153
NOTES & TIPS
10. Besant, P. G., Byrne, L., Thomas, G., and Attwood, P. V. (1998)
Anal. Biochem. 258, 372–375.
11. Besant, P. G., and Attwood, P. V. (1998) Anal. Biochem. 265,
187–190.
12. Almaula, N., Lu, Q., Delgado, J., Belkin, S., and Inouye, M.
(1995) J. Bacteriol. 177, 2524 –2529.
13. MacDonald, N. J., De la Rosa, A., Benedict, M. A., Freije, J. M.,
Krutsch, H., and Skeeg, P. S. (1993) J. Biol. Chem. 268, 25780 –
25789.
14. Bominaar, A. A., Tepper, A. D., and Veron, M. (1994) FEBS Lett.
353, 5– 8.
An In-Gel Assay of a Recombinant Western
Corn Rootworm (Diabrotica virgifera virgifera)
Cysteine Proteinase Expressed in Yeast
Hisashi Koiwa, 1 Matilde Paino D’Urzo,
Keyan Zhu-Salzman,* Jose Ignacio Ibeas,
Richard E. Shade,* Larry L. Murdock,*
Ray A. Bressan, and Paul M. Hasegawa
FIG. 4. (A) Autoradiogram of alkaline-hydrolyzed, neutralized
samples of GST-SLN1 (lane 1) and NDPK (lane 2) resolved by RPTLC. (B) Ninhydrin-stained image of the RP-TLC plate (A) showing
3-phosphohistidine (lane 1) and histidine (lane 2) standards, GSTSLN1 (lane 3), and NDPK (lane 4) alkaline hydrolysates. The 3-phosphohistidine standard (B, lane 1) comigrates with the radioactive
spots of the GST-SLN1 and NDPK alkaline hydrolysates (A, lanes 1
and 2).
on histidine. Through this simple, single-step separation technique, SLN1, NDPK, and other potential histidine phosphoproteins can be qualitatively analyzed
for phosphohistidine content.
REFERENCES
1. Falke, J. J., Bass, R. B., Butler, S. L., Chervitz, S. A., and
Danielson, M. A. (1997) Annu. Rev. Cell Dev. Biol. 13, 457–
512.
2. Loomis, W. F., Shaulsky, G., and Wang, N. (1997) J. Cell. Sci.
110, 1141–1145.
3. Ohmori, H., Kuba, M., and Kumon, A. (1993) J. Biol. Chem. 268,
7625–7627.
4. Urushidani, T., and Nagao, T. (1997) Biochim. Biophys. Acta
1356, 71– 83.
5. Steiner, A. W., Helander, E. R., Fujitaki, J. M., Smith, L. S., and
Smith, R. A. (1980) J. Chromatogr. 202, 263–269.
6. Noiman, S., and Shaul, Y. (1995) FEBS Lett. 364, 63– 66.
7. Wagner, P. D., and Vu, N.-P. (1995) J. Biol. Chem. 270, 21758 –
21764.
8. Posas, F., Wurgler-Murphy, S. M., Maeda, T., Witten, E. A.,
Thai, T. C., and Siato, H. (1996) Cell. 86, 865– 875.
9. Wei, Y.-F., and Matthews, H. R. (1991) Methods Enzymol. 200,
388 – 414.
Center for Plant Environmental Stress Physiology and
*Department of Entomology, Purdue University,
West Lafayette, Indiana 47907-1165
Received December 2, 1999
Cysteine proteinases and their inhibitors (cystatins)
function, in conjunction, to facilitate numerous biological processes including protein turnover, pathogenesis, and disease mitigation (1, 2). Cysteine proteinases
constitute the major digestive proteolytic activity of
many phytophagous coleopteran and hemipteran insect pests, including western corn rootworm (WCR) 2 (3,
4). Induction, by insect attack, of cysteine proteinase
inhibitors (phytocystatins) that attenuate the activity
of these digestive enzymes is presumed to be a significant host plant resistance mechanism (5, 6). Insect
countermeasures to this plant defensive strategy include utilization of diverse proteinases for digestion
and de novo production of inhibitor-insensitive proteinase(s) (7, 8).
We established previously that WCR digestive proteolytic activity is comprised primarily of multiple
isoforms of cathepsin L-like cysteine proteinases of
the papain superfamily (9). Further dissection of the
WCR proteolytic enzyme complement requires sys1
To whom correspondence should be addressed at Center for Plant
Environmental Stress Physiology, 1165 Horticulture Building, Purdue University, West Lafayette, IN 47907-1165. Fax: (765) 494-0391.
E-mail: koiwa@hort.purdue.edu.
2
Abbreviations used: WCR, western corn rootworm; scN, soyacystatin N; Cbz-F-R-Mec, N-Cbz-Phe-Arg 7-amido-4-methylcoumarin.
Analytical Biochemistry 282, 153–155 (2000)
doi:10.1006/abio.2000.4591
0003-2697/00 $35.00
Copyright © 2000 by Academic Press
All rights of reproduction in any form reserved.
154
NOTES & TIPS
tematic biochemical evaluation of structure/function
and inhibition kinetics of individual proteinases by
specific phytocystatins. Papain family proteinases
can be expressed as recombinant proteins but these
typically must be purified to near homogeneity and
then activated by removal of an autoinhibitory domain (10, 11). Such elaborate methodology is suitable for detailed characterization of a single enzyme
but is a major constraint to analysis of protein complements like those of the WCR digestive proteolytic
system, which is comprised of at least five different
cathepsin L-like proteinases (4, 9). Presumably, each
proteinase is inhibited differentially by unique defensive phyto-inhibitors (12, 13).
Herein, we report a highly sensitive assay system for
evaluation of phytocystatin inhibition of recombinant
WCR cysteine proteinases expressed in yeast cells. A
WCR cysteine proteinase, DvCAL2, was expressed in
Pichia pastoris, and secreted into gelled medium. Cysteine proteinase activity was visualized after hydrolysis of a substrate that produced a fluorescent product,
indicating that the proprotein is autoactivated presumably by deletion of the inhibitory domain. DvCAL2
activity was inhibited by inclusion, in the medium, of
soyacystatin N (scN), a cysteine proteinase inhibitor
from soybean (14).
Materials and Methods
WCR proteinase expression vector. A cDNA encoding DvCAL2 proenzyme was amplified by PCR using
forward P1 (aactcgagaaaagagaggctatttcctttgttgatttggt)
and reverse P2 (aaagcggccgcttaaactaaaggataactggcttgagttgcaataccgcaggcattgttcctgtt) primers and a cDNA
clone encoding DvCAL2 isolated from a WCR cDNA
library (H. Koiwa et al., unpublished) as template. P2
includes a point mutation that eliminates a putative
glycosylation site in the mature enzyme. After the fidelity of the nucleotide sequence was confirmed, the
XhoI-NotI fragment was cloned into pPIC9 to obtain
pCAL2. The pCAL2 was linearized by digestion with
NcoI and transformed into P. pastoris GS115 by electroporation. Pichia cells expressing human cathepsin L
(phCHL) and Saccharomyces cerevisiae BJ3501␣ cells
expressing rat cathepsin B (pCBR22) were provided by
Dr. J. S. Mort (11, 15).
Recombinant cysteine proteinase assay. Transformed Pichia cells were streaked onto YPD medium
for isolation of a single colony that was subsequently
streaked onto plates for analysis of proteinase activity.
The basal medium consisted of 0.2X YNB, 1 g/L ammonium sulfate, 20 ␮g/ml uracil, 25 mM potassium
phosphate (pH 5.0), and 0.3% phytagel (Sigma). The
carbon source was either 0.5% glucose or methanol,
and 10 ␮M Cbz-F-R-Mec was included as a proteinase
substrate (16). Two hundred microliters of methanol
FIG. 1. DvCAL2 expression cassette for Pichia pastoris. A cDNA
encoding DvCAL2 proenzyme was inserted into the XhoI and NotI
sites of pPIC9. Transcription of DvCAL2 was regulated by the
promoter and polyadenylation signal of alcohol oxidase (AOX),
and the translated product was targeted for secretion by a signal
sequence of ␣-factor (␣F) from Saccharomyces cerevisiae fused to
the N-terminus.
was added daily to the lids of the plates containing the
alcohol to compensate for evaporation. After incubation for 2 days at 28°C, proteinase substrate hydrolysis
was detected under long-wavelength UV illumination.
The scN-sensitive amidolytic activity was analyzed by
including soyacystatin in the medium at a concentration of 30 ␮g/ml.
Results and Discussion
Recombinant cysteine proteinase activity was measured using a fluorescent substrate-based assay that
was developed by modifying conventional YNB medium. Bacteriological grade agar was replaced with
phytagel (Sigma) and the concentration of YNB constituents was reduced to attenuate background fluorescence and enhance medium clarity. An acidic medium pH (5.0) promoted processing of the proteinase
proregion. A reduction in potassium phosphate level
lowered the solidification temperature of the medium
to 42– 45°C, so that recombinant scN could be added to
and distributed evenly in liquidified medium without
heat denaturation.
The DvCAL2 proenzyme was expressed in P. pastoris cells as a fusion protein with yeast ␣-factor (Fig. 1).
Although the recombinant proteinase was not detectable in a stained SDS-PAGE gel (not shown), a distinct
fluorescent zone (halo) was evident around cells expressing DvCAL2, or human cathepsin L or B growing
on plates impregnated with Cbz-F-R-Mec (Fig. 2). The
fluorescent halo is indicative of Cbz-F-R-Mec hydrolysis that releases fluorescent methylcoumarin. Proteinase expression from Pichia cells was methanol dependent and the activity was inhibited by scN, implicating
DvCAL2 as a cysteine proteinase of the papain family
(1, 17). Differential inhibition of DvCAL2 and human
cathepsin L hydrolytic activities by scN may be indicative of variation in recombinant protein expression or
relative effectiveness of the phytocystatin as an inhibitor of each specific proteinase. S. cerevisiae cells produced cathepsin B on medium containing glucose, consistent with its expression being driven by the ␣-factor
promoter (15). These results indicate that the Pichia
NOTES & TIPS
155
and their inhibitors that compose the host plant-pest
interaction.
Acknowledgments. The authors thank Northup King for WCR
cDNA clones, and Prof. J. S. Mort for the yeast clones expressing
cathepsin L and cathepsin B. This work was supported, in part, by
grants from the Indiana Soybean Board 98-210 and USDA/NRICGP
98-35503-6384. This is journal Article No. 16253 of Purdue University Agricultural Experimental Station.
REFERENCES
FIG. 2. DvCAL2 encodes a scN-sensitive cysteine proteinase.
Single colonies of Pichia pastoris or Saccharomyces cerevisiae cells
were streaked onto phytagel test media. Test media were prepared with methanol or glucose to examine specific induction of
proteinase activity, and 0 or 30 ␮g/ml scN protein to assay for
specific proteinase inhibition. Images were obtained under UV
illumination after 2 days of incubation. The fluorescent halo is
indicative of amidolytic activity secreted from the cells detected by
hydrolysis of Cbz-F-R-Mec. Strains of P. pastoris cells are 1 and 3,
GS115 (pPIC9, control); 2, GS115 (pCAL2, WCR DvCAL2); and 4,
GS115 (phCHL, human cathepsin CatL). Strains of S. cerevisiae
are 5, BJ3501␣ (control); and 6, BJ3501␣ (pCBr22, human cathepsin CatB).
cells can express a functional WCR cysteine proteinase
that is secreted to the medium where its in-gel activity
can be detected.
Substantial research and genomics information implicate papain family proteinases and their inhibitors
as having substantial involvement in biological processes of diverse organisms, including host-pest/pathogen interactions (18 –20). Typically, invading organisms express families of proteinase genes that encode
isoforms with differential sensitivities to host defensive inhibitors. Consequently, defining the function of
each proteinase, and identifying the most effective inhibitor of a specific proteinase, is not possible based
only on sequence informatics or gene expression data.
The proteinase assay system reported here is a simple
but reliable adjunct to traditional biochemical characterization techniques that require purification of native enzymes. The assay could greatly expedite highthroughput analysis of cysteine proteinase isoforms
1. Turk, B., Turk, V., and Turk, D. (1997) Biol. Chem. Hoppe-Seyler
378, 141–150.
2. Henskens, Y. M. C., Veerman, E. C. I., and Amerongen, A. V. N.
(1996) Biol. Chem. Hoppe-Seyler 377, 71– 86.
3. Kitch, L. W., and Murdock, L. L. (1986) Arch. Insect Biochem.
Physiol. 3, 561–575.
4. Gillikin, J. W., Bevilacqua, S., and Graham, J. S. (1992) Arch.
Insect Biochem. Physiol. 19, 285–298.
5. Koiwa, H., Bressan, R. A., and Hasegawa, P. M. (1997) Trends
Plant Sci. 2, 379 –384.
6. Koiwa, H., Bressan, R. A., and Hasegawa, P. M. (2000) in Biotechnology Intelligence UnitⱍRecombinant Protease Inhibitors in
Plants (Michaud, D., Ed.), Landes/Academic Press, Austin, TX,
in press.
7. Jongsma, M. A., Bakker, P. L., Peters, J., Bosch, D., and
Stiekema, W. J. (1995) Proc. Natl. Acad. Sci. USA 92, 8041–
8045.
8. Bolter, C. J., and Jongsma, M. A. (1995) J. Insect Physiol. 41,
1071–1078.
9. Koiwa, H., Shade, R. E., Zhu-Salzman, K., Paino D’Urzo, M.,
Murdock, L. L., Bressan, R. A., and Hasegawa, P. M. (2000)
FEBS Lett., in press.
10. Mach, L., Mort, J. S., and Glössl, J. (1994) J. Biol. Chem. 269,
13030 –13035.
11. Ménard, R., Carmona, E., Takebe, S., Dufour, E., Plouffe, C.,
Mason, P., and Mort, J. (1998) J. Biol. Chem. 273, 4478 – 4484.
12. Elvin, C. M., Vuocolo, T., Smith, W. J. M., Eisemann, C. H., and
Riddles, P. W. (1994) Insect Mol. Biol. 3, 105–115.
13. Bown, D. P., Wilkinson, H. S., and Gatehouse, J. A. (1997) Insect
Biochem. Mol. Biol. 27, 625– 638.
14. Zhao, Y., Botella, M. A., Subramanian, L., Niu, X., Nielsen, S. S.,
Bressan, R. A., and Hasegawa, P. M. (1996) Plant Physiol. 111,
1299 –1306.
15. Rowan, A. D., Mason, P., Mach, L., and Mort, J. S. (1992) J. Biol.
Chem. 267, 15993–15999.
16. Barrett, A. J., and Kirschke, H. (1981) Methods Enzymol. 80,
535–561.
17. Koiwa, H., Shade, R. E., Zhu-Salzman, K., Subramanian, L.,
Murdock, L. L., Nielsen, S. S., Bressan, R. A., and Hasegawa,
P. M. (1998) Plant J. 14, 371–380.
18. Gelb, B., Shi, G., Chapman, H., and Desnick, R. (1996) Science
273, 1236 –1238.
19. Lalioti, M. D., Scott, H. S., Buresi, C., Rossier, C., Bottani, A.,
Morris, M. A., Malafosse, A., and Antonarakis, S. E. (1997)
Nature 386, 847– 851.
20. Selzer, P. M., Pingel, S., Hsieh, I., Ugele, B., Chan, V. J., Engel,
J. C., Bogyo, M., Russell, D. G., Sakanari, J. A., and McKerrow,
J. H. (1999) Proc. Natl. Acad. Sci. USA 96, 11015–11022.