms
epidermidis strainsare responsible
produced
by S.
for a number of nosocomial infections
and infections on indwelling medical devices .
108
3.5 Sugar fermentation
Table 3.5: Sugar fermentation for Coagulase negative Staphylococci
bacterial strain.
CONS
BACTERIAL
STRAIN
SUGAR FERMENTATION
Xylose
Fructose
Sucrose
Maltose
Lactose
Staph.epidermidis
+
+
+
+
+
-
+
-
-
S.saprophyticus
+
+
+
+
+
-
+
+
+
S.lentus
+
+
+
-
+
+
+
+
+
S.heamolyticus
+
+
+
+
+
-
-
-
-
109
Mannose
sorbitol
Glucose
Mlebiose
Note: +
: positive reaction; - : negative reaction
S.hominis
+
+
+
+
+
-
-
-
-
Table 3.5 showed the staph.epidermidis isolated were none fermenting the xylose ,
sorbitole , mlebiose while fermented many sugar as positive results for glucose,
fructose, sucrose , maltose, lactose and mannose, this results in agreement with
[Ali etal.,2009].
Table 3.6: Identification of Staphylococcus. epidermidis by API Staph system.
Biochemical Test
Results
Negative control 0
Acidification of D-glucose GLU
Acidification of D-fructose FRU
Acidification of D-mannose MNE
Acidification of D-maltose MAL
Acidification of D-lactose LAC
Acidification of D-trehalose TRE
Acidification of D-mannitol MAN
Acidification of xylitol XLT
Acidification of D-melibiose MEL
Reduction of nitrate to nitrite NIT
Alkaline phosphatase PAL
Acetyl-methyl-carbinol production VP
Acidification of raffinose RAF
Acidification of xylose XYL
Acidification of sucrose SAC
Acidification of α-methyl-D-glucoside MDG
Acidification of N-acetyl glucoseamine NAG
Arginine dihydrolase ADH
Urease URE
Note: Staphylococcus epidermidis profile number (6706113)
109
+
+
+
+
+
+
+
+
+
-
Figure 3.1: code for Staphylococcus epidermis (6706113) by API
staph system.
API Staph System test is essential for accurate diagnosis of the bacterial
isolates in this study as well as the comparison method described up, In current
study, it appeared
S.epidermidis was (68.5%), S. saprophyticus 13.7%, both
S.Lentus and S. haemolyticus were 6.85 % while S.hominis was 4.1% , these results
confirm that the commercial identification kits are only of limited value in
identifying CONS isolates, as reported previously [Couto etal.,2001], but cunha
etal.,(2004) result showed Inaccurate identification by the API Staph method ,
while Couto, etal (2001) explained in study according to the API Staph System,
7 of the
isolates were characterized as S. aureus, 10 as S. xylosus, 2 as S.
epidermidis, 3 as S. warneri ,8 as S. cohnii a nd 4 as S. lentus ,however, 6 isolates
could not be identified .
API Staph System are rapid biochemical tests, also faster and less laborious
than classical biochemical characterization, but t a k e
110
at
least
24 h
for
appropriate results [Pascoli etal., 1986],most isolates tested were identified by API
Staph only to the genus level, because the results of the 20 biochemical reactions
were often identical for different staphylococcal species, a variation in a single
reaction could also cause a misidentification, In addition, tests such as reduction of
nitrate to nitrite, alkaline phosphatase and acetyl- methyl-carbinol production
(Voges–Proskauer reaction) were difficult to interpret [Couto et al., 2001].
Automicrobic VITEK system may represent a useful method for rapid
identification in coagulase-negative staphylococci [ Venditti et al., 1991].
3.7 Virulence factors
The virulence factors produced by Coagulase negative Staphylococci that
contribute to the pathogenesis of infections caused by these bacteria, CONS
pathogenicity has various metabolites are produced by these bacteria, including
enzymes such as lipases, lecithinase , DNAase and urease as well as produced
hemolysin and toxins.
Table 3.7: Virulence factors which produce by Coagulase negative Staphylococci.
CONS BCACTERIAL ISOLATES
VIRULENCE FACTOR
DNase Urease Lipase Lecithinase
Staph.epidermidis
-
+
+
-
Staph.saprophyticus
-
-
+
+
Staph.lentus
-
+
-
-
Staph.heamolyticus
-
-
-
-
Staph.hominis
-
+
-
-
Results in table 3.7 showed all S.epidermidis isolated were positive for
Urease and lipase while negative for DNase and Lecithinase . Staphylococci
111
release a large number of enzymes. Cunha etal.,showed of all CONS samples
isolated produced Lipase (17.1%), lecithinase (3.4%), DNAse (15.4%),
thermonuclease (7.7%), and enterotoxin (37.6%)
In the present investigation, except for S. epidermidis and S. saprophyticus,
all species non produced lipase as well as DNase ,Lipases play important role in
persistence of bacteria by providing a source of energy or by facilitating
adherence[Gribbon etal.,1993] as well as the lipases
can be
contribute
to
virulence by enabling bacteria to persist in the fatty secretions of the human
skin, and also interfering with phagocytosis, Otto(2004) study finding the lipase
of S. epidermidis can bind to collagen might constitute a novel role for lipase in
virulence , while Urease was produced by 18.1% of CNS isolates[Alkhafaje,
2011].
Results of Longauerova (2006) study showed urease production by S.simulans,
S. capitis, S. hominis, S. warneri, and S. caprae, urease which clearly functions as
important virulence factor, these findings are similar to those reported by Nataro
etal., (1994) and suggest that the infections caused by these microorganisms do not
only depend on virulence factors but also on the conditions that predispose the
host to infection, including factors innate and the use of invasive procedures.
Vuong (2000) stud y sho wed the S. epidermidis and other CONS are
caused infected , it has been shown that extracellular products like protease,
DNase, lipase, hemolysis, and other exoenzymes may be responsible for
tissue degradation and spreading of an infection caused by these bacteria.
112
Table 3.8: Distribution of staph.epidermidis isolates among gender and age in
relation to specimen types
GENDER
AGE
GROUP
NO. OF
PATIEN
STUDY GROUP
Male
No.
(%)
Femal
e
No.
(%)
Bloo
d
No.
(%)
Catheter
urine
specime
n
No.(%)
(YEARS
)
T (٪)
≤ 25
5(10)
4(80)
1(20)
3(60)
0(0)
26-45
9(18)
5(55.5)
4(44.4)
5(55.5)
46- 65
20(40)
7(35)
13(65)
> 65
16(32)
13(81.25
)
Swab
Woun of Skin
d and
and
burns nasal
swab hospita
No.
l staff
(%)
No.
(%)
1(20)
1(20)
4(44.4)
0(0)
0(0)
10(50)
5(25)
3(15)
2(10)
3(18.75)
12(75)
2(12.5)
2(12.5)
0(0)
21(42)
30(60)
11(22)
6(12)
3(6)
Total
50(100)
29(58)
In table 3.8 Most of the S.epidermidis was isolated from male patients (58 %)
compare to female (42%), because of male always in work and more have accident
from female.
So, the prevalence of S. epidermidis with age were peaked (40%) in the t h i r d
g r o u p (4 5 - 65) years, because in this age group including the worker in differ
jobs whom may have accident in worker or street or from bursting as well as many
of them may have other diseases as diabetic mellitus which play important factor in
all type of bacterial infections, followed (32%) in fourth age group (≥ 65),
113
In third age group (45- 65) the most bacterial isolated from four study groups
(blood, catheter urine specimen, wound and burns swab, as well as swab of skin
and nasal hospital staff) were (50, 25, 15, 10) % respectively.
Newman etal., (2006) have pointed out in their some of the risk factors for
bacteraemia
include old age, immunosuppression, chemotherapy and invasive
procedures.There was male preponderance in all age group, excepte in third group,
the proportion of females (65%) appeared higher than in males (35%), Taye
,(2005) showed in his study incidence
common in males (89.7%) than
of wound
infection
was more
in females (81.4%),this i n agree with
studies done in different parts of Ethiopia [Gelaw etal.,2011].
Biofilm assay
Detection of slime-production by S. epidermidis isolates
Ability of S. epidermidis to form slime can be inferred by phenotypic characteristic
when grown on congo red agar. Colonies of strains that produce Slime strains form
rough, black colonies, while the colonies that do not produce slime are red in color, as
those seen in Figure 3.2 which showed Phenotypic production and non-produced
slime by all investigated strains (from blood, catheter urine specimen, wound and
burns swab, as well as skin and nasal hospital staff swab).
114
A1-Biofilm producer and non-
A-2- Biofilm producer and
A-3- Biofilm producer and
producer on Congo-red agar
non-producer on modified
non-producer on new
Congo-red agar
modified Congo-red agar
B- Biofilm production by tube
C- MTP method
method
1- high biofilm producer 2- moderate
biofilm producer 3- non biofilm
producer
Strong
produced
biofilm
Moderate
produced
biofilm
Weak /non
produced
biofilm
1
2
3
115
Figure 3.2: (a) Biofilm producer and no producer on Congo-red agar, modified Congo-red agar
and new M.Congo-red agar, (b) Biofilm production by tube method and (c) Tissue culture plate
method for detection of biofilm production.
For the biofilm production By Congo red agar method, black colour colonies
were observed, 8 isolates gave black colors on Congo red agar while 42 isolates
gave pink colour indicating as non-biofilm production , also by Tube method,
visible thick film were obtained inside the wall of tubes and bottom of these tubes.
19 isolates were shown thick film inside the wall of the tube indicating strong
biofilm production while 31 isolates were not showing biofilm formation, while
result of Rewatkar and Wadher (2013), showing Congo red agar method gave
significant result 90% strong biofilm production as compared to the Tube
Method (83%).
Table 3.9: Number and percentage of biofilm form by S.epidermidis
detection by Congo red agar , modified Congo red agar and new modified
Congo red agar.
ISOLATED
BIOFILM
CONGO RED
MODIFIED
NEW
BACTERIAL FORMATION
AGAR
CONGO RED
MODIFIED
AGAR
CONGO RED
NUMBER (50)
NO. (%)
NO. (%)
AGAR
NO.(%)
High
3( 6)
2(4)
1(2)
Moderate
5( 10)
5( 10)
2( 4)
Weak / none
42( 84)
43( 86)
47(94)
Total
50( 100)
50( 100)
50( 100)
116
S.epidermidis is a frequent cause of nosocomial infections, the major virulence
factor is biofilm formation by these bacteria by gene products of the icaADBC
operon, S. epidermidis produces an extracellular slime that enables it to form
adherent biofilms on plastic surfaces, which can detected by Congo red agr and
others as Modified Congo red agar and new Modified Congo red agar as well as
others.
In Table 3.9 approximately 16 % of the isolates were biofilm producers with
Congo red agar method, although production level varied. In the biofilm positive S.
epidermidis strains on CRA , Modified CRA and New Modified CRA were 6,
4, 2 ,% respectively of isolates were strong producers, while 10 ,10 ,4% and 84, 86
, 94 % respectively were moderate and weak For this study]( see figure 3.2).
Results of this study show no differences between CRA , modified CRA and new
modified CRA these results resemble the findings of khudhur(2013) who showed
that there is no differences between Congo red agar and modified Congo red agar
methods ,strong biofilm formation was 6% in CRA compare to (4, 2) % to modified
CRA and new modified CRA (CRA mod plus vancomycin) respectively; also
moderate produced biofilm was 10% in CRA and modified CRA while 4% in new
modified CRA, This could explain through Kaiser etal.,(2013) who explained that
CRA mod plus vancomycin may be a promising tool and can help to determine the
real participation of S. epidermidis in the infectious process
Table 3.10: Detection of biofilm of S. epidermidis by phenotyping methods.
PHENOTYPE
NO. POSITIVE
NO. NEGATIVE
TOTAL NO
METHODS
NUMBER (%)
NUMBER (%)
(%)
CRA
8 (16)
42 (84)
50 (100)
Tube method
19 (38)
31 (62)
50 (100)
Microtiter plate
30 (60)
20 (40)
50 (100)
117
In table 3.10 showed the slime producing that was detected by three phenotyping
methods 60% of bacterial isolate were positive biofilm produced by microtiter plate
, while ( 38, 16%) respectively were positive for both tube and CRA methods, in
the same time table 3.10 showed negative result as ( 84 , 62 , 40%) respectively for
CRA, Tube and microtiter plate method .
The result showed S.epidermidis able to produced biofilm by tube method in 38%
while non in 62%, different results where AL-Omare et al.,( 2013) explained that
66% of the S. epidermidis isolates produced black colonies by tube method while
33% non-biofilm produce ,whilst Sujata et al.,( 2012) twenty two (73.3%) of the 30
adherent bacteria were slime producers as opposed to only 4 (16%) of the 25 nonadherent bacteria .
When comparing the results of both CRA , t u b e m e t h o d with T.C.P method,
although
16% of the total staphylococcal
isolates were positive by th ree
phenotype methods, Mathur et al., (2006) show low correspondence between
CRA and T.C.P methods where screening on CRA did not correlate with T.C.P
results except for 8/152 (5.2%) of staphylococcal isolates.
On the other hand Cafiso et al., (2004) showen better correlation between both
methods (CRA and T.C.P ) where all staphylococci positive by one test were
also positive by the other .
CRA method cannot recommend for detection of biofilm formation by
staphylococcal clinical isolates,While in earlier studies proposed CRA method as
an alternative to MTP.
Kudhur (2013 ) evidence that CRA method has been used as indirect indicator of
polysaccharide production, while tissue culture plate method was more sensitive for
slime layer detection, so Melo etal., (2013) study showed the microtitre test allowed
118
an easy and quantitative classification of the staphylococcal isolates also matching
results from both CRA and tissue culture plate were obtained with (87%) of the
strains screened.
Microtiter plate method was more sensitive for slime layer detection as the rate
of production was 51.42% from all isolates as compared with 31.42% positive
results in Congo red agar method[khuder,2013],whilst Melo etal., (2013) show the
results of the microtitre plate test was better than the CRA test in the detection of
biofilms in vitro, because of it’s a higher sensitivity (100%), so both MTP and CRA
assay can used to identify Staphylococci biofilm-producing strains, but MTP is the
gold standard [ Jain and Agarwal, 2009], because tissue culture plate test is an
economical quantitative technique and easy for direct detection of polysaccharide
production
because
spectrophotometric
measurements
provide
quantitative
information on the ability of bacterial strains to rapidly grow as well as it is a very
Percentage of biofilm
sensitive test, and it has low specificity[Stepanovic et al., 2000].
90
80
70
60
50
40
30
20
10
0
High
mod
weak
CRA
Tube .M
119
MTP
Figure 3.3: Congo red agar, microtiter plate, and tube methods for
detection of biofilm produced by Staph. Epidermidis.
The figure showed moderate were high percent in MTP (42%) while tube method
has (26%) and CRA (10%). Congo red agar method showed little correlation with
MTP assay where only (16 %) of the isolates were positive by both methods, so
MTP method, from the total number of 50 isolates tested for biofilm formation,
strong biofilm producers were 18 % and 42% moderate while 40% isolates were
considered as non or weak biofilm producers [Figure3.3].
Tube method detected 38% isolates as biofilm producers and 62% as non-biofilm
producers, as well as (84, 40) % respectively in CRA & T.C.P method as weak or
non-biofilm producer ,while Hassan reported (2003)the tube method detected 49%
isolates as biofilm producers and 51% as non-biofilm .
The results of Nasr (2012) are compatible with results of the study where the
88.6% of S. epidermidis isolated from urinary
tract catheterized
patients
produced biofilm by the MTP assay, while biofilm production analysis by
MTP method showed 37.5% S.epidermidis assessed as a biofilm formers by this
method[ wojtyczka etal., 2014], which agrees with the findings of Satorres and
Alcaraz (2 0 0 0 ), S o M T P method for screening staphylococcal isolates for
biofilm production being rather easy to perform, less time taking, sensitive and
specific[Ziebuhar, 2006].
In study of Gamal et al.,(2009) showed Staphylococcal strains were further
classified as high (56.6%), moderate (30.2%) and non-biofilm producers (13.2%),
So in results of Farran(2013) study showed (12%) very strong biofilm formation in
the wells, 58 (79.4%) moderate biofilm growth while (8.6%) no biofilm formation
120
,So Ansari etal.,(2015) are shown strongly positive by microtitre plate assay method
in (30%) S. epidermidis, while the remaining isolates were either moderate adherent
(40%) S. epidermidis or weak/non-biofilm producers (30%) S. epidermidis.
Table 3.11: Biofilm produced by three phenotype method according to
Source of S.epidermidis.
NO.NON-
PHENOTYPE
BIOFILM
SOURCE OF
STAPH
NO.
NO.OF
ISOLATE
METHODS USED
OF
PRODUC
TO DETECTION BIOFILM
ED (%)
BIOFILM
.EPIDERMIDIS
PRODUCE
R (%)
CRA
Tube
method
M.T.P
Blood
30
12(40)
18(60)
5
7
18
Catheter urine
11
5 (45.5)
6(54.5)
1
6
6
6
1 (16.7)
5(83.3)
1
5
5
3
2(66.7)
1(33.3)
1
1
1
50(68.6)
20(40)
30(60)
8(16)
19(38)
30(60)
Wound and
burns swab
Swab of skin
and nasal
hospital staff
Total No.(%)
Biofilm production was determined phenotypically by the Congo red agar
method, The CRA method should be used as a complementary test because of the
higher specificity relative to the Microtiter plate method.
Table 3.11 showed (16%) of the S. epidermidis isolates produced black colonies
on the Congo red agar (CRA) , S. epidermidis isolates, which were gained from
blood by (60 %), (54.5 %) of the isolates from urine catheters, wound and burns
swab produced biofilm phenotypically by 83.3% also 33.3% from swab of skin and
121
nasal hospital staff, while (40, 45.5, 16.7)% respectively of the S. epidermidis
isolates from blood culture , urine catheters and wound and burns swab as well as
(66.7%) from swab of skin and nasal hospital staff produced no biofilm
phenotypically. biofilm production is considered to be less in case of samples
collected from healthy skin when compared to those collected from people
associated with infections [ Arciola et al., 2001] .As study reported that 44.2% of
the samples that were collected from patients were strong biofilm-producers
compared to 0% of the samples that were isolated from healthy volunteers[Mateo
etal.,2007].
Ansari et al.,(2015) showed (80%) isolates of S. epidermidis ability to produce
black colonies, which are indicative of biofilm formation by CRA methods , while
Gamal etal., (2009), showed 88.6%of S. epidermidis were biofilm producers, as the
results of Arslan and Ozkarde(2007) explained that CRA method demonstrated
positive results in 38.5% of staphylococci isolated from clinical specimens.
PCR detection of IcaA, IcaD
All biofilm and non-biofilm producing S. epidermidis (50 isolate) were
performed by PCR detection genes which included the IcaA, IcaD genes for
identification and confirmation of biofilm producing strains. It was found that
some biofilm producing staphylococci strains were positive for IcaA also
positive for IcaD genes , giving 188 bp and 198 bp band for the IcaA and IcaD was
shown that in figure 3.4 .
122
Ladder
(100p.b)
Ladder
(100p.b)
Ica D
(198 P.b)
Ica A
(188 P.b)
Figure 3.4: Gel electrophoresis of PCR product for detection of Ica
A gene (188bp) and Ica D gene (198bp) using 1.6%agarose for 50
min at 80 volt .
Table 3.12: Relationship of phenotype and genotypic biofilm production
GENOTYPE
BIOFILM
ICA A / D(%)
Positive (%)
Negative (%)
Positive 22(44)
17 (77.3)
5 (22.7)
Negative 28 (56)
13 (46.4)
15(53.6)
30(60)
20(40)
Total
50(100)
123
PIA mediates intercellular adhesion essential for biofilm accumulation, and
have role in primary attachment to surfaces, in S. epidermidis intercellular
adhesion locus (ica) are required for biosynthesis PIA and biofilm form .
table 3.12 showed most positive both genotype (Ica A, Ica D) and biofilm
produced Were 17(77.3%) while negative for both of them and negative biofilm
were 15(53.6%) While 5(22.7%) were positive for Ica A / D and negative for
phenotype (biofilm produce) whilst 15 only out of 50 clinical strains are nonproducing slime and losing the Ica genes. That’s Probably, other factors besides the
ica genes may have an influence in biofilm formation, as environment, nutrition
inhibitory concentrations of diverse antibiotics, and stress (temperature, osmolality),
might have a significant role in biofilm formation, while Arciola and Vogel, (2000)
study that shown biofilm form in staphylococcus associated with the presence of
both IcaA and IcaD genes , whereas in some isolates presence of the Ica operon but
non biofilm production may be has the insertion of a sequence element, known as
IS256 [Cho, 2002]. As well as The biofilm formation by strains that did not have the
Ica genes in this study could be explained by the presence of other genes, such as
bap, which can compensate for a deficiency of Ica genes, according to other studies,
the bap gene in strains isolated facilitated biofilm formation [Cucarella et al., 2001],
As well as Chaieb etal., (2 0 0 5 ) determined higher proportion of IcaA/D-positive
isolates (72.7%), which phenotypically produced biofilm , In some Ica-positive
strains, biofilm production was not observed; this can be explained by an extreme
sensitivity of this feature to different environmental factors like antibiotic
concentration in a patient’s body, high temperature , stress , glucose level, etc.
[Frebourg et al., 2000].
Sujata et al., (2012) study showed twenty (86.9%) of the 23 ica positive bacteria
were slime producers, as opposed to only 6 (18.7%) of the 32 ica negative
bacteria, while Qin etal., (2007), suggested a novel molecular
124
mechanism
mediating biofilm formation
in these two clinical isolates two biofilm-
positive/ica-negative strains of S. epidermidis meaning did not detect these two
genes, on the other hand, some investigators have found no association between
presence of the Ica operon and biofilm formation by clinical isolates of S.
epidermidis [De silva et al., 2002].
In the study of Satorres and Alcaraz(2007) only one out of 65 staphylococci
was found to be biofilm negative by CRA while possessing the Ica A and
Ica D genes, also Dobinsky etal., (2003), evidence that expression of Ica m-RNA
in biofilm negative S. epidermidis or biofilm
producing
strains
under
experimental conditions which did not promote biofilm formation, that biofilm
accumulation is controlled by regulatory mechanisms other than the Ica
operon,While Gad etal.(2009) reported showed all Staphylococcal biofilm producing strain
were positive for IcaA and Ica D, also Zhou etal.,(2013) found all isolated S.
epidermdis slime positive strains were positive for the icaA, the co-expression of
mecA and icaD was associated with enhanced resistance to antibiotics, as well as
Muhammad (2013) study showed all S. epidermidis slime positive isolates were
icaA positive, There was a greater correlation between the presence of both icaA
and icaD and the slime production than the single expression of icaA or icaD and
the presence of slime in all groups .
125
Table 3.13: Presence and absence of each Ica gene in clinical and non-clinical
strains.
NUMBER
SOURCES OF
ICAA
ICAA
ICAD
ICAD
+( % )
_( % )
+(% )
_(% )
OF
S.EPIDERMIDIS
ISOLATE
Blood
30(60)
10(33.3) 20(66.7) 8(26.7)
22(73.3)
Catheter urine specimen
11(22)
5(45.4)
6(54.6)
4(36.3)
7(63.7)
Wound and burns swab
6(12)
5(83.3)
1(16.7)
5(83.3)
1(16.7)
3(6)
2(66.7)
1(33.3)
2(66.7)
1(33.3)
50(100)
22(44)
28(56)
19(38)
31(62)
Swab of Skin and nasal
hospital staff
Total
In table 3.13 showed prevalence of IcaA, IcaD genes were (56,38)% respectively ,
The results indicated that the IcaA gene had the highest rate in blood culture (33.3%)
and Catheter urine specimen (45.4%) followed by IcaD gene which was detected in
26.7% of blood culture while (36.3%) of catheter urine specimen. The prevalence of
IcaA gene (44%) was highly versus that of IcaD gene (38%).
Several studies have shown that formation of biofilm in staphylococci
causing catheter associated and nosocomial infections with presence of both
icaA and icaD genes [Vogel etal.,2000 ; Arciola etal.,2002 ;Satorres and Alcaraz
,2007], co expression
of these genes is necessary
for
the full phenotypic
expression of biofilm in clinical staphylococcal isolates [Cafiso etal.,2004].
In S. epidermidis detection of Ica locus is a good predictor of biofilm formation
for distinguishing
blood and
catheter related
infecting
organisms
contaminating bacteria [Aricola et al., 2005], so Satorres and Alcaraz
126
from
(2007)
reported that 42.2% of S. epidermidis isolated from blood and intravascular catheter
were positive for IcaA and Ica D genes.
In Eftekhar (2 0 0 9 ) study showed 30% of the samples collected from patients
were ica positive compared to 8% of the samples collected from healthy individuals
,in another study, 53% of the samples isolated from patients were ica positive
compared to 0% of samples collected from healthy volunteers[El-Din etal., 2000].
Table 3.14: Relationships between phenotype (biofilm production in three
methods) and genotype (presence of Ica A, Ica D genes)
PRESENCE
CRA
/ ABSENCE
TUBE METHOD
MICROTITER
PLATE
GENES
( +)
(-)
( +)
(-)
( +)
(-)
Ica A (+)
7
-
15
0
17
5
Ica A (-)
1
42
4
31
13
15
Total
8
42
19
31
30
20
Ica D (+)
7
1
12
7
15
4
Ica D (-)
1
41
7
24
15
16
Total
8
42
19
31
30
20
The icaADBC gene locus of S. epidermidis contains genes essential for PIA
synthesis , a polysaccharide intercellular adhesion (PIA), which plays an essential
role in the S. epidermidis biofilm accumulation by mediating cell-to-cell adhesion
and is expressed by the majority of biofilm-producing clinical S. epidermidis
isolates, which can be detected by three phenotype method (CRA agar , tube
method and MTP methods).
Results of colony phenotype on CRA plates showed that 7 isolates formed black
colonies on CRA agar (potential biofilm producers) and positive for both ica genes
127
( A and D) (Figure 3.4), in total, 15,12 strain of S.epidermidis were positive for
both (Ica A and Ica D) and produced biofilm by tube method while 17, 15 strain
were positive to both IcaA and IcaD by MTP methods.
Best correlated with a positive CRA test and presence of the genes [Arciola et
al., 2005; Jain and Agarwal, 2009], so ica positive S. epidermidis in Chennai
population which is an alarming finding since ica operon is associated with strong
biofilm formation, also several studies have reported a higher frequency of
distribution of ica locus in clinical isolates of S. epidermidis, and its utility as a
virulence marker [ Ziebuhr et al., 2001; Arciola et al., 2001, 2002].
Also results in Table 3.14 shown presence of Ica genes did not always correlate
with biofilm production. De silva etal., (2 0 0 2 ) reported that shown only 59% of
S. epidermidis strains positive for Ica operon were biofilm producers by CRA
method ,in correlating also to MTP method, whilst Cafiso etal., (2 0 0 4 )
demonstrated that 83.3% of the Ica-positive isolates produced biofilm by this
methods(MTP) , while Yazdani
etal., (2 0 0 6 ) reported that only 54% and
52% of Ica positive were also positive by CRA and MTP methods respectively
, So Arciola etal., (2 0 0 5 ) reported that (IcaA/IcaD+)/MTP- strains represented
8%, however (IcaA/ IcaD + )/MTP+ strains were 16% , while in the study of
Oliveira and Cunha (2 0 1 0 ) one CONS was classified as strongly adherent by
MTP assay but did not carry any of the Ica genes.
The presence of Ica operon is always associated with biofilm formation but the
absence of Ica operon is not always associated with absence of biofilm formation.
In fact, one sample in which Ica operon was not detected showed a strong biofilm
forming capability, this confirms the fact that multiple genes are involved in
biofilm production and Ica operon alone is not a crucial cluster for causing an
implant associated infection, that’s mean Ica genes didn’t always correlate with
128
biofilm production. , but De Silva (2 0 0 2 ) showed the relationships between
presence of the Ica operon and phenotype, of the 49 S. epidermidis strains found
positive for the Ica operon, 29 (59%) were found to be biofilm producers by the
CRA method, as well as all of the S. epidermidis strains which lacked the Ica
operon were found to be CRA negative [Gad etal., 2009].
Also present study showed five and four S.epidermidis strain were negative
biofilm produced by MTP although possession Ica A and Ica D respectively , Melo
etal., (2013)was founded low correlation between the results of the PCR-based
analysis and CRA test, this finding indicates that CRA test produces a high number
of false negatives, this is in contrast with other studies which reported that
Dhanawade et al., (2010) showed results CRA and microtitre plate tests were
significantly correlated with the molecular analysis ,While Jain and Agarwal
(2 0 0 9 ) showed the presence of genes was best correlated with a positive CRA test
.3.5 Hemagglutinin assay
Hemagglutinin of S.epidermidis may play a major role in the adherence of this
organism to
polymer
containing
biomaterials.
Thus,
hemagglutinin
S.epidermidis may be a virulence factor in the pathogenesis of infection.
129
of
Figure 3.5: Hemagglutination among S.epidermidis isolates responsible for
infection.
Figure showed ability of S. epidermidis to hemagglutination of erythrocytes
was shown to be associated with the ability to adhere to plastic and to produce
biofilm .
He magglutination may be important for the pathogenesis of S. epidermidis
infections [Rupp et al., 1995], as well as Mack etal., (1999) showed the
hemagglutination of erythrocytes is common property of Staphylococcus
epidermidis strains, which related to biofilm formation and also may be essential
for pathogenesis of S. epidermidis also Mack et al., (2006) Showed the functional
relation between PIA and hemagglutinin of S. epidermidis .
In results Cerca’s (2004) study show the S. epidermidis isolates has able to cause
haemagglutination , as well as hemagglutination of erythrocytes is a common
property of Staphylococcus epidermidis strains, which is related to adherence and
biofilm formation and may be essential for pathogenesis of biomaterial-associated
infections caused by S. epidermidis[Mack et al., 1999].
130
PNAG/PIA also can agglutinate erythrocytes [Rupp and Archer, 1992] as well
as a direct relation was founded between ability of S. epidermidis to agglutinate
erythrocytes and form biofilm [Cerca et al., 2004], So strains that produced
biofilm were more likely to mediate hemagglutination, this results are confirm with
Fey (1999) who showed (16 biofilm-positive/hemagglutination-positive strains and
19 biofilm-negative/hemagglutination-negative strains) within the 39 clinical
strains tested and production of PIA and strongly hemagglutination in S.
epidermidis .
Since biofilms formed in vivo in an infected host develop over a long period
of time, and biofilm properties change with age [Neu etal., 1997], it was
hypothesized that changes in availability of nutrients over time could influence
the amount of a S. epidermidis biofilm, when biofilms formed under batch
mode, so amount of biofilm slightly increased with biofilm age [ Cerca et al.,
2004].
3.6 Dry weight of biofilm
The dry weight measurement is o n e o f technique to determine the total
biomass of biofilm [Chandra et al., 2001].
Figure 3.6: Dry weight of biofilm of S.epidermidis.
131
In figure 3.6 appearance the dry weights of biofilm to S.epidermidis which
calculated weight before and after put biofilm, From the difference between these
two values dry weight of biofilm , and the mean of dry weights of biofilm w h i c h
f o r me d b y staph.epidermidis.
Dry Weights of Biofilms isolated from different samples ( blood , catheter urine
, wound and burns swab as well as swab of skin and nasal hospital staff ranged
from ( 2.2 – 2.8 mg) ( see figure 3.6).
The amount of biofilm slightly increased with the biofilm age. However, no
statistically significant differences were found between the amounts of biofilm
formed among the isolates strains, a good correlation was found between the
amount of biofilm formed and the haemagglutination , consistent with the results
of some studies, such as cerca whom explained that whenever the large amount of
biofilm given high level of agglutination [Cerca et al., 2004].
132
Table 3.15: Relationship between biofilm formation, Hemagglutination assay and
dry weight of biofilm in staph.epidermidis
SOURCE OF
S.EPIDERMIDIS
MTP
METHOD
(+)
HEMAGGLUTINATION
MEAN OF DRY
ASSAY
WEIGHTS
ICA
A(+)
Macroscopically
BIOFILM (TOTAL
Microscopically
+
-
+
-
BIOMASS)(MG)
Blood
18
10
6
12
8
10
2.7
Catheter urine
6
5
5
1
6
0
2.8
5
5
2
3
3
2
2.8
1
2
0
1
1
0
2.2
30
22
13
17
18
12
Wound and
burns swab
swab of skin and
nasal hospital
staff
Total No.
Hemagglutination may play a role in the pathogenesis of infections or may serve
as alternative marker for adherence isolates, by microtiter plate assay,
Table 3.15 results showed 13, 18 of the 30 strains, were the relationship between
positive both (Macroscopically and microscopically) hemagglutination assay
respectively and biofilm formation, So in this measurement studies it was shown
that the Mean of Dry weights of 24-h biofilm w h i c h f o r me d b y S.epidermidis
which isolated from blood was equal to 2.7 mg, and 6 out of 18 isolates have
positive macroscopically hemaglutination assay and 8 isolates have positive
microscopically hemaglutination assay ,while ( 5, 6 and 2,3) isolates have positive
macroscopically and microscopically hemaglutination assay respectively with 2.8
133
mg were Mean of Dry weights of biofilm w h i c h f o r m e d b y staph.epidermidis
which isolated from both Catheter urine and Wound and burns swab while only one
isolate isolated from swab of skin and nasal hospital staff has positive
microscopically hemaglutination assay but negative macroscopically with Mean of
Dry weights biofilm were equal to 2.7 mg, these results indicate no relationship was
founded between the amount of biofilm formed and form of biofilm but increasing
when increased age of biofilm, Compatible with what expounded cerca etal.,(2005)
that showed the biofilm formation is more likely to be dependent on cell-to-cell
adhesion rather than on the amount of cells initially attached to the surface ,these
results indicate high levels of initial adherence don’t necessarily to thick biofilm
formation.
134
This is entirely consistent with Cerca, etal., (2005) in his studies have shown for 9
of the 11 strains, was derived describing the relationship between biofilm
formation and hemagglutination , hemagglutinating isolates were significantly
more likely to be recovered in high number from blood culture comparing to
catheters urine (18, 6) strains respectively, also this study appearance a strong
correlation between hemagglutination (18 strain) and Ica A genes (22 strain).as
well as results of Fey etal.,(1999) whom showed that relationship between biofilm
formation and hemagglutination in S.epidermidis , and the presence of icaA, a
strong association existed between biofilm formation, and hemagglutination .
PIA and Ica-containing plasmid, is not only able to mediate biofilm formation on
glass but is also able to mediate hemagglutination , therefore, PIA is involved in
both intercellular adhesion between individual S. epidermidis cells and adherence
to erythrocytes, causing hemagglutination,this may allow S. epidermidis to
colonize biomaterials that are associated with host cellular milieu, including
erythrocytes as well as Fey etal., (1999) showing the strong between biofilm
formation, which has been linked to strains that produce polysaccharide
intercellular adhesion (PIA), and hemagglutination .
PIA as the hemagglutinin of S. epidermidis or at least as a major functional
component [Mack etal., 1999], mechanism of hemagglutination mediated by PIA
could be related to co-interactions of the differentially charged polysaccharide
species with the negatively charged surface of the erythrocyte, but purified PIA
inhibits hemagglutination, PIA might interact with a specific receptor for the
hemagglutinin on the erythrocyte surface [Gerke et al., 1998].
Cafiso (2004) reported that co-expression of icaA can increase slime production
remarkably .However, there is not always agreement in the conclusions regarding
135
biofilm formation, likely because of use different systems by different investigators
to form biofilms [ Pitts etal., 2003; Hume etal., 2004] also, many clinically
significant isolates of S. epidermidis agglutinate the erythrocytes of humans, sheep,
and other animal species and the rate of agglutination for non-S.epidermidis
CONS is low (33%) [Rupp and Archer1992], whereas Fey etal,. (1999) showed all
strains forming biofilms were able to agglutinate erythrocytes, so the ability of S.
epidermidis to produce biofilm on plastic surfaces has capacity to mediate
hemagglutination of erythrocytes (16 biofilm-positive/hemagglutination-positive
strains and 19 biofilm-negative/hemagglutination-negative strains) within the 39
clinical strains tested ,while cerca etal. (2005) showed the small amounts of
biofilm on surface (1.2µg/mm2 on glass) and no macroscopic hemagglutination
was observed, for this strain, However, via microscopic examination it was
possible to verify that strain could bind to human erythrocytes and cause some
degree of agglutination, so biofilm negative control strain, did not agglutinate
human erythrocytes, because this strain cannot express PNAG/PIA [McKenney,
1998], whilst Rupp etal., (1995) Showed adherence to biomaterials and form
biofilm is thought to be pivotal in the pathogenesis of prosthetic device infection
by S.epidermidis and strong association of hemagglutination with adherence and
biofilm production.
The ability of S. epidermidis to hemagglutination of erythrocytes of different
species is associated with the ability to adhere to plastic and to produce biofilm
and therefore may be important for the pathogenesis ofS.epidermidis
infections[Cerca,2001], clinical isolates expressed small amounts of PNAG/PIA
giving rise to both low biofilm formation and small hemagglutination
capabilities, that meaning hemagglutination data that reflectthe level
of
expression of PNAG/PIA, although it may not be entirely quantitative, it is
135
possible to conclude that PNAG/PIA is a clear determinant for biofilm formation,
but not for initial adhesion of S. epidermidis [Cerca etal.,2005].
Expression of PNAG/PIA, adhesion to synthetic surfaces and biofilm formation
are virulence factors of S. epidermidis clinical strains, [Viedma et al.,2000] it is
further expected that they might have different capabilities to adhere and to form
biofilms on synthetic surfaces.
3.7 Antigen - Antibodies titration
Agglutination are based on the presence of antibodies in patient sera that can react
with specific antigens and form visible clumps, but formation of biofilm may protect
bacteria from the action of antibodies [Pourmand etal., 2006].
1 control
2control
3control
Figure 3.7: Antigen - Antibodies titration with control (control 1:
Only BHI broth
Control 2: BHI + Bacteria
Control 3: BHI + Serum)
In figure 3.7 apparent the positive reaction between surface antigens of bacteria
and the antibodies, which consider as a good tool used for diagnose infection and
identify bacterial isolates by detection of bacterial-specific antibodies in samples.
Table 3.16: agglutination of antigens (whole cells of S. epidermidis which
137
formed Biofilm) against antibodies in sera of patients.
CONCENTRATION OF
S.EPIDERMIDIS
NO.OF
TITER OF
CONTROL
ANTIGENS(WHOLE
PATIENT
ANTIBODIES
(SERUM )
6
2
6
4
1
8
5
16
6
32
9
64
6
128
11
256
CELLS)
(1.5×10^8 CFU/mL)
0
Results in table 3.16 showed sera from patients reactivity with S. epidermidis
antigens (whole cells ) as: six of S. epidermidis antigens agglutinated in titer 1: 2 ,
1: 4 , 1: 32 and 1: 128 of patients sera ( antibodies ) while 5, 9 , 11 of
S.
epidermidis antigens agglutinated in the patients sera in titer ( 1: 16 , 1: 64 , 1:
256) respectively .
Most S. epidermidis have a pronounced ability to bind non- specifically to
naked polymer surface , this binding can be blocked by coating the surface with
various proteins , as fibrinogen ( fg), extract of S. epidermidis may be useful in
serodiagnosis of coagulase-negative staphylococcal,however, in this table
appearance one only of S. epidermidis antigens positive agglutinated in titer 1:8 ,
138
High level of antibodies may inhibition the agglutination reaction [Frank etal.,
2007].
139
Results of Pourmand etal., (2006) study explained
the higher titers of
antibodies to several proteins were observed in individuals who were not nasal
carriers of S.aureus than in sera patients who were carriers these bacteria, surface
proteins of Staphylococci have led to development of several potentially
immunological therapeutic and prophylactic strategies for
control of this
organism[Flock, 1999] , a high anti- IgG titer in donor serum have potential to
reduce sepsis caused by S. aureus and mortality in infants[Bloom etal., 2010],
An antibody response to a given antigen is indicative of its expression in vivo and
of its potential for use in a subunit
vaccine or as a target
in passive
immunotherapy or prophylaxis[Pourmand etal., 2006] , So some of antigenic S.
epidermidis proteins are potential targets for immunotherapy, which provides a
novel strategy for control of S. epidermidis infection, and could potentially
reduce infection and have a significant impact on human health. Interestingly,
a subset of S. epidermidis proteins a r e also conserved in S. aureus and in other
genera. These antigens may have important functions in disease [Clarke etal.,
2006].Results of Kumar etal., (2005) study showed elevated levels of IgG to
teichoic acid antigen were detected in all (100%) group patients while 40% with
superficial infection, so (72%) of IgG antibodies to peptidoglycan and (60%)
patients with superficial staphylococcal infection. An increase in levels of
antibodies to peptidoglycan showed a positive correlation trend with levels of IgG
antibodies to teichoic acid only in deep infection group.
140
Table 3.17: Percent Inhibition of concentration sera protein on biofilm
formation
CONCENTRATION OF
NO. OF
Percent Inhibition
SERA PROTEIN
PATEINTS
of biofilm
( µG/ML)
SERA
formation (%)
1.394
13
30
2.156
13
62
3.007
7
79
4.429
12
82
5.032
5
90
Total
50
Results in table 3.17 showed Effect of concentration sera protein
(antibodies) on biofilm formation, the concentration of sera protein (5.032) µg/ ml
gave90% inhibition in five sera of patients but concentration of sera protein (1.394)
µg/ ml gave 30% inhibition thirty sera of patients.McCool etal.,(2002) identified
a serum immunoglobulin G (IgG)
and
secretory
IgA
response
to
pneumococcal surface protein A as a result of colonization; individuals who
did not become colonized after inoculation had preexisting antibodies to this
protein, in sessile cells , SesC are a surface-exposed protein of which the
expression is slightly higher compared to their planktonic SesC is a promising
antigen
for
vaccination
against
S.epidermidis
biofilm
formation
and
production of protective antibodies against S.epidermidis established biofilms
[Shahrooei etal.,2009], Shahrooei (2010) study showed the polyclonal antibodies
cross react with other non-specific antigens, the concentration of antibodies
which was used not sufficient for inhibition of the function of some Ses proteins.
Specific antibodies blocked biofilm development at the initial attachment and
141
aggregation stages, and deletion or inhibited normal biofilm formation. So specific
antibodies also serve as opsonins to enhance neutrophil binding, motility, and
biofilm engulfment, Vaccination against, or therapeutic antibodies reactive to
proteins may provide targetsfor use against a broad spectrum
positive bacteria[Shahrooei,
of gram-
2012].Results may explained by Shahrooei (2012)
who proved a SesC inhibited S. epidermidis biofilm formation in a rat model of
subcutaneous foreign body infection.
Table-3.18: Mean values of immunoglobulin and complement Level (C3 and
C4) in sera of infected patients by S.epidermidis (produced and non –
produced biofilm).
Sera of patients infected by
S.epidermidis
(M ± S.D)
Produced
Non-Produced
biofilm
biofilm
(No.=30)
(N0.=20)
Normal
value
P value
Immunoglobulin
(mg / dl)
IgG
(mg / dl)
IgM
(mg / dl)
IgA
(mg / dl)
1535±812.333 1521.3±475.440 710-1520
(P< 0.001)
significant
(P> 0.001)
90.23±44.23
220.8±90.209
124.4±41.20
200.10±79.004
140
40-250
90-310
no
significant
(P> 0.001)
no
significant
Complements
C3
(mg / dl)
C4
(mg / dl)
(P> 0.001)
120±36.5
120±36.49
84-193
no
significant
(P> 0.001)
41.9±14.09
42±14.28
20-40
no
significant
I.g.G: Immunoglobulin G , I.g.M :Immunoglobulin M ,I.g.A :Immunoglobulin A ,C3 : complement 3 , C4 : complement 4 M=
Mean; - S.D = Standard deviation
Table (3.18) showed mean values of Immunoglobulin, complement in sera of
patients (infected by S.epidermidis) with produced and non-produced biofilm,
normal level both for immunoglobulin M and A (90.23±44.23, 124.4±41.20 and
220.8±90.209, 200.10±79.004) mg / dl respectively (P> 0.001), but IgG increased
level is highly elevated (1535±812.333, 1521.3±475.440) mg / dl respectively (P<
0.001) in sera of patients with produced and non-produced biofilm.
Also table showed normal levels of complements components (C3) (120±36.5,
120±36.49) mg/dl respectively (P> 0.001), in sera of patients with produced
biofilm compare to non-produced biofilm whilst elevated levels of complements
components (C4) (41.9±14.09, 42±14.28) mg/dl respectively (P> 0.001), to each
two groups (produced and non-produced biofilm).
Increasing C3 and C4 can be explained by the IgG, prevent complement attack
by inhibiting C3 and C4 uptake onto target cells and tissues, therefore elevated level
of
IgG in sera of patients may be the source of the noticed increase in the
141
complements, that suggest immunoglobulins can play role in active therapy in
diseases accompanied by activation of classical complement pathway.
Also these levels reflected the innate immunity status of individual especially C3
which it is a key component of complement activities, while the level of C4 was
elevated, C3 reduction is a good indication for alternative pathway complement
activation due to local non - invasive bacterial infection, So results of CRP are
positive test in the sera of all patients. The appearance of this abnormal protein is
correlated with acute phase diseases, the nature and duration of the disease
determines the positively of CRP test [Davi etal., 2003].
Complement may be activated by immunoglobulin bound to extracellular
material in biofilms, leading to complement activation and C3 a generation but to
insufficient opsonization of the bacterial surface. In addition, PIA is strongly
produced in S. epidermidis biofilms, and may promote the lectin pathway of
complement activation [Cerca etal.,2006]. So biofilm formation has an important
role in the evasion of the host immune defense; and protects S. epidermidis from
neutrophil phagocytosis, AMPs and deposition of antibodies and complement, and
induces a significantly lower CRP response in neonatal blood compared to nonbiofilm producing strains [Klingenberg etal.,2005 and Kristian etal.,2008]
Hansen etal., (2003) showed in his study third Complement component [C3]
levels are normal in the sera of all patients , however [C4] is observed elevated in
sera . Results study of Mahdi etal.,(2009) showed significant increase in IgG, IgA,
C3 and C4 in order to overcome the inflammation, IgM decreased level in IC
(indeterminate colitis ) patients when comparison with control , this may be due to
secondary immune response intiation and IgM level return to its level because its
only raised in primary immune response,presence of antigen-antibody immune
complex leading to complement activations by alternative and lectin pathways and
142
causing increased level of complement [Swidsinski etal.,2002].
complement
activation induced by PIA biofilm are stronger than non-PIA biofilm [Granslo
etal.,2012].
Innate inflammatory response to S. epidermidis infections involves the
activation of the complement system (classical pathway) , leukocytes and
secretion of cytokines [ Otto, 2009].
Results study of Kristian et al.,(2008) explained form biofilm induced to
release of C3a, but also protected S. epidermidis from IgG and
opsonisation
whilst
Staphylococci
complement
are known to produce immune evasive
molecules that also may inhibit the complement system [Foster, 2005; Laarman
et al., 2010], So PIA as a strong activator of the complement system as well as
Kristian et al.,(2008) shown in his results the S. epidermidis embedded in a
biofilm is protected from polymorph nuclear
cells(PMN) killing .So
PIA
important factor for immune evasion and strains which produce PIA are persistent
colonizers of indwelling medical devices and that biofilm is a major virulence
factor in chronic S. epidermidis infections [Begun et al., 2007], Whilst Granslo
etal.,(2012) showed in his study the S.epidermidis biofilms induce a lower
complement activation in neonates as compared with adults which induced
stronger complement.
143
Table 3.19: Mean of interleukins (6 and 8) and C- reactive protein (C-RP)
in sera of infected Patients by S.epidermidis (produced and non – produced
biofilm)
SERUM OF PATENTS
INFECTED BY
S.EPIDERMIDIS
TEST
M ± S.D
Produced
biofilm
(No.=30)
IL
(24.8
Interleukins
6
±18.20)
(pg/ml)
IL
8
CONTROL
P-VALUE
Non- Produced
biofilm(No.=20)
(24.5 ±19.09)
(38±9.52)
(37±7.13)
+
+
(15.88±6.8)
(P< 0.001)
significant
(P< 0.001)
(20.3±7.07) significant
C-reactive
protein
-
(C-RP)
- M= Mean; - S.D = Standard deviation
The level of cytokines (IL-6, IL-8) was determined in sera of patients and
control, cytokines determined, showed variations between patients and controls.
Serum levels of IL-6 (24.8 ±18.20, 24.5 ±19.09) pg/ml respectively in sera of
infected patients by S.epidermidis (produced and non-produced biofilm)
respectively compare to the control (15.88±6.8) pg/ml (P< 0.001)., while serum
level of IL-8 (38±9.52, 37±7.13) pg/ml respectively in sera of infected patients
144
by S.epidermidis (produced and non-produced biofilm) respectively compare to
the control (20.3±7.07) pg/ml (P< 0.001).
In the present results, patients shared a significant increased serum level of IL-8,
IL-6 compared to controls ,increased production of IL-6 has been implicated in
various disease processes ,including bladder cancer. In some instance, IL-6 is
implicated in proliferation pathways, because it acts with other factors, such as,
heparin-binding epithelial growth factor and hepatocyte growth factor [ Wang et
al., 2002].
The innate inflammatory response to S. epidermidis infections involves activation
of the complement system and leukocytes and Cytokines activate the innate
immune system and facilitate the defense against invading pathogens[Rogier et al.,
2003], PIA as an important immunogenic component of the S. epidermidis biofilm
that can regulate pro-inflammatory cytokine production (IL-1α) and (IL-8) but
inhibit other cytokine secretion, so IL-6 alone or together with IL-1β and TNF-α,
induce the production of acute-phase proteins as C-reactive protein (CRP) , as
well as Klingenberg et al.,(2005) of his study explained reduced IL-6 and IL-1β
secretion in response to the PIA-positive strain may therefore explain reduced
CRP-response , in neonatal infections caused by biofilm positive coagulasenegative staphylococci.
Result of Ivarsson (2013) reported showed S. epidermidis induced higher
levels of IL-8 (mean 38.5 ng/mL) than S. aureus (IL-8 mean 22.2 ng/mL) and
induced a higher chemo attractive response, So Dinarello (1996) showed in results
study IL-8 are elevated in patients with Gram- positive bacterial sepsis and
S.epidermidis induced significant increases in TNF-a and IL-8 (1.9 - 0.9 and 94.767.2 ng/ml, respectively), and high CRP levels have been observed in bacteremic
patients[ Honkinen et al., 2000 ].
145
This study is in agreement with Snijder and Meulenberg (2001) whom suggested
that CRP is a good marker for systemic inflammation, as well as increased
bacterial infections that mean increased in CRP Titer which is considered as a
defense against any bacterial infections [Challis et al., 2009],the CRP levels are
significantly increased in urinary tract infection or increased as a result of
infections[ Malave et.al., 1998].
146
Conclusions
and
Recommendations
147
Conclusions and Recommendations
I. Conclusions
We can conclude from our study that
1. Comparing the phenotypic biofilm detection methods, CRA, although easier
and faster to perform, still microtiter method is a more quantitative and reliable
method for detection biofilm forming microorganisms as compared to Tube
method and congo red agar methods, and considered as gold-standard method for
biofilm detection.
2. This study suggested that Ica is not always associated with biofilm production
of S. epidermidis but it can support the adhesion mechanisms of S. epidermidis
involved in the infections associated with medical devices.
3.Though staphylococci isolated from study groups were capable of forming
biofilm, when presence of both ica ( A , D ) gene but some strains has ability
t o f o r m biofilm in absence of both ica ( A , D ) gene .
4. Most strains forming biofilms were able to agglutinate erythrocytes, and
hemagglutination of erythrocytes is a common property of Staphylococcus
epidermidis strains, which is related to adherence and biofilm formation.
5. Can be measurements dry weight Biofilm formation on class ptridish surfaces.
6. Extracted biofilm used as antigens against sera of patients’ infected.
7. The level of immunoglobulin and complement in study group were within the
normal range excepted (IgG and C4).
8. C.reactive protein is a sensitive but non- specific marker for the diagnosis of
acute infection, because it can increase in other causes of tissue injury and
inflammation and S.epidermidis induced higher levels of IL-8, as well as IL-8
correlated positively with CRP and IL-6 in patients infected by S.epidermidis.
148
II. Recommendations
1- Further studies to investigate the mechanism by which specific proteins can
form heterogeneous biofilm in S. epidermidis.
2- Study to use the fibrinogen and teichoic acid extract from S. epidermidis in tool
to diagnostic biofilm form by these bacteria.
3- Using Pulse Field Gel Electrophoresis (PFGE) for determination the external
the source of infection and internal source of infection (colonization study
before and during catheterization).
4-Study effect of virulence factor of S. epidermidis like AtlE gene, sarA family
and the agr quorum sensing system.
5- Using the PNAG molecule as a target for development vaccine against
infections.
149
References
150
References
►A
Abass, E. A. (2006). A Study of Homocysteine and other Biochemical Profile in
patients with Chronic Renal failure Undergoing Hemodialysis and Kidney Transplant
Recipients. Ph. D dissertation. College of Education (Ibn Al-Haitham) University of
Baghdad. Iraq.
Abdel-Aziz; Shadia, M. and Aeron A. (2014). Bacterial Biofilm: Dispersal and
Inhibition Strategies. SAJ Bio- technol 1(1): 105.
Abe,K.; Miyazaki, .; Koji, T.; Furusu, A.; Nakamura-Kurashige, T.; Nishino, T.;
Ozono, Y.; Harada, T.; Sakai, H. and Kohno, S. (2001). Enhanced expression of
complement C5a receptor mRNA in human diseased kidney assessed by in situ
hybridization. Kidney Int. 60: 137-146.
 Akinkunmi, E. O. and Lamikara, A.(2010).Species distribution and Antibotic
resistance in coagulase negative staphylococci colonizing the Gastro intestinal tract of
children in Ile-Ife Nigeria. Tropical Journal of Pharmarceutical Research 9(1); 35-43.

AL-Khafaje, A.A.(2011).Evaluation of Virulence of Coagulase-Negative
Staphylococci; Isolated from Sexually Active Women with Symptomatic Genital
Tract Infection in Vitro Journal of Kerbala University ; Vol. 9 No.2 Scientific .
 Ansari,M.A.; Khan ,H.M .; Alzohairy ,M.A.(2015). Anti-biofilm efficacy of
silver nanoparticles against MRSA and MRSE isolated from wounds in a tertiary care
hospital..33(1):101-109.
151
 Adeleye; I. A.; Akanmu, A. S.; Bamiro, B. S.; Obosi, A. C. and Unem, A. V.
(2010).Bacterial bloodstream infections in HIV – infected adults attending a Lagos
Teaching Hospital. Journal of Health Population and Nutrition 28 (4): 318-326.
 Agren, K.; Brauner, A. and Anderson. J. (1998). Haemophilus influenza and
Streptococcus pyogenes group a challange induce the Thl type ofcytokine of response
in cells obtained from tonsillar hypertrophy and recurrent tonsillitis. OLR. 60: 35-41.
 Al- Muhanna ; Abbas, S.h.; Al-Hilu, S. A. and Maytham, A.A.(2014).
Characterization of coagulase-negative; oxacillin resistant staphylococci from
patients undergoing catheter related infections. European Journal of Experimental
Biology; 4(3):774-778.
 Al-Dahmoshi ;Hussein, O.M.; Habeeb, S. N.and Alaa, H. .(2013).Study of Some
Bacterial Isolates Associated with Leukocytospermia in Asthenospermic Patients in
Hilla City; Iraq.International Research Journal of Medical Sciences; 1(3); 1-11.
 Ali, F.A. ;Abbas,A.H. and Majahid.H.(2009).Identification of Coagulase negative
Staphylococci Isolated
from Different Diseases Cases. Sensitivity of Coagulase
negative Staphylococci Isolated from Different Diseases Cases to Antibiotics. Tikrit
jo.41(4):92-101.
 Al-Omari,A. W.; Amera, M. M. and Waad M. R. (2013). Detection of Biofilm
Formation in some Pathogenic Bacteria Using Tube and Congo Red Agar
Methods.al-raf. jo. 24(6):55-65.
Alcaraz, L.E.; Blanco, S.E.; Puig, O.N.; Tomas, F. and Ferretti, F.H.(2000).
Antibacterial activity of flavonoids against methicillin-resistant Staphylococcus
aureus strains. J Theor Biol.;205:231–240.
152
 Atshan, S.S.; Shamsudin, M.N.; Zamberi ,S.; Z.,L.;Hamat; R.A.; Arunkumar
K.A.; Ali,A.; Ghaznavi,R.; Ghasemzadeh,M. H.; Seng, J.S.; Nathan, J.J. and Pei Pei;
C. (2012). Prevalence of Adhesion and Regulation of Biofilm-Related Genes in
Different Clones of Staphylococcus aureus. J. Biomed. Biotechnolo.; 10;20 .
Afreenish,H.; Javaid, U.; Fatima, K.; Maria, O.; Ali, K.; Muhammad,
I.(2011).Evaluation of different detection methods of biofilm formation in the clinical
isolates. Braz J Infect .; 15(4):305–11.
Arciola, C.R., Baldassarri, L., and Montanaro, L. (2001) Presence of icaA and
icaD genes and slime production in a collection of staphylococcal strains from
catheter-associated infections. J Clin Microbiol 39: 2151–2156.
Arciola, C.R.; Baldassarri, L; Montanaro, L.(2002). In catheter infections by
Staphylococcus epidermidis the intercellular adhesion (Ica) locus is a molecular
marker of the virulent slime-producing strains.J Biomed Mater Res; 59(3):557-562.
 Arciola, C.R.; Campoccia, D.; Baldassarri, L.; Donati, M.E.; Pirini
,V.;Gamberini, S. and Montanaro, L .(2005). Detection of biofilm for mation in
Staphylococcus epidermidis from implant infections. Comparison of a PCR method
that recognizes the presence of ica genes with two classic phenotypic methods.J
Biomed Mat Res 76:425-430.
Arslan, S.; Ozkardes, F. (2007).Slime production and antibiotic susceptibility in
staphylococci isolated from clinical samples. Memorias do Instituto Oswaldo Cruz;
102(1):29-33
Azuka, A. and Idahosa, E.(2013).Species Distribution and Virulence Factors of
Coagulase Negative Staphylococci Isolated From Clinical Samples From the
153
University of Benin Teaching Hospital; Edo State; Nigeria journal of natural
science’s research; 3(9):39-43.
►B
 Barraud ,N.; Hassett, D.J.; Hwang, S.; Rice, R.A .(2006). Involvement of nitric
oxide in biofilm dispersal of Pseudomonas aeruginosa. Journal of Bacteriology;
188(21): 7344 -7353.
Bergey's Manual of Systematic Bacteriology,Volume Two: The proteobacteria,
Part A Introductory Essays ,Editor-in-chief: Garrity, George 2004
 Benjamini,E.;coico ; R. and Sunshine ,G.,Immunology: Ashort course.,2000, 4th
ed.Wiley-Liss,Inc,USA, pp.70-80.
 Bjarnsholt, T.A. and Givskov,I.A .(2007). Quorum-sensing blockade as a strategy
for
enhancing
host
defences
against
bacterial
pathogens;thePhilosophicalTransactions of theRoyalSociety;362(1483): 213-222.
 Bloom, B.; Schelonka ,R.; T. Kueser; W. Walker; E. Jung; D. Kaufman; K.
Brumatti, G.; Salmanidis, M; and Ekert,P.G. (2010) Crossing paths: interactions
between the cell death machinery and growth factor survival signals. Cell Mol Life
Sci 67(10): 1619–1630.
Begun, J.; Gaiani, J.M.; Rohde, H.; Mack, D.; Calderwood, S.B.; Ausubel ,F.M. &
Sifri, C.D. (2007).staphylococcal biofilm exopolysaccharide protects against
Caenorhabditis elegans immune defenses. PLoS Pathog 3: 57.
Bowler, P.G.; Duerden, B.I.; and Armstrong, D.G.(2001).Wound microbiology
andassociated approaches to wound management. Clin. Microbial. Rev,. 14(2);244269.
154
Boles,B.R. and Horswill,A.R.(2011).Staphylococcalbiofilm disassembly .NIH
Public Access 19:449-455.
►C
 Campbell, M.J.; Wolf, D.; Mukhtar,R.A.; Tandon, V.; Yau. C. (2013) The
Prognostic Implications of Macrophages Expressing Proliferating Cell Nuclear
Antigen in Breast Cancer Depend on Immune Context. PLoS ONE 8(10)
Cafiso, V.; Bertuccio, T.; Santagati, M.; Campanile, F.; Amicosante, G.;Perilli,
M.G.(2004).Presence of the Ica operon in clinical isolates of Staphylococcus
epidermidis and its role in biofilm production.Clin Microbiol Infect ;10:1081–8.
 Cunha, M. L.; Rugolo, L.M.; Lopes, C.A.(2006) . Study of virulence factors in
coagulase-negative staphylococci isolated from newborns.
memInst Oswaldo
Cruz.101(6):661-8.
 Challis, J.R.; Lockwood ,C.J.; Myatt, L.;
Norman, J.E.; Strauss, J.F. and
Petraglia F. (2009). Inflammation and pregnancy. Reprod Sci 16:206–215.
 Chapel, H.; Haeney; M.; Misbah, S. and Snowden, N. (1999). Essentials of
clinical immunology. 4th ed. Blackwell Science. Oxford. U.K.
Clarke, S. R. and Foster, S. J.(2006). Surface adhesins of Staphylococcus aureus.
Adv Microb Physiol 51, 187–224.
 Cheung; G. Y. and Michael Otto.(2010). Understanding the significance of
Staphylococcus epidermidis bacteremia in babies and children.Curr Opin Infect Dis.;
23(3): 208–216.
155
 Cho. S.; Naber, K.; Hacker, J.; Ziebuhr, W.(2002).Detection of the ica ADBC
gene cluster and biofilm formation in Staphylococcus epidermidis isolates from
catheter-related urinary tract infections. Int. J. Antimicrob.
 Christensen, G.D.; Simpson, W.A.; Younger, J.J.(1985). Adherence of coagulasenegative staphylococci to plastic tissue culture plates: a quantitative model for the
adherence of staphylococci to medical devices. J Clin Microbiol .22:996-1006.
 Collee, J.G. ; Miles, R.S. ; Watt, B.(1996). Test for identification of bacteria. In
Collee; J.G.; Fraser; A.G.; Marmion; B.P. and Simmons; A. ed. Mackie &
MacCartney practicle medical microbiology. 14th ed.; Churchill Livingstone: 131149.
 Cucarella, C.; Solano, C. and Valle, J.(2001).a Staphylococcus aureus surface
protein involved in biofilm formation. J Bacteriol.183:2888–96.
 Cuong, V.; Michael, O.(2002).Staphylococcus epidermidis infections; Microbes
and InfectionVolume 4(4): 481–489
Cerca, N.
;Pier, G.B.;Vilanova,M.O.;
Rosário,A. and Joana,A.A.(2005).
Quantitative analysis of adhesion and biofilm formation on hydrophilic and
hydrophobic surfaces of clinical isolates of Staphylococcus epidermidis. Research in
microbiology";56(4):506-514.

Cerca, N.; Jefferson, K.K.; Oliveira, R.; Pier, G.B.; Azeredo, J.(2006).
Comparative antibody-mediated phagocytosis of Staphylococcus epidermidis cells
grown in a biofilm or in the planktonic state. Infect Immun . 74: 4849–55.
Chaieb, K.; Mahdouani, K.; Bakhrouf, A.(2005). Detection of icaA and icaD loci
by polymerase chain reaction and biofilm formation by Staphylococcus epidermidis
isolated from dialysate and needles in a dialysis unit. J Hosp Infect; 61(3):225-230.
156
Chandra, J.; Kuhn, D.M.; Mukherjee, P.K.; Hoyer, L.L.; McCormick, T.;
Ghannoum, M.A. (2001):Biofilm Formation by the Fungal Pathogen Candida
albicans: Development; Architecture; and Drug Resistance. Journal of Bacteriology;
September; 183(18): 385-394.
Christner, M.; Franke, G.C.; Schommer, N.N.; Wendt, U.; Wegert, K.; Pehle
P.(2010). The giant extracellular matrix-binding protein of Staphylococcus
epidermidis mediates biofilm accumulation and attachment to fibronectin. Mol
Microbiol.75(1):187-207.
Christoph, G. A; manfred, F.; Johann, H.; michael, N.; markus, N.; Débora, C. C
.(2014).Influence of poly-N-acetylglucosamine in the extracellular matrix on Nchlorotaurine
mediated
killing
of
Staphylococcus
epidermidis.new
microbiologica.37;383-386.
Cogen, A.L.; Yamasaki, K.; Muto, J.; (2010). Staphylococcus epidermidis
Antimicrobial
δ-Toxin
(Phenol-Soluble
Modulin-γ)
Cooperates
with
Host
Antimicrobial Peptides to Kill Group A Streptococcus. DeLeo FR; ed. PLoS
ONE;5(1)
Collier , M. (2003).Understanding wound inflammation. Nurs. Times. 99 (25).
Costerton,J.W.; Stewart,P.S. and Greenberg, E.P. (1999).Bacterial biofilms: A
common cause of persistent infections. Science 284; 1318-1322.
Coulon ,C.; Irina, S. ; Philippe, L. ; Saïd , J.; Jeffrey, B. K. and Sigrid,
F.(2012).Stress-Induced Dispersal of Staphylococcus epidermidis Biofilm Is Due to
Compositional Changes in Its Biofilm Matrix.Advances in Microbiology; 2; 518522.
157
Couto,I.;Pereira,S.;Miragaia,M.;Sanches,I.S.;delencastre .(2001).Identification of
clinical staphylococcal isolates from humans by internal transcribed spacer PCR. J
Clin Microbiol; 39: 3099–3103.
Cruse, J.M. and Lewis, R.E. (1999). Atlas of immunology. 1st ed. Springer;
U.S.A. p 192-193.
►D
Del; Pozo; J.L. and Patel,R. (2007).The challenge of treating biofilm-associated
bacterial infection. Clinical Pharmacology & Therapeutics 82; 204-209.
 Donlan, R. M.(2001). Biofilm formation: a clinically relevant microbiological
process. Clin. Infect. Dis. 33:1387-1392.
 Duran, N.; Dogramaci, Y.; Ozer, B.; Demir, C. and Kalaci, A. (2010).Detection of
Adhesin genes and slime production among staphylococci in orthopaedic surgical
wounds. African Journal of Microbiology Research 4(9); 708-715.
Dan Yu; Liping Zhao; Ting Xue and Baolin Sun.(2012).Staphylococcus aureus
autoinducer-2 quorum sensing decreases biofilm formation in an icaR-dependent
manner. BMC Microbiology; 12:288.
Davis SC; Ricotti C.; Cazzaniga A. (2008).Microscopic and physiologic evidence
for biofilm-associated
wound
colonization
in
vivo. Wound
Repair
and
Regeneration;16(1):23 - 9.
Davis, SL.; Gurusiddappa, S.; McCrea, KW.; Perkins, S.; Höök, M. (2001).SdrG;
a fibrinogen-binding bacterial adhesin of the microbial surface components
recognizing adhesive matrix molecules subfamily from Staphylococcus epidermidis;
targets the thrombin cleavage site in the Bbeta chain. J Biol Chem.27(30): 799-805.
158
De Silva, G.D.I.; Kantzanou, M.; Justice, A.; Massey, R.C.; Wilkinson, A.R.; Day
N.P.J.; Peacock S.J. (2002).The ica operon and biofilm production in coagulaseDietrich, M.;Joachim, R.;Holger, R.;Tim, M.;Hubert, H. F.;Holger,A. E.;Rainer,
L. and Mark, E. R.( 1999). Essential Functional Role of the Polysaccharide
Intercellular Adhesin of Staphylococcus epidermidis in Hemagglutination . Infect.
Immun. 67 (2): 1004-1008
Dhanawade, NB.; Kalorey, DR.; Srinivasan, R.; Barbuddhe, SB.; Kurkure,
NV.(2010).Detection of intercellular adhesion genes and biofilm production in
Staphylococcus aureus isolated from bovine subclinical mastitis. Vet Res Commun
34:81-89.
Dinarello, CA. (1996).
Biologic basis for interleukin-1 in disease. Blood
;87:2095–147.
Dobinsky, S.; Kiel, K.; Rohde, H.; Bartscht, K.; Knobloch, JK.; Horstkotte, MA.;
Mack, D.(2003).Glucose-related dissociation between icaADBC transcription and
biofilm expression by Staphylococcus epidermidis: evidence for an additional
factor required for polysaccharide intercellular adhesin synthesis. J Bacteriol; 185:
2879-2886.
Dunne, W. J. (2003). Bacterial adhesion: Seen any good biofilms lately?
►E
 El-Din, S.S.; El-Rehewy, M.S.; Ghazaly, M.M.; Abd-Elhamid, M.H.(2011)
Biofilm formation by blood stream Staphylococcal isolates from febrile pediatric
cancer patients at South Egypt Cancer Institute. J Am Sci ; 7:674-86.
159
Eftikhar, F.; Speert, D.P.(2009). Biofilm formation by persistent and nonpersistent isolates of Staphylococcus epidermidis from a neonatal intensive care unit.
J Hosp Infect;71(2):112-6.
►F
 Farina; C.; Aloisi; F.; and Meinl; E. (2007) Astrocytes are active players in
cerebral innate immunity. Trends Immunol.28: 138–146.
 Foster, T.J.(2005). Immune evasion by staphylococci.Nat Rev Microbiol. 3:948958.
 Farran, C. A.; Sekar, A.; Balakrishnan, A.; Shanmugam, S.; Arumugam, P.; and
Gopalswamy, J. (2013).Prevalence of biofilm-producing Staphylococcus epidermidis
in the healthy skin of individuals in Tamil Nadu; India. Indian J Med
Microbiol;31:19-23
 Fey,p. and Michael, E. Olson.(2010).Current concepts in biofilm formation of
Staphylococcus epidermidis. Future Microbiol.; 5(6): 917–933.
Fireman, P. (2006). Atlas of allergies and clinical immunology. 3rd ed. Mosby
Elsevier; China. p 17-20.
Fischbach, F. (2000). A manual of laboratory and diagnostic tests. 6TH ed.
Lippincott; Phladelphia. U.S.A. 71-74.
 Fischbach, and Frances.(2001). Amanual of Laboratory and Diagnostic Test.
Edition 7. P: 164 – 170. Chapter 3.
 Fournier, B.; and Philpott, D.J. (2005) Recognition of Staphy- lococcus aureus by
the innate immune system. Clin Micro- biol Rev 18: 521–540.
160
 Frank, K.L.; Reichert, E.J.; Piper, K.E.; Patel, R.(2007). In vitro effects of
antimicrobial agents on planktonic and biofilm forms of Staphylococcus lugdunensis
clinical isolates. Antimicrob. Agents Chemother;51:888–895.
 Frebourg, N.B.; Lefebvre, S.; Baret, S.; Franc, J.; Lemel,and O.(2000).PCRBased Assay for discrimination between invasive and contaminating Staphylococcus
epidermidis strains. J Clin Microbiol;38:877-80.
Favre-Bonté, S.; T Köhler, and Van Delden, C.(2003).Biofilm formation by
Pseudomonas aeruginosa: role of the C4-HSL cell-to-cell signal and inhibition by
azithromycin. Journal of Antimicrobial Chemotherapy; 52: 598 - 604.
Fey,P.D.; Ulphani,J.S.
;
Götz,
F.; Heilmann,
C.;
Mack,
D.;
Rupp,
E.(1999).Characterization of the relationship between polysaccharide intercellular
adhesin and hemagglutination in Staphylococcus epidermidis. J Infect Dis.
179(6):1561-4.
Fitzpatrick, F.; Humphreys, H.; and O’Gara, J. P. (2005).The genetics of
staphylococcal biofilm formation – will a greater understanding of pathogenesis lead
to a better management of device-related infection? Clin. Microbiol. Infect. 11: 967–
973.
Flock, J.-I.(1999). Extracellular-matrix-binding proteins
as targets for the
prevention of Staphylococcus aureus infections. Mol. Med. Today 5:532–537.
Freeman, D.J.; Falkiner, F.R. and Keane, C.T.(1989).New method for detecting
slime production by coagulase negative staphylococci. Journal of Clinical Pathology.;
42 (8): 872-874.
161
►G
 Gadepalli, R.B.; Dhawan, V.; Sreenivas, A.; Kapil, A.C.; Ammini, C. and R.
Chaudhry, R.(2006).
A clinico-microbiological study of diabetic foot ulcers in an
Indian tertiary care hospital. Diabetes Care. 29:1727–32.
 Gamal, Fadl. ; Mohamed, Ali. El-Feky.; Mostafa, Said. El-Rehewy.;and Mona,
Amin.
 Garrote ;FernandoGarcia; Emilia, Cercenado. and
Evaluation of a New System; VITEK
Emilio, ouza.(2000).
2; for Identification and Antimicrobial
Susceptibility Testing of Enterococci .Jo. ofclinicalmicrobiology; Vol. 38; No.6; p.
2108–2111.
 Gasper; Gerald, lynn. (2011). MS Imaging of Antibiotics within Staph.
epidermidis Bacterial Biofilms by Laser Desorption Postionization.degree of phd in
Chemistry ; Graduate College ;University of Illinois at Chicago.
 Gelaw, A.(2011).Isolation of bacterial pathogens from patients with postoperative
surgical site infections and possible sources of infections at University of Gondar
Hospital; Northwest Ethiopia.
Gerke,C.
;
Kraft,
A.;
Süssmuth,
R.;
Schweitzer,
O.;
Götz,
F.
(1998).Characterization of the N-acetylglucosaminyltransferase activity involved in
the biosynthesis of the
Staphylococcus epidermidis polysaccharide intercellular
adhesin. J Biol Chem. 17;273(29):18586-93.
162
Gil, C.; Solano, C.; Burgui, S.; Latasa, C.; García, B.; Toledo-Arana, A.; Lasa, I.
and Valle, J.(2014).Biofilm matrix exoproteins induce a protective immune response
against Staphylococcus aureus biofilm infection.Infect Immun.;82(3):1017-29
Gad, G.F.; El-Feky, M.A.; El-Rehewy, M.S.; Hassan, M.A.; Abolella, H.; ElBaky, R.M.(2009). Detection of icaA; icaD genes and biofilm production by
Staphylococcus aureus and Staphylococcus epidermidis isolated from urinary tract
catheterized patients. J Infect Dev Ctries . 3(5):342-351.
Gilbert, P.; Das, J.; Foley, I. (1997). Biofilm susceptibility to antimicrobials. Adv.
Dental Res. 11: 160–167.
Goldsby, R.A.; Kindt,T.G. and Osborne,B.A. (2000).Immunology. 4 th ed.;W.H
Freeman and company. NewYork.USA.
Gomes ;Fernanda; Pilar, Teixeira.; Nuno, Cerca; Howard, Ceri.; and Rosa´, rio.
Oliveira . (2011). Virulence Gene Expression by Staphylococcus epidermidis Biofilm
Cells Exposed to Antibiotics.Microbaildrug resistance;V.17; N. 2
Garrity, G. M., Bell, J. A. & Lilburn, T. G.(2004). Taxonomic outline of the
prokaryotes. In Bergey's Manual of Systematic Bacteriology, 2nd edn, release 5.0.
New York: Springer..
Gopal ,Shubha; Pradeep, P. Halebeedu.; G.S. Vijay, Kumar.(2014). Revamping
the role of biofilm regulating operons in device-associated Staphylococci and
Pseudomonas aeruginosa.Indian Journal of Medical Microbiology; Vol. 32; No. 2;
pp. 112-123
Gotz, F. (2002).Staphylococcus and biofilms. Mol Microbiol.;43:1367–78.
163
Granslo HN; Klingenberg C; Fredheim EA; Acharya G; Mollnes TE; Flægstad
T.(2013). Staphylococcus epidermidis biofilms induce lower complement activation
in neonates as compared with adults; Pediatr Res.;73(3):294-300.
Granslo; Hildegunn, and Norbakken.(2012). Staphylococcus epidermidis virulence factors and innate immune response.pdh; Doktorgradsavhandling.
University of Tromsø; Universitetet i o.
Gribbon, E. M.; Cunliffe, W. J.; and Holland, K. T.(1993). Interaction of
Propionibacterium acnes with skin lipids in vitro. J. Gen. Microbiol.; 139:1745–1751.
Günther,F. ;Wabnitz, G.H.; Stroh, P.(2009).Host defence against Staphylococcus
aureus biofilms infection: Phagocytosis of biofilms by polymorphonuclear
neutrophils (PMN). Molecular Immunology; 46(8-9): 1805-1813.
►H
 Hell, W.; Meyer, H-GW.; Gatermann, S . (1998).Cloning of aas; a gene encoding
a Staphylococcus saprophyticus surface protein with adhesive and autolytic
properties. Mol Microbiol ;29:871-81.
 Hall-Stoodley, L.; Costerton, J.W. and Stoodley, P. ((2004)) Bacterial biofilms:
From the natural environment to infectious diseases. Nature Reviews Microbiology;
2: 95-108.
Hansen, T.K.; Thiel, S.; Knudsen, S.T.; Gravholt, C.H.; Christiansen, J.S.;
Mogensen, C.E.; Poulsen, P.L.;(2003).Elevated levels of mannan-binding lectin in
patients with type 1 diabetes. J. Clin. Endocrinol. Metab. 88; 4857–4861.
Hansen, S. K.; Rainey, P. B.; Haagensen, J. A. and Molin, S. (2007). Evolution of
species interactions in a biofilm community. Nature 445; 533–536.
164
Härtel, C.; Osthues, I.; Rupp, J.; Haase, B.; Röder, K.; Göpel, W.; Herting
,E.;Schultz, C. (2008) .Characterisation of the host inflammatory response to
Staphylococcus epidermidis in neonatal whole blood.Arch Dis Child Fetal Neonatal
Ed.;93(2).
 Harley, J.P. and Prescott, L.M.(2002) .Laboratory Exercises In Microbiology. 5th
.ed. The McGraw- Hill Companies; Inc.; New York.
 Hogan, D. and Kolter, R. (2002). Why are bacteria refractory to antimicrobials?
Current Opinions in Microbiology; 5:472–477.
 Honkinen, O.; Jahnukainen, T.; Mertsola, J.; Eskola, J. and Ruuskanen, O. (2000)
Bacteremic urinary tract infection in children. Pediatr Infect Dis J 19(7): 630–634
Handke, L.D.; Conlon, K.M.; Slater, S.R.; Elbaruni, S.; Fitzpatrick, F.;
Humphreys, H.; Giles, W.P.; Rupp, M.E.; Fey, P.D. and O’Gara, J.P.(2004). Genetic
and phenotypic analysis of biofilm phenotypic variation in multiple Staphylococcus
epidermidis strains. J. Med. Microbiol. 53:367-374.
Heilmann, C.; Schumacher-Perdreau, F.; Götz, F. (1996).Characterization of
Tn917 insertion mutants of Staphylococcus epidermidis affected in biofilm
formation. Infect Immun ;64:277-82.
Heilmann, C.; Schweitzer, O.; Gerke, C.; Vanittanakom, N.; Mack, D.; Gotz,
F.(1996). Molecular basis of intercellular adhesion in the biofilm-forming
Staphylococcus epidermidis. Mol Microbiol; 20: 1083-1091.
Hume, E.; Baveja, J.; Muirf, B.; Schubert, T.; Kumar, N.; Kjelleberg, S.; Griesser,
H.; Thissen, H.(2004). The control of Staphylococcus epidermidis biofilm formation
165
and in vivo infection rates by covalently bound furanones. Biomaterials.; 25:5023–
5030.
►I
Ivarsson, M.; Schollin, J. and Björkqvist, M.(2013).Staphylococcus epidermidis
and Staphylococcus aureus trigger different interleukin-8 and intercellular adhesion
molecule-1 in lung cells: implications for inflammatory complications following
neonatal sepsis; Acta Paediatr. 102(10):1010-6.
►J
 Janeway , Jr. (2001). Immunobiology. 5 th ed. Garland Publishing. ISBN 0-81533642-X. electronic full text via NCBI Booksh.
Jain A and
Agarwal A.(2009).Biofilm production; a marker of pathogenic
potential of colonizing and commensal staphylococci.J Microbiol Methods 76:88-92
Janssen, B.J.; Huizinga, E.G.; Raaijmakers, H.C.; Roos, A.; Daha , M.R.; NilssonEkdahl, K.; et al. (2005): Structures of complement component
C4 provide
insights into the function and evolution of immunity Nature 437: 505-511.
►K
 Kaiser; Thaís, Dias Lemos. ;Eliezer, Menezes Pereira.;Kátia, Regina Netto dos
Santos.; Ethel, Leonor Noia Maciel.;Ricardo, Pinto Schuenck.(2013)Modification of
the Congo red agar method to detect biofilm production by Staphylococcus
epidermidis ;Diagnostic Microbiology and Infectious Disease;Volume 75; Issue 3;
Pages 235–239.
Khudhur;
and Iman, M. (2013).Investigating the Ability of some Bacterial
Species to Produce Slime Layer. J.of al-rafedeen sci.24 (1) p.36-49.
166
 Kidd, P.(2003). Th1/Th2 Balance: The Hypothesis; its Limitations; and
Implications for Health and Disease. Alternative Medicine Review 8(3):223-246 .
 Kindt, T.J.; Goldsby, R.A. and Osborne, B.A. (2007). Kuby immunology. 6th ed.
W. H. Freeman and Company; New York. USA.
 Kirketerp-Møller, K. (2008). The distribution; organization; and ecology of
bacteria in chronic wounds. J. Clin. Microbiol. 46:2717–2722.
 Klingenberg, C.; Aarag, E.; Rønnestad, A.; Sollid, J.E.; Abrahamsen, T.G.;and
Kjeldsen,
G.(2005).Coagulase-negative
staphylococcal
sepsis
in
neonates:
Association between antibiotic resistance; biofilm formation and the host
inflammatory response. The Pediatric Infectious Disease Journal .24(9).
 Kools, W.E. and Bannerman, T.L.(1994). Update on clinical significance of
coagulase negative staphylococci. Clin. Microbiol. Rev.;7: 117-140.
Kotb,M.(1998). Opsonic antibodies to the surface M protein of group A
 Kristian, S.A.; Birkenstock, T.A.; Sauder, U.(2008). Biofilm formation induces
C3a release and protects Staphylococcus epidermidis from IgG and complement
deposition and from neutro- phil-dependent killing.Infect Dis. 1;197(7):1028-35.
 Kumar ;Ashok; Pallab Ray; Mamta Kanwar; Meera Sharma;and Subhash
Varma.(2005). A comparative analysis of antibody repertoire against Staphylococcus
aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal
Infections.Int J Med Sci ; 2(4):129-136.
Karolis,
V.;Pal,R.;
and
N.
Gupta.(2011).Pharmaceutical
Immunology;vol. 1: 341–344.
167
microbiology;
Kaysen, G.A. (2001).The microinflammatory state in uremia: causes and potential
consequences. Journal of the American Society of Nephrology; 12:1549–1557.
Klingenberg, C.; Aarag, E.; Ronnestad, A.; Sollid, J.E.; Kjeldsen, G. and
Flaegstad, T. (2005) Coagulase-negative staphylococcal sepsis in neonates:
association between antibiotic resistance; biofilm formation and the host
inflammatory response. Pediatr Infect Dis J 24: 817–822.
Kropec, A.; T. Maira-Litrán, K. K. ; Jefferson, M. ; Grout, S. E. ;Cramton, F.
Götz; D. A. Goldmann.; and G. B. Pier. (2005). Poly-N-acetylglucosamine
production in Staphylococcus aureus is essential for virulence in murine models of
systemic infection. Infect. Immun. 73:6868-6876.
►L
 Laarman, A.; Milder, F.; van Strijp, J.; Rooijakkers, S.(2010) Complement
inhibition by gram-positive pathogens: molecular mechanisms and therapeutic
implications. J Mol Med (Berl); 88:115–120.
Lasaro, M.A.; Salinger, N.; Zhang, J .(2009).F1C fimbriae play an important role
in biofilm formation and intestinal colonization by the Escherichia coli commensal
strain Nissle 1917. Applied and Environmental Microbiology; 75(1): 246-251.
 Lauta,V.M.(2003).A review of the cytokine network in multiple myeloma:
diagnostic; prognostic; and therapeutic implications.Cancer 97(10): 2440- 2452 .
Longauerova,
participation
A. (2006). Coagulase
negative
staphylococci
and
their
in pathogenesis of human infections. Bratisl Lek Listy; 107 (11-12):
448-52.
168
Lachachi;Meriem; Hafida Hassaine; Kaotar Nayme; Samia Bellifa; Imene
M’hamedi; Ibtissem Kara Terki and Mohammed Timinouni.(2013)..Detection of
biofilm formation; icaADBC gene and investigation of toxin genes in Staphylococus
spp. strain from dental unit waterlines; University Hospital Center (UHC) Tlemcen
Algeria;academic journal; Vol. 8(6: 559-565 .
Lawrence, J. R.; G. D. W. Swerhone; G. G. Leppard; T. Araki; X. Zhang; M. M.
West; and A. P. Hitchcock. (2003). Scanning transmission X-ray; laser scanning; and
transmission electron microscopy mapping of the exopolymeric matrix of microbial
biofilms. Appl. Environ. Microbiol. 69:5543-5554.
Layer
,F.
;
B.
Ghebremedhin;
K.-A.
Moder;
W.
König
and
B.
König.(2006).Comparative Study Using Various Methods for Identification of
Staphylococcus Species in Clinical Specimens . J. Clin. Microbiol. 44 (8):24-230.
Lee, S. and Margolin K.(2011) . Cytokines in cacer immunotherapy .Cancer;
3(4):3856-3893.
Lefmann, M.; Schweickert, B.; Buchholz, P.; Göbel, U.B.; Ulrichs, T.; Seiler, P.;
Theegarten, D.; and
fluorescence
in
Moter,
A.(2006). Evaluation
of
peptide
nucleic
acid-
situ hybridization for identification of clinically relevant
mycobacteria inclinical
specimens and tissue sections. Journal of Clinical
Microbiology; 44(10): 3760 – 3767.
Leid,
J.G.;
Willson,
C.J.;
Shirtliff,
M.E.;
Hassett,
D.J
.(2005).The
exopolysaccharide alginate protects Pseudomonas aeruginosa biofilm bacteria from
IFN- γ- mediated macrophage killing. The Journal of Immunology; 175: 7512-7518.
Li, H.; Xu, L.; Wang, J.; Wen, Y.; Vuong, C.; Otto, M. and Gao, Q.(2005).
Conversion of Staphylococcus epidermidis strains from commensal to invasive by
169
expression of the ica locus encoding production of biofilm exopolysaccharide. Infect
Immun 73; 3188–3191.
►M
Mack; Dietrich; Joachim Riedewald; and Mark, E. Rupp.(1999).Essential
Functional Role of the Polysaccharide Intercellular Adhesin of Staphylococcus
epidermidis
in
Hemagglutination.Tuomanen
EI;
ed.
Infection
and
Immunity;67(2):1004-1008
 Mack, D.; Bartscht, K.; Dobinsky, S.; Horstkotte, M.A.; Kiel, K.; Knobloch,
J.K.M.; Schäfer, P.(2000).Staphylococcal factors involved in adhesion and biofilm
formation on biomaterials. In: An YH; Friedman RJ; editors. Handbook for studying
bacterial adhesion: principles; methods; and applications. Totowa: Humana Press. p.
307–30. Chap 20.
Mack, D.; Horstkotte, M.A.; Rohde, H.; Knobloch, J.(2006). Coagulase-negative
staphylococci. In: Biofilms; infections and Antimicrobial Therapy. Editors: JL; Rupp
M; Finch RG. Boca Raton: CRC Press. : 109-53.
 Mack, D.; Davies, A.P.; Harris, L.G.(2009). Staphylococcus epidermidis biofilms:
functional mol- ecules; relation to virulence; and vaccine potential. Top Curr Chem.
288:157–82.
 Mack, D.; Angharad, P. Davies; Llinos, G.;Harris; Rose Jeeves; Ben Pascoe;
Johannes, K. M. ; Knobloch; Holger Rohde and Thomas, S. Wilkinson
.(2013).Staphylococcus epidermidis in Biomaterial-Associated Infections. Wilkinson;
Medical Microbiology and Infectious Diseases; Institute of Life Science; College of
Medicine; Swansea University; Swansea SA2 8PP; UK
170
 Malave, I.;Vethencourt, M.A.;Pirela, M.; and Cordero, R. (1998).Serum levels of
thyroxine -binding prealbumin ; C-reactive protein; and interleukin -6 in proteinenergy and normal controls or with associated clinical infections .instituto venezolano
de investigacione cientificas (IVIC);44(5).236-62.
 Martín-López, J.V.; Pérez-Roth, E.; Claverie-Martín, F.; Díez-Gil, O.; Batista, N.;
Morales, M.; Méndez-Álvarez, S.(2002). Detection of Staphylococcus epidermides
clinical isolates harbouring the ica gene cluster needed for biofilm establishment. J
Clin Microbiol 40:1569-1570.
 Mary, L. Turgeon ; Margaret, B. Boone; Jill Dennis ; Patricia Kelly. (2009).
Immunology and serology in laboratory medicine. 4 th ed.
Maira-Litran, T., Kropec, A., Abeygunawardana, C., Joyce, J., Mark, G., III,
Goldmann, D.A., and Pier, G.B. (2002) Immunochemical properties of the
staphylococcal poly-N- acetylglucosamine surface polysaccharide. Infect Immun 70:
4433–4440.
 Mathur, T.; Singhal, S.; Khan, S.; Upadhyay, D.J.; Fatma, T.; Rattan, A.
(2006).Detection of biofilm formation among the clinical isolates of Staphylococci:
An evaluation of three different screening methods. Indian Journal of Medical
Microbiology ; 24(1):25-29.
 Matsushita , M.;et .al.(2000).Complement- activating complex of ficolin and
mannose- binding lectin- associated serine protease.J.Immunol;164;2281-2284.
Macleod , J .and Edwards , C .Disease of the kidney and genitourinary system in
: Davidsons principles and practice of medicine,1995, ( 17th ) ed . P 650 .
McCann, K.S .(2000). The diversity-stability debate. Nature. 405:228-233.
171
 McCool, T.L.; Cate, T.R.; Moy, G.; Weiser, J.N.(2002). The immune response to
pneumococcal proteins during experimental human carriage. J Exp Med ;195:359–65.
 McKenney, J. Hubner, E. Muller, Y. Wang, D. Goldmann, G. Pier.(1998).The ica
locus of Staphylococcus epidermidis encodes production of the capsular
polysaccharide/adhesin; Infect. Immun. 66 ; 4711-4720.
McCann ;Maureen,
T.; Brendan, F.; Gilmore and Sean, P. Gorman.(2008).
Staphylococcus epidermidis device-related nfections:pathogenesis and clinical
management;JPP 2008; 60: 1551–1571.
Melo , Poliana d. C. ; Luciano Menezes Ferreira; Antônio Nader Filho; Luiz
Francisco Zafalon; Hinig Isa Godoy Vicente; and Viviane de .(2013).Comparison of
methods for the detection of biofilm formation by Staphylococcus aureus isolated
from bovine subclinical mastitis.Braz J Microbiol. 44(1): 119–124.
 Mohit, T.; Robert, C.; Bernard, K. and Jean-Fancois R. (2003): Targeted antiinterleukin-6 monoclonal antibody therapy for cancer. Clinical Cancer Research; 9:
4653-4665.
 Muhammad;Hemn Abdalla .(2013).A comparative study on biofilm forming
capacity in Methicillin Resistant Staphylococcus aureus and Methicillin Resistant
Staphylococcus epidermidis using three different techniques.College of Science/
University of Baghdad. Master of Science in Biology . Microbiology.
Murakami; Ichiro; Michiko Matsushita;Takeshi Iwasaki; Satoshi Kuwamoto;
Masako Kato; Keiko Nagata; Yasushi Horie; Kazuhiko Hayashi; Toshihiko
Imamura;Akira Morimoto; Shinsaku Imashuku; Jean Gogusev; Francis Jaubert;
Katsuyoshi Takata; Takashi Oka and Tadashi Yoshino.(2015).Interleukin-1 loop
172
model for pathogenesis of Langerhans cell histiocytosis. J. of Cell Communication
and Signaling ; 13(1)14-31.
Mahajan, S. and Mehta, A.A. (2006). Role of cytokines in pathophysiology of
asthma. Iranian Journal of Pharmacology & Therapeutics; 5: 1-4.
Male, D.(1998). Cell migration and inflammation in Immunology; 62-70. Mosby;
London; UK.
Malic, S.; Hill, K.E.; Hayes, A.; Percival, S.L.; Thomas, D.W. and Williams,
D.W.(2009).Detection and identification of specific bacteria in wound biofilms using
peptide nucleic acid fluorescent in situ hybridization (PNA FISH). Microbiology;
155: 2603 - 2611.
Mama ;Mohammedaman; Alemseged Abdissa and Tsegaye Sewunet.(2014).
Antimicrobial susceptibility pattern of bacterial isolates from wound infection and
their sensitivity to alternative topical agents at Jimma University Specialized
Hospital; South-West Ethiopia Annals of Clinical Microbiology and Antimicrobials ;
13:14.
Mateo, M.; Maestre, J.R.; Aguilar, L.; Giménez, M.J.; Granizo, J.J.; Prieto,
J.(2007). Strong slime production is a marker of clinical significance in
Staphylococcus epidermidis isolated from intravascular catheters. Eur J Clin
Microbiol Infect Dis ;27:311-4.
Mathur, T.; Singhal, S.; Khan, S.; Upadhyay, D.J.; Fatma, T.; Rattan, A.(2006).
Detection of biofilm formation among the clinical isolates of staphylococci: an
evaluation of three different screening methods. Indian J Med Microbiol ;24(1):25-9.
173
Matthews, K.R.; R.J. Harmon and B.A. Smith .(1990). Protective effect of
Staphylococcus chromogenes infection against Staphylococcus aureus infection in the
lactating bovine mammary gland. J Dairy Sci; 73:3457-3462.
Mertens and B. Ghebremedhin.(2013).Genetic determinetic and bioofilm
formation of clinical Staphylococcus epidermidis isolates from blood culture and
indwelling devises. European Journal of Microbiology and Immunology 3;2; pp.
111–119.
Moghaddam; Mehrdad Moosazadeh and Ali Mirhosseini.(2014). Quorum Sensing
in Bacteria and a Glance on Pseudomonas aeruginosa. Clin Microbial 3:156.
Mohammed, M. M. Ali; Audun, H. Nerland; Mohammed Al-Haroni and Vidar
Bakken.(2013).Characterization of extracellular polymeric matrix; and treatment of
Fusobacterium nucleatum and Porphyromonas gingivalis biofilms with DNase I and
proteinase K. Journal of Oral Microbiology ; 5: 61 .
Mulu, W.; Kibru, G.; Beyene, G.; Damtie, M.(2012).Postoperative nosocomial
infections and antimicrobial resistance pattern of bacteria isolates among patients
admitted at Felege Hiwot Referral Hospital; Bahirdar. Ethiopia Ethiop J Health Sci
; 22(1):7–18.
Műzes, G.; Molnár, B.; Tulassay, Z. and Sipos, F. (2012). Changes of the cytokine
profile in inflammatory bowel diseases. World J. Gastroenterol.; 18: 5848-5861.
Mahdi, B. W.; Salih, B. K.; Hasan,R.M. and Ameen.(2009). Humoral Immune
Response And Luminal Microorganisms In Patients With Indeterminate Colitis.
The Internet Journal of Gastroenterology. 9 (1).
►N
174
 Nasser, M.W.; Raghuwanshi, S.K.; Grant, D.J.; Jala, V.R.; Rajarathnam, K. and
Richardson, R.M. (2009).
Differential activation and regulation of CXCR1 and
CXCR2 by CXCL8 monomer and dimer. J. Immunol.; 183 : 3425-3432.
Newman,
M.J.;
Frimpong,
E.;
Asamoah-Adu,
A.;
Sampane-Donkor,
E.(2006).Resistance to antimicrobial drugs in Ghana. The Ghanaian – Dutch
collaboration for Health Research and Development; 1-6.
Narin, R. ; and Helbert, M. (2007). Immunology for medical students. 2nd ed.
Mosby; Canada.
Nasr ;Rasha, A. ;Hala,
M. AbuShady;Hussein, S. Hussein.(2012). Biofilm
formation and presence of icaAD gene in clinical isolates of staphylococci. The
Egyptian Journal of Medical Human Genetics;13; 269–274.
Nataro, J.P.; Corcoran, L.; Zirin, S.; Swink, S.; Taichman, N.; Goin, J.; Harris,
M.C. (1994). Prospective analysis of coagulase-nega- tive staphylococcal infection
in hospitalized infants. J Pediatr 125: 798-804.
Neu, T.R.; De Boer, C.E.; Ververke, G.D.; Schutte, H.K.; Rakhorst, G.; van de,r
Mei H.C.; Busscher. H.J.(1997). Film development in time on a silicone rubber voice
prosthesis a case study. Microbiology and Ecology in Health Diseases. 7:27–33.
Novick,R.P. and Geisinger,E. (2008).Quorum Sensing in Staphylococci. Annual
Review of Genetics 42; 541-564.
Nwankwo, I. U.; Godwin, C. T. and Nwankwo, E. O. (2014).Bacterial profile
inpatientswith
indwelling urinary catheters
in
FederalMedical
Center;
Umuahia;Abia State; Nigeria;Sky Journal of Microbiology Research Vol. 2(5); pp.
028 – 031.
175
►O
 O'Gara, J. P.; and Humphreys, H.(2001).Staphylococcus epidermidis biofilms
importance and implications. H Med Microbiol 50: 582-87.
 Olusola Adeola Okhiria.(2010).The role of biofilm in wounds. thesis
phd.University of Wales Institute; Cardiff (UWIC) at the Cardiff school of Health
Sciences;Western Avenue; Llandaff; Cardiff.
Ołdak, E. and Trafny, E.A.(2005).Secretion of proteases by Pseudomonas
aeruginosa biofilms
exposed
to
ciprofloxacin.
Antimicrobial
Agents
and
Chemotherapy; 49(8): 3281-3288.
Oliveira, A.; Cunha Maria de Lourdes R.S.(2010).Comparison of methods for the
detection of biofilm production in coagulase-negative staphylococci.
BMC Res
Notes ;3:260.
Oliveira, A.; Cunha, M.L.R.S.(2010). Comparison of methods for the detection of
biofilm production in coagulase-negative staphylococci. BMC Res. ; 3;260.
O'Toole, G.; Kaplan, H.B. and Kolter, R.(2000).Biofilm formation as microbial
development. Annual Review of Microbiology; 54: 49-79.
Otto, M. and Vuong, C. (2002) Staphylococcus epidermidis infections. Microbes
and Infect 4, 481–489.
Otto, M.(2004).Virulence factors of the coagulase-negative staphylococci. Front
Biosci 1;9:841-63.
Otto, M. (2008). Staphylococcal biofilms. Curr Top Microbiol Immunol 322,
207–228.
Otto, M. (2009). Staphylococcus epidermidis-the 'accidental' pathogen.Nat. Rev.
Microbiol. 7:555-67.
176
Ozumba, U.C.; Jiburum, B.C.(2000).Bacteriology
of
Burn Woundsin
Enugu; Nigeria. Burns. 26:178-80.
►P
 Peakman, M. and Vergani, D. (1997)‘‘Basic and Clinical Immunology’’Hong
Kong: Churchill Liveingstone. 131–146.
 Pitiphat, W.; Gillman,M.W.; Joshipura, K.J. et al. (2005). C- reactive
rotein in
early pregnancy and preterm delivery.Am;J. Epidemiol; 162(11):1108-13.
 Pourmand ;Mohammad, R.; Simon, R. Clarke; Richard, F. Schuman; James, J.
Mond; and Simon, J. Foster.( 2006).Identification of Antigenic
Components of
Staphylococcus epidermidisExpressed during Human Infection. Inf.& immun.; Vol.
74; No. 8; p. 4644–4654
Prag, G.;Karin ,F.B.; Susanne, J.;
Bengt, H.; Magnus,
U. and Bo
Söderquist.(2014). Decreased susceptibility to chlorhexidine and prevalence of
disinfectant resistance genes among clinical isolates of Staphylococcus epidermidis.
ISI Journal Citation Reports © Ranking: 43(7):25–30.
Pascoli, L.; Chiaradia, V.; Mucignat, G. and Santani, G.(1986).Identifcation of
Staphylococci by the
API STAPH;
Sceptor; Rosco and Simpli®ed Lyogroup
Systems. European Journal of Clinical Microbiology 5; 669±671.
Percival, S.L.; Malic, S.; Cruz, H.; Williams, D.W.(2011). Introduction to
biofilms. Biofilms and Veterinary Medicine 6: 41-68.
Piccolomini, R.; Catamo, G.; Picciani, C.; D’Antonio, D.(1994). Evaluation of
Staph-System 18-R for identification of staphylo- coccal clinical isolates to the
species level. J Clin Microbiol 32: 649-653.
177
Pitts, B.; Hamilton, M.; Zelver, N.; Stewart, P. (2003).A microtiter-plate screening
method for biofilm disinfection and removal. Journal of Microbiological Methods.
;54:269–276.
Prigent-Combaret, C.; Vidal, O.; Dorel, C. and Lejeune, P.(1999).Abiotic surface
sensing and biofilm-dependent regulation of gene expression in Escherichia coli.
Journal of Bacteriology; 181(19): 5993 - 6002.
►Q
 Qin, Z.; Ou, Y.; Yang, L.(2007). Role of autolysin-mediated DNA release in
biofilm formation of Staphylococcus epidermidis. Microbiology. 153:2083–92.
►R
 Rachid, S.; Ohlsen, K.; Witte, W.; Hacker, J.; Ziebuhr, W.(2000). Effect of
subinhibitory antibiotic concentrations on polysaccha- ride intercellular adhesion
expression in biofilm-forming Staphylococcus epidermidis. Antimicrob Agents
Chemo- ther 44; 3357–3363 .
Reardon, C.L.; Cummings, D.E.; Petzke, L.M.(2004).Composition and diversity of
microbial communities recovered from surrogate minerals incubated in an acidic
uranium-contaminated aquifer. Applied Environmental Microbiology; 70(10):
6037-6046.
 Raad, I.; Costerton, W.; Sabharwa,l U.; Sacilowski, M.; Anaissie, E.;
- Rachel, J. Williams; Brian Henderson; Lindsay, J. Sharp ;(2002). Identification of a
Fibronectin-Binding Protein from Staphylococcus epidermidis; Infect. Immun. ; 70
(12): 6805-6810.
178
Ravindar, G.; Ragamalika, G. and Nagaraja Rao P .(2015). Analysis of proteins
profile and antibacterial activity in haemolymph of Eri silkworm;Samia cynthia ricini
after bacterial inoculation.international journal of advance research .:3(1):186-192.
 Rayfield, E.J.; Ault, M.J.; Keusch, G.T.; Brothers, M.J.; Nechemias, C.; Smith, H.
(1982) Infection and diabetes: the case for glu- cose control. Am J Med 72:439–450
Rehman,
K.;
M.A. Zia;
(2002).Conjugation of
M. Arshad;
peroxidase with
T. Mehmood
and S.
Hamid;
antibodies against haemorrhagic
septicaemia. Int. J. Agri. Biol.; 4: 78–80.
Rewatkar; Dr. B. J. Wadher. (2013). Staphylococcus aureus and Pseudomonas
aeruginosa- Biofilm formation Methods; IOSR Journal of Pharmacy and Biological
Sciences (IOSR-JPBS)(8):36-40
Rogier, J.L.Stuyt; Soo-Hyun Kim; Leonid, L. Reznikov; Giamila Fantuzzi;
Daniela Novick; Menachem Rubinstein; Bart Jan Kullberg;Jos W.M. van der Meer;
Charles A. Dinarello; Mihai, G. Netea.(2003). Regulation of Staphylococcus
epidermidis-induced IFN-c in whole human blood: the role of endogenous IL-18; IL12; IL-1; and TNF. Cytokine 21 ;p 65–73.
Rogers, P. D. Fey; and M. E. Rupp.(2009). “Coagulase-negative staphylococcal
infections;” Infectious Disease Clinics of North America; 23(1): 73–98.
Rohde, H.; Burandt, E.C.; Siemssen, N.(2007). Polysaccharide intercellular
adhesin or protein fac- tors in biofilm accumulation of Staphylococcus epidermidis
and Staphylococcus aureus iso- lated from prosthetic hip and knee joint infections.
Biomaterials. (2007);28:1711–20.
179
Rotllant, J.;Prado-Alvarez, M.; Gestal, C.; Novoa, B.; Figueras, A.(2009).
Characterization of a C3 and a factor B-like in the carpet-shell clam; Ruditapes
decussatus. Fish Shellfish Immunol. 26: 305-315.
Rupp, M.E.; Sloot, N.; Meyer, H.G.; Han, J. and
Gatermann.(1995).Characterization of the hemagglutinin of Staphylococcus
epidermidis. J Infect Dis. ;172(6):1509-18.
Bodey, G.P.(1993). Ultrastructural analysis of indwelling vascular cath- eters:
a
quantitative
relationship between
luminal
colonization and duration of
placement. J Infect Dis ;168:400–7.
Reaper Jacqueline; Sally Ann Collins; John McMullan; Roger Bayston. (2010).
The use of ASET (Anti Staph Epidermidis Titer) in the diagnosis of ventriculoatrial
shunt infection; Cerebrospinal Fluid Research; Academic Journal ; ( 7):1
Roper, M.C.; Greve, L.C.; Labavitch, J.M.; and Kirkpatrick, B.C.(2007).
Detection and visualization of an exopolysaccharide produced by Xylella fastidiosa in
vitro and in planta. Applied and Environmental Microbiology; 73(22): 7252 - 7258.
Roberts, M. E.; Stewart, P. S.(2005).Modelling protection from antimicrobial
agents in biofilms through the formation of persister sells. Microbiology 151: 75–80.
Roitt,I.; Brostoff, J.and Male, D. (2002). Immunology. 6th ed. Mosby; Spain. p.
119-129.
Rupp, G. Archer.(1992).Hemagglutination and adherence to plastics by
Staphylococcus epidermidis; Infect. Immun. 60. 4322-4327
Ruzicka, F.; Hola, V. and Votava, M .(2004). Biofilm detection and
clinicalsignificance of Staphylococcus epidermidis isolates. Folia Microbiol (Praha);
49(5):596-600.
180
► S
 Scott, D.A.and Krauss, J. (2012).Neutrophils in periodontal inflammation. Front
Oral Biol . 15: 56–83.
 Sakamoto, M. (1992). Low nutrition level and host defense. In “Foods and host
defense;” ed. by Kaminogawa S. and Murakami H.; Kodansha Ltd.; Tokyo; 9-27
Satorres, S.E.; Alcaraz, L.E.(2007). Prevalence of icaA and icaD genes in
Staphylococcus aureus and Staphylococcus epidermidis strains isolated
from
patients and hospital staff. Cent Eur J Public Health ;15(2):87–90.
 Sauer, K.; Cullen, M.C.; Rickard , A.H.(2004). Characterization of nutrientinduced dispersion in Pseudomonas aeruginosa PAO1 biofilm. Journal of
Bacteriology; 186 (21): 7312-7326.
Schlag, S.; Nerz, C.; Birkenstock, T.A.; Altenberend, F.; and Gö tz, F. (2007)
Inhibition of staphylococcal biofilm formation by nitrite. J Bacteriol 189: 7911–
7919.
 Schwartz, R.S. (2003). Immune defense and immuno regulation. Engl J
Med;
348:1017-1026.
 Seanghuoy, H.(2014).RNA polymerase inhibitor activity against Staphylococcus
epidermidis biofilms;Graduate School- New Brunswick Electronic Theses and
DissertationsOrganization NameRutgers; The State University of New Jersey
Shahrooei,Mohammad;Vishal Hira;Rita Merckx; Benoit Stijlmans ;Peter, W.M.
Hermans; Johan Van Eldere.(2009). Inhibition of Staphylococcus epidermidis biofilm
formation by rabbit polyclonal antibodies against SesC protein. Infection and
Immunity. 77(9):36703678.
181
Shahrooei, Mohammad.(2010).Identification of potential targets for vaccination
against staphylococcus epidermidis
Katholieke
Universiteit
biofilm
Leuven
Group
;phd. Medical Sciences.Leuven;
Biomedical
Sciences;Faculty
of
Medicine;Department of Medical Diagnostic Sciences.
 Shahrooei , M. ; Vishal Hira; Laleh Khodaparast;Ladan Khodaparast; Benoit
Stijlemans;Soňa Kucharíková;Peter Burghout;Peter, W. M. Hermans and -Johan Van
Eldere.(2012). Vaccination with SesC Decreases Staphylococcus epidermidis Biofilm
Formation. Infect. Immun. ; 80 (10): 60-68
Schommer,
N.N.;
Christner,
M.;
Hentschke,
M.
Ruckdeschel
,K.;
Aepfelbacher,M. and Rohde, H. (2011) .Staphylococcus epidermidis uses distinct
mechanisms of biofilm formation to interfere with phagocytosis and activation of
mouse macrophage.like cells J774A.1. Infection and Immunity 79(6):2267-76.
Speziale, P.; Visai L.; Rindi S.; Pietrocola, G.; Provenza, G.and
,M.(2008).Prevention and treatment
Provenzano
of Staphylococcus biofilms. Curr Med
Chem.;15(30):3185-95.
 Singh, P.K.; Schaefer, A.L.; Parsek, M.R.(2000). Quorum-sensing signals
indicate that cystic fibrosis lungs are infected with bacterial biofilms. Nature; 407:
762-764.
 Snijder, E.J.; Meulenberg, J.J.M.(2001). Arteriviruses. In: Knipe; D.M.; Howley;
P.M.; Griffin; D.; Lamb; R.A.; Martin; M.A.; Roizman; B.; Straus; S.E. (Eds.);
Fields Virology. 4th ed. Lippincott Williams & Wilkins; Philadelphia; PA; pp.
1205–1220.
 Stepanovic, S.; Vukovic, D.; Daki, I.; Savic, B.; Vlahovic-Svabic, M .(2000).A
modified microtiter-plate test for uantification of staphylococcal biofilm formation. J
Microbiol Methods 40:175-179.
182
 Stewart, P.S.; Costerton JW(2001)Antibiotic resistance of bacteria in biofilms.
Lancet .358(9276):135–8.
Sun, D.; Accavitti, M.A.; Bryers, J.D.(2005). Inhibition of biofilm formation by
monoclonal antibodies against Staphylococcus epidermidis RP62A accumulationassociated protein. Clin Diagn Lab Immunol ;12:93–100.
 Surman, S.B.; Walker, J.T.; Goddard, D.T.(1996).Comparison of microscope
techniques for the examination of biofilms. Journal of Microbiological Methods;
25(1):66- 70.
Sauer, K.; Camper, A.K.; Ehrlich, G.D.; Costerton, J.W. and Davies
D.G.(2002).Pseudomonas
aeruginosa
displays
multiple
phenotypes
during
development as a biofilm. Journal of Bacteriology; 184(4): 1140 - 1154.
 Sutherland; I.W.( 2001).Biofilm exopolysaccharides: A strong and sticky
framework. Microbiology ; 147; 3–9.
 Swidsinski, A.; Ladhoff, A.; Pernthaler, A.; Swidsinski, S. (2002). Mucosal Flora
in Inflammatory Bowel Disease.Gasteroenterology.122:44-54.
Sambrook, J.; Russell, D.W.(2005). Identification of associated protein by
coimmunprecipitation nature methods.2.475-476.
Schaber,
J.A.;
Hammond,
A.;
Carty,
N.L.;
Williams,
S.C.;
Colmer-
Hamood.(2007) .Diversity of biofilms produced by quorum-sensing- deficient clinical
isolates of Pseudomonas aeruginosa. Journal of Medical Microbiology; 56: 738-748.
Schleifer, K.H.; Bell, J.A.(2009).Genus I. Staphylococcus Rosenbach 1884; 18AL
(Nom. Cons. Opin. 17 Jud. Comm. 1958; 153.); in: De Vos; P.; Garrity; G.M.; Jones;
183
D.; Krieg; and N.R.; Ludwig; W.; Rainey; F.A.; Schleifer; K.H.; Whitman; and W.B.
(Eds.); Bergey’s Manual of Systematic Bacteriology; The Firmicutes; (3): 392–421.
Singh, N.P.; Goyal, R.; Manchanda, V.; Das, S.; Kaur, Z.; Talwar, V. (2003).
Changing Trends in bacteriology of burns in the burns units; Delhi; India. Burns.
29:129-32.
Spiliopoulou (2012). An extracellular Staphylococcus epidermidis polysaccharide:
relation to Polysaccharide Intercellular Adhesin and its implication in phagocytosis .
BMC Microbiology .12 :76-79.
spoering ,A.L. and Lewis,K.(
pseudomonas
.auroginosa
2001).biofilm and planktonic cell of
have
similar
resistance
to
killing
byantimicrobial.J.Bacteriol.183,6746-6751.
Sujata Prasad; N. Nayak, G. Satpathy; H.L. Nag; P. Venkatesh, S. ; Ramakrishnan;
Supriyo Ghose and T.C. Nag .(2012).Molecular & phenotypic characterization of
Staphylococcus epidermidis in implant related infections; Indian J Med Res 136; pp
483-490.
Sutcliffe,I.C. and Russell,R.R.B.(1995).Lipoproteins of Gram-Positive Bacteria.
Journal of Bacteriology 177; 1123-1128.
Sutherland, I.W.(2001).Biofilm exopolysaccharides: A strong and sticky
framework. Microbiology ; 147; 3–9.
►T
Thao Doan ; Roger Melvold; Susan Viselli; Carl Waltenbaugh.(2013) .Lippincotts
IIIustrated Reviews : Immunology . 2 nd ed.
184
 Tolker-Nielsen T; Brinch, U.C.; Ragas, P.C.; Andersen, J.B.; Jacobsen, C.S. and
Molin, S .(2000).Development and Dynamics of Pseudomonas sp. Biofilms. Journal
of Bacteriology; 182(22): 6482 - 6489.
Taye,M.(2005).Wound infection in Tikur Anbessa hospital; surgical department.
Theerthankar Das; Prashant, K. Sharma; Henk, J. Busscher; Henny, C. van der
Mei and Bastiaan, P. Krom m.(2010); Role of Extracellular DNA in Initial Bacterial
Adhesion and Surface Aggregation;Appl. Environ. Asm.org.Microbiol. vol. 76 no. 10
3405-3408
Thiago
Galvão
da
Silva
Paim;
Vlademir
Vicente Cantarelli;
Pedro
Alves d'Azevedo.(2014).Performance of the Vitek 2 system software version 5.03 in
the bacterial identification and antimicrobial susceptibility test: evaluation study of
clinical and reference strains of Gram-positive cocci.Rev. Soc. Bras. Med.
Trop. vol.47 no.3
Thorberg,
B.M.;
EL
Dnielsson-Tham,
U.
Emanuelson;
and
P.
Waller.(2009).Bovine subclinical mastitis caused by different types of coagulase
negative staphylococci. J Diary Sci; 92: 4962-4970.
►V
 Venditti ,M. ; S. Santilli ; P. Petasecca Donati ; A. Micozzi.(1991).Species
Identification and Detection of Oxacillin Resistance in Coagulase-Negative
Staphylococcus Blood Isolates from Neutropenic Patients .European Journal of
Epidemiology Volume: 7 Issue: 6 Pages: 686-689 .
Vasudevan ; Ranganathan.(2014).Biofilms: Microbial Cities of Scientific
Significance. J Microbiol Exp; 1(3) .
185
 Vandepitte, J.(2003). Basic Laboratory Procedure in clinical Bacteriology/ J.
Vandepitte (et al) World Health Organisation.
Venkatesh; Mohan, M.D.; Frank Placencia, M.D.; and Leonard, E. Weisman,
M.D.(2006).Coagulase-Negative Staphylococcal Infections in the Neonate and Child:
An Update. Semin Pediatr Infect Dis 17:120-127.
 Vogel, L.; Sloos, J.H.; Spaargaren, J.; Suiker, I.; Dijkshoorm, L.(2000).Biofilm
production by Staphylococcus epidermidis isolates associated with catheter related
bacteremia. Diagn Microbiol Infect Dis ;36:139–41.
Vuong, C.; Voyich, J.M.; Fischer, E.R.; Braughton, K.R.; Whitney, A.R.; DeLeo,
F.R.;
Otto,
M.(2004).Polysaccharide
intercellular
adhesin
(PIA)
protects
Staphylococcus epidermidis against major components of the human innate immune
system. Cell Microbiol.;6(3):269-75
Visser, C.E.; Steenbergen, J.J.;Betjes, M.G.; Meije,r S.;Arisz, L.;Hoefsmit, E.C.;
(1995). Interleukin-8 production by human mesothelial cells after direct stimulation
with staphylococci. Infect Immun ; 63:4206–9.
Vuong, C.; Go« tz, F. and Otto, M.(2000).Construction and character- ization of
an agr deletion mutant of Staphylococcus epidermidis. In- fect. Immun. 68; 10481053.
►W
Wan, M.T. and Chou, C.C.(2014).Spreading of β-lactam resistance gene (mecA)
and methicillin-resistant Staphylococcus aureus through municipal and swine
slaughterhouse wastewaters. Water Res. ; 1;64:288-95.
186
 Wang ;Xin-Min ; Liliane Noble ; Barry, N. Kreiswirth; William Eisner;William
McClements; Kathrin, U. Jansen ;Annaliesa, S. Anderson.(2003). Evaluation of a
multilocus sequence typing system for Staphylococcus epidermidis. J Med Microbiol
; vol. 52 no. 11 989-998
Wang, Y.D.; De Vos, J.; Jourdon, M.; Couderc, G.; Lu, Z.Y.; Rossi, J.F.; and
Klein, B.(2002): Cooperation between heparin-binding EGF-like growth factor and
interleukin-6 in promoting the growth of human myeloma cells. Oncogene; 21:25842592 .
Watnick, P.; and R. Kolter. (2000). Biofilm; city of microbes. J. Bacteriol.
182:2675-2679.
 Wojtyczka ,R.D. ; Kamila Orlewska ; Małgorzata Kępa ; Danuta Idzik ;
Arkadiusz Dziedzic ; Tomasz Mularz ; Michał Krawczyk ; Maria Miklasińska and
Tomasz, J. Wąsik . (2013). Biofilm Formation and Antimicrobial Susceptibility of
Staphylococcus epidermidis Strains from a Hospital Environment; Int. J. Environ.
Res. Public Health; 11; 4619-4633.
Wolbink, G.J. ; M.C. Brouwer; S. Buysmann; I.J. ten Berge and
C.E.
Hack.(1996).CRP-mediated activation of complement in vivo: assessmentby
measuring circulating complement-C-reactive protein complexes.J. Immunol.; 157
(1996); pp. 473–479
Webster, P.; Wu, S.; Gomez, G.; Apicella, M.(2006).Distribution of bacterial
proteins in biofilms formed by non-typeable Haemophilus influenzae. Journal of
Histochemistry and Cytochemistry; 54 (7): 829-842; (2006).
Wenzel, R.P .(2007). Health care-associated infections: major issues in the early
years of the 21st century. Clinical Infectious Diseases; 15(45 -1):S85-8.
187
►Y
Yazdani, R.; Oshaghi, M.; Havay,i A.; Salehi, R.; Sadeghizadeh, M.; Foroohesh,
H. (2006). Detection of icaAD gene and biofilm formation in Staphylococcus aureus
isolates from wound infections. Iranian J Publ Health 35: 25-28.
►Z
 Ziebuhr, W.; Hennig, S.; Eckart, M.; Kranzler, H.; Batzilla, C.; Kozitskaya,
S.(2006). Nosocomial infections by Staphylococcus epidermidis: how a commensal
bacterium turns into a pathogen.Int J Antimicrob Agents; 28(Suppl 1):S14-S20.
Zhou, Sh.; Xiaoguang Chao; Mingming Fei; Yuanyuan Dai and Bao
Liu.(2013).Analysis of S. Epidermidis icaA and icaD genes by polymerase chain
reaction and slime production: a case control study. BMC Infectious Diseases;
13:242.
188
Appendix
189
Appendix 1
Patients information list:
General information list: Name
Age
Number of file
sex
For Women: Pregnant
Not Pregnant
Received Antibiotic before 3 days:
Yes
No
A- Bacteriology Test :
1-General urine examination (GUE):
Reaction
Albumin
Sugar
Keton bodies
Microscopically Findings :
RBCs
Pus cells
Cast
Crystals
Other
2- Urine Culture :
Negative
Positive
Growth: Scantly
Moderate
Isolated Bacteria:
C- Immunological Test:
Immunoglobulin levels:
190
Heavy
I.g.G
I.g.M
I.g.A
Complement component levels : C3
C-Reactive protein:
IL -6:
IL-8:
191
C4
Appendixe 2
Biochemical tests of API staph system
Test
Substrate
ONPG
Enzyme
Positive
reaction
result
OrthonitrophenB-galactosidase Yellow
ADH
Arginine
Arginine
Red-orange Yellow
LDC
Lysine
Lysine
Orange
ODC
Ornithine
Ornithine
Red-orange Yellow
CIT
Soduim citrate Citrate utilizationGreenish-
Green-yellow
H2S
Soduim
H2S
Black
Colorless-
URE
Urea
Urease
Red-orange Yellow
TDA
Tryptophane
Tryptophane
Red-orange Yellow
IND
indole
Indole
Red ring
Yellow ring
VP
Soduim
Actone
Pink-red
Colorless
GEL
Gelatin
Gelatinase
Change in
Black
GIU
Glucose
O/F
Yellow
Greenish blue-
MAN
Mannitol
O/F
Yellow
Greenish
INO
Inositol
O/F
Yellow
Greenish
SOR
Sorbitol
O/F
Yellow
Greenish
RHA
Rhaminose
O/F
Yellow
Greenish
SAC
Sucrose
O/F
Yellow
Greenish
MEL
Melibiose
O/F
Yellow
Greenish
AML
Amygdalin
O/F
Yellow
Greenish blue-
ARA
Arabinose
O/F
Yellow
Greenish
192
Negative
result
Colorless
Yellow
Appendix 3
The PCR reaction mix (25 µl).
Chemicals material
Volume
DNA
5 µl (25 ng)
master mix
12.5 µl
Primer forward
1 µl
Primer reverse
1 µl
Nuclease free
5.5 µl
Total volume
25 µl
water
193
Appendix 4
2000
1800
Concentration ( mg / dl )
1600
IgG
1400
IgM
1200
IgA
1000
800
600
400
200
0
0
10
20
30
40
50
60
70
Ring Diameter ( mm )
Figure ( 1 )A-Standard curve of immunoglobulins ( IgG , IgM ,IgA)
160
140
Concentration (mg/dl)
120
100
C3
C4
80
60
40
20
0
0
10
20
30
40
50
60
70
Ring Diameter (mm)
Figure ( 1 )B- Standard curve of complement components ( C3 , C4 )
194
Appendix 5
Optical density (450 nm)
2.5
y = 0.0054x + 0.0548
R² = 0.9983
2
1.5
1
0.5
0
0
100
200
300
400
500
Standered IL-6 level (pg/ml)
Figure 2: A- Standard curve of IL-6 serum level.by using ELISA.
1.0
y = 0.025x + 0.4296
R2 = 0.906
Absorbance (405 nm)
0.8
0.6
0.4
0.2
0.0
0
200
400
600
800
IL-8 Serum Level (pg/ml)
195
1000
1200
Figure 3: B- Standard curve of IL-8 serum level.by using ELISA.
196
Download

thesis nihad kh.tektook 2016 (2)

2016nihadtektookthesis