' 2007 Wiley-Liss, Inc.
genesis 45:101–106 (2007)
TECHNOLOGY REPORT
Generation of a Conditional Disruption of the Tsc2 Gene
Omar Hernandez, Sharon Way, James McKenna III, and Michael J. Gambello*
Department of Pediatrics, Division of Medical Genetics, University of Texas Health Science Center, Houston, Texas
Received 13 September 2006; Revised 11 December 2006; Accepted 17 December 2006
Summary: Tuberous sclerosis complex (TSC) is an autosomal dominant disorder caused by mutations in the
TSC1 or TSC2 gene. Patients afflicted with TSC develop
tumors in various organ systems, but cerebral pathology
is particularly severe. Conventional gene disruption
of the Tsc1 or Tsc2 gene in mice cause limited central
nervous system pathology. Homozygous deletion of
either gene causes midgestation lethality. To circumvent
the homozygous lethality of the conventional Tsc2
knockout we have generated a conditional allele of the
Tsc2 gene by homologous recombination in mouse ES
cells. The homozygous Tsc2flox/flox mice are identical to
wildtype in many organs typically affected by TSC, especially the brain. Using this Tsc2flox allele we have generated a null allele using Cre recombination. This allele will
be useful in investigating TSC pathology with appropriate cell and organ specific Cre-transgenic mice. genesis
C 2007 Wiley-Liss, Inc.
45:101–106, 2007. V
Key words: Tsc2; tuberin; Cre-loxP; tuberous sclerosis;
conditional allele
Tuberous Sclerosis Complex (TSC) is an autosomal dominant hamartomatous disorder with an incidence of
approximately 1/6,000 (Hyman and Whittemore, 2000).
Benign and occasionally malignant tumors occur in any
organ, but predominantly the brain, kidney, heart, lung,
and skin (Gomez, 1999). Mutations in either TSC1
or TSC2, encoding hamartin and tuberin, respectively,
are the principle cause of TSC (Consortium, 1993; van
Slegtenhorst et al., 1997). Although any organ can be
affected, brain pathology, often as cortical tubers
and subependymal nodules, is particularly debilitating.
Significant morbidity and mortality result from epilepsy, autism, and other developmental and behavioral
disabilities.
TSC1 and TSC2 control cell growth, division, adhesion,
and vesicular traffic by modulating the insulin signaling/
AKT/mTOR, Wnt/Disheveled/b-catenin, and Rho-GTP/
p27Kip1 pathways (Au et al., 2004). How perturbations
in these pathways lead to pathology is unclear. Conventional targeted disruptions of the Tsc1 and Tsc2 genes in
the mouse have been generated to model and study TSC
(Kobayashi et al., 1999, 2001; Kwiatkowski et al., 2002;
Onda et al., 1999; Wilson et al., 2005). Homozygous
disruption of either gene causes embryonic lethality.
Heterozygous mice eventually develop some aspects of
TSC (renal tumors), but have not been demonstrated to
have any major central nervous system pathology. To
address CNS pathology, a conditional disruption of the
Tsc1 gene has been crossed to a glial-specific Cre transgenic mouse (Jansen et al., 2005; Uhlmann et al., 2002).
All of the progeny develop seizures after 1 month of age
and demonstrate increased numbers of astrocytes as
well as hippocampal disorganization. These Tsc1-null
mice may be a good model for the neuropathology and
seizures associated with TSC. To further study the CNS
pathophysiology of TSC and better define the roles of
Tsc2 in normal brain physiology, we have generated and
characterized a conditional disruption of the Tsc2 gene
using the Cre-loxP and Flp-frt systems.
To generate a floxed Tsc2 allele, we made a Tsc2neo
targeting vector by inserting a loxP-BamHI site into
exon 4 and a loxP-frt-neo-frt cassette into exon 1
(Fig. 1a). To screen for neomycin resistant ES cells we
used the 30 external and 50 internal probes indicated.
Seven of 180 clones demonstrated 13 kb wildtype and
8.6 kb mutant bands on Southern blot when the genomic
DNA was digested with BamH1 and probed with the
external probe (Fig 1b). After Southern analysis of
BamHI digested DNA using the internal probe demonstrated the correct 13 kb wildtype and the 2.6 kb mutant
bands (Fig. 1b), two of the clones were selected for
blastocyst injection. Only one chimera demonstrated
germline transmission as demonstrated by PCR genotyping for the presence of the loxP-BamH1 site (Fig. 1c).
Breeding of Tsc2þ/neo heterozygotes did not generate
any live born Tsc2neo/neo homozygotes, suggesting that
the neomycin gene interfered with the expression of
Tsc2. We dissected pregnant females from heterozygous
Tsc2þ/neo crosses at different embryonic time points
* Correspondence to: Michael J. Gambello, Department of Pediatrics,
Division of Medical Genetics, University of Texas Health Science Center,
MSB 3.144, 6431 Fannin, Houston, TX 77030.
E-mail: michael.j.gambello@uth.tmc.edu
Contract grant sponsor: Tuberous Sclerosis Alliance
Published online in
Wiley InterScience (www.interscience.wiley.com).
DOI: 10.1002/dvg.20271
102
HERNANDEZ ET AL.
FIG. 1. Generation of the Tsc2neo allele. (a) Gene-targeting construct. Exons are indicated by black boxes labeled with exon numbers.
LoxP sites are marked by black triangles and frt sites by white triangles. The loxP-frt-neo-frt cassette was inserted in intron 1 and a
loxP-BamHI site in intron 4. External and internal probes used for ES cell screening are indicated. PCR primers P1F and P1R were used to
confirm germline transmission of the Tsc2neo allele. B, BamHI; A, AflII; Sf, SbfI. (b) Southern blot analysis of genomic DNA digested with
BamHI from Tsc2þ/þ and Tsc2þ/neo ES cell clones and probed with the external probe (Probe A). Positive clones (Lanes 1, 3) demonstrate
the shorter 8.6 kb band because of the introduced BamHI site. Hybridization using the internal probe (Probe B) shows 13 and 2.6 kb fragments for both Tsc2þ/neo clones (Lanes 1,2). (c) PCR product from mouse DNA using Primers P1F and P1R. Lane 1 shows a heterozygote
Tsc2þ/neo with a 433bp loxP-BamHI allele and a 389bp wild type allele; Lane 2, homozygous Tsc2neo/neo embryo DNA; Lane 3 wild type.
[Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]
and found that most Tsc2neo/neo embryos died at midgestation (Fig. 2b, c). Often nongenotypable resorptions
were found with every heterozygous cross analyzed.
Most Tsc2neo/neo embryos that we were able to genotype
were smaller and paler than the wildtype or Tsc2þ/neo
embryos and one had an open neural tube (Fig. 2b).
These Tsc2neo/neo embryos are similar to the previously
reported Tsc2 homozygous knockouts in that they are
smaller and paler than wildtype or heterozygous
embryos. They differ in that we never observed exencephaly in Tsc2neo/neo embryos. Moreover we identified
some Tsc2neo/neo embryos at embryonic time points (13,
15, and 17 dpc) when, in previous reports, no homozygous Tsc2 knockout embryos were ever found
(Kobayashi et al., 1999; Onda et al., 1999). We also
observed that Tsc2þ/neo heterozygous mice developed
renal cysts after a year of age (Fig. 2d, e). We have not
detected frank renal tumors in these mice. Reported
Tsc2 knockout mice all developed renal cysts and
tumors within a year of life. These genetic data suggest
that the Tsc2neo allele is hypomorphic. To confirm this
biochemically, we performed western analysis of whole
embryo lysates (Fig. 2a.) Strong tuberin bands are seen
for the wild type and the Tsc2þ/neo lysates but a faint
tuberin band is visible for Tsc2neo/neo. Note that hamartin levels are unaffected and there is an increase in phosphorylated S6 in both Tsc2þ/neo and Tsc2neo/neo lysates,
genesis DOI 10.1002/dvg
indicating activation of the mTOR pathway. These data
demonstrate genetically and biochemically that the
Tsc2neo allele is hypomorphic.
To generate a conditional allele of Tsc2 that would
be useful for modeling the multiorgan pathology of
TSC in the mouse, we removed the neomycin gene by
mating the Tsc2þ/neo to FLPe transgenic mice (Fig. 3a)
(Rodriguez et al., 2000). We confirmed that the neomycin gene was removed by PCR detection of the loxP-frt
site that remains after Flp recombination (Fig. 3b). The
resultant Tsc2þ/flox mice were intercrossed to generate
Tsc2flox/flox homozygotes, which are viable, fertile and
appear to behave like wildtype mice. To further characterize the Tsc2flox/flox mice and ensure their utility for
future organ and cell specific Cre-mediated deletion, we
perfused mice with 4% paraformaldehyde and performed routine histologic analysis of various organs. No
differences were found in the cerebral cortex, hippocampus, cerebellum, liver, lung or kidneys of the
Tsc2flox/flox mice when compared with the littermate
control (Fig. 4).
To demonstrate that the Tsc2flox allele could be converted to a null allele by Cre recombination, we mated the
Tsc2flox/flox mice with a CMV-Cre transgeneic mouse
(Fig. 3a). Complete deletion of exons 2–4 was demonstrated by PCR genotyping (Fig. 3c). To demonstate
genetically that our Tsc2 ko allele is truly a null allele, we
CONDITIONAL DISRUPTION OF THE Tsc2 GENE
103
FIG. 2. Analysis of Tsc2neo allele (a) Western analysis of lysates from E12.5 embryos. Note the low level of tuberin antigen in the Tsc2neo/neo
lane. Hamartin levels are unaffected. Phosphorylated S6 is increased in both Tsc2þ/neo and Tsc2neo/neo lysates. (b) Comparison of embryos
at E12.5. Tsc2neo/neo embryos were slightly smaller than wildtype and were distinctly underdeveloped and pale. Most noticeable is the lack
of digitation of paws and the head size. Note the open neural tube indicated by the arrows. (c) Genotype frequency of Tsc2þ/neo crosses
demonstrating the lethality of Tsc2neo/neo embryos. Asterisk (*) denotes nongenotypable resorptions. (d) Kidneys from Tsc2þ/neo mice at
various ages demonstrating cysts, and an H and E histology of a simple cyst, demonstrating renal cyst. Bar represents 1 mm for gross
kidney photographs. (e) Table characterizing the kidney cyst phenotype. Note that no cysts developed in the first year of life, most cysts
were 1 mm or less. No tumors were detected. [Color figure can be viewed in the online issue, which is available at www.interscience.
wiley.com.]
performed heterozygous crosses to determine if our
homozygous knockout Tsc2ko/ko die at midgestation as
previously reported. No adult homozygous knockout
Tsc2 mice were detected (Fig. 5c). Embryonic analysis at
midgestation demonstrated midgestation lethality similar
to previously published reports. Severe growth retardation was noted in the Tsc2ko/ko mice (Figure 5b). Western analysis of whole embryo lysates demonstrates the
complete absence of tuberin antigen in the Tsc2ko/ko
embryos, with unaffected hamartin levels (Fig. 5a). Note
in particular that phosphorylated S6 is increased in both
Tsc2þ/ko and Tsc2ko/ko embryos, demonstrating the activation of the mTOR pathway. The kidney phenotype in
our Tsc2þ/ko mice is also similar to previously published
reports. Lesions are detected within the first year of life
(Fig. 5h) and are comprised of cysts and frank tumors
(Fig. 5d,e). Histology demonstrates cystadenomas and
renal tumors with abnormal giant cells (Fig. 5f,g).
Though TSC is complex, efforts to understand the
pathophysiology of this disease have been rather fruitful.
TSC2 occupies a central role in inhibiting mTOR activity
(Au et al., 2004). Loss of tuberin results in increased
mTOR activity with consequent increases in translation,
cell growth, and proliferation. Rapamycin, a well known
inhibitor of mTOR, has been used in trials to replace the
TSC2 inhibition lost in TSC patients. Animal and human
trials have been very encouraging (Franz et al., 2006;
Kenerson et al., 2005; Lee et al., 2006). Nonetheless,
tumors can often develop resistance to one chemotherapeutic agent. Consequently other targets should be
genesis DOI 10.1002/dvg
104
HERNANDEZ ET AL.
FIG. 3. Generation of the Tsc2flox and Tsc2ko alleles. (a) The Tsc2neo allele was converted to a floxed allele by mating with a FLPe transgenic mouse. Heterozygous and homozygous Tsc2flox mice were obtained at the expected Mendelian frequencies, and homozygous mice
were viable and fertile. A Tsc2ko allele was generated by mating the Tsc2flox mice with a general Cre-deletor strain. (b) PCR of tail DNA from
conditional knockout mice using primers P2F and P2R. The 1172bp band indicates the presence of the loxP-frt site while the 1000bp band
represents a wildtype allele. (c) PCR of tail or embryo DNA using primers P4F, P3R, and P3F to detect the wild type and the Tsc2ko alleles.
The 1090 bp band represents the null allele. Homozygous Tsc2ko/ko genotypes were only identified at embryonic time points due to the
lethality of the null phenotype (Lane 3).
FIG. 4. Comparison of organs of wild type vs Tsc2flox/flox mice. Tsc2þ/þ: a, c, e, g, i, k; Tscflox/flox: b, d, f, h, j, l. (a, b) Cerebral cortex. (c, d)
Hippocampus. (e, f) Cerebellum. (g, h) Liver. (i, j) Lung. (k, l) Kidney. Magnification: 403 (a–d); 2003 (e–l).
sought by further understanding the pathophysiology of
TSC, particularly in the brain. The conditional allele of
Tsc2 that we have created is susceptible to Cre-mediated
deletion to form a null allele. This allele will be valuable
genesis DOI 10.1002/dvg
for studying postnatal organ and cell-specific pathology.
Such postnatal studies will expand our knowledge of
TSC pathology and shed new light on novel functions of
TSC2.
CONDITIONAL DISRUPTION OF THE Tsc2 GENE
105
FIG. 5. Analysis of Tsc2ko allele. (a) Western analysis of E12.5 embryo lysates. Note the absence of tuberin in Tsc2ko/ko lysates, with the
preservation of hamartin levels in all genotypes. Phosphorylated S6 is increased in Tsc2þ/ko and even more so in the Tsc2ko/ko lysates, demonstrating activation of the mTOR pathway. (b) Comparison of embryos at E12.5. Wildtype and Tsc2þ/ko mice are virtually identical. The
Tsc2ko/ko mouse is severely growth retarded. (c) Genotype frequency of Tsc2þ/ko crosses demonstrating the lethality of Tsc2ko/ko. Asterisk (*)
denotes non-genotypable resorptions. (d) Kidney phenotype. Note the multicyst development (white arrows) in Tsc2þ/ko mice. A small tumor
is indicated by the black arrowhead (e) A large tumor was found in a Tsc2þ/ko mouse at 11 months of age. (f) Histology of a complex cyst.
(g) Histology of tumor shown in panel e. Note the presence of giant cells and nuclei (white arrowheads). (h) Table characterizing the kidney
phenotype. Note that cysts as well as tumors were detected within the first year of life, much sooner than with the Tsc2neo phenotype. [Color
figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]
MATERIALS AND METHODS
albino C57BL/6 mice. Only one clone demonstrated
germline transmission as evidenced by PCR genotyping.
Generation of Targeting Construct
The targeting construct was made by PCR amplification
of 129 3 1 genomic DNA (Jackson Laboratories). All
cloning was performed in the pBluescript backbone
(Stratagene). A 5 kb fragment containing exons 1a-2 was
amplified using primers T2E forward AGAAGGCAGCACCTCTGTCA and T2E reverse CCACCTCCTCAAGCTTCTTA. The 30 arm containing exons 2–6 was amplified
using T2F forward TATTATCGATGTGAGTGGCCTCTGTCTTGG and T2F reverse TATTCCCGGGCAGTGCAGGTAAGCGAGAGT and cloned into a Bluescript vector containing loxP-frt-neo-frt. A loxP and a new BamH1 site
were introduced into the SbfI site in intron 4. Both
vectors were then combined to generate the full length
targeting vector. All exons and intron–exon junctions
were sequenced to ensure no deleterious mutations
were introduced. The functionality of the loxP and frt
sites were tested in bacteria containing Cre and Flp
respectively (data not shown). Linearized plasmid was
electroporated into R1 ES cells. Screening with an external probe yielded 7 positive clones out of 180. Two of
these clones were selected for blastocyst injection and
yielded high level mosaic mice, which were mated with
Genotyping
Genomic DNA was isolated from tail snips using routine protease digestion and phenol:chloroform extraction. For Southern analysis, DNA was digested with
BamHI, separated on a 1% agarose gel and transferred to
nylon. Probes were labeled with high prime (Amersham)
to high specific activity and hybridized using ULTRAhybTM (Ambion). Washed nylon was exposed to Kodak
XAR film at 808C.
PCR primers were developed to detect all of the various alleles. To genotype the Tsc2neo allele, primers P1F
50 -CAGGCATGTCTGGAGTCTTG-30 and P1R 50 -CAGCAGGTCTGCAGTGAATC-30 were designed to detect the
presence of the loxP-BamHI site introduced into intron
4 (Fig. 1a). To genotype the Tsc2flox allele, primers P2F
50 -TCCGGCTTGAAGGAGAAGTT-30 and P2R 50 -ATTGTTGAGGCCGCATTCAC-30 were designed to detect the
loxP-frt sites that would remain after removal of the neomycin cassette by Flp recombination (Fig. 3a). Primers
P3F 50 -AAGATTCCGGCTTGAAGGAG-30 , P4F 50 -CACTAGTCTAGCCTGACTCT-30 , and P3R 50 -GAGGACAAGCCAgenesis DOI 10.1002/dvg
106
HERNANDEZ ET AL.
0
ACATCCAT-3 were designed to detect the null allele as
well as the wildtype allele (Fig. 3a).
Protein Analysis
Whole cell lysates were made from E12.5 embryos
that were quick frozen in liquid nitrogen. After genotyping a small piece of each embryo, samples were pooled
by genotype and homogenized in a dounce homogenizer
with 10 volumes of Ripa buffer with protease inhibitor
cocktail (Sigma). Lysates were centrifuged at 48C,
sonicated and frozen until use. Protein concentrations
were determined with a BCA reagent kit (Pierce). Equal
amounts of protein were separated on a denaturing
4–12% gradient gel (Invitrogen) and transferred to nitrocellulose. The same membrane was probed with three
different antibodies using a stripping procedure after
each experiment. The membrane was first probed with
tuberin antibody (1:1,000, Cell Signaling), then with
hamartin (1:1,000, Santa Cruz), and lastly with phosphorylated (Ser 240/244) S6 (1:2,000, Cell Signaling).
Secondary antibodies were horseradish peroxidase conjugated. Visualization was done with an enhanced chemiluminescence kit (Amersham).
Embryo and Organ Analysis
The day of the vaginal plug was 0.5. Mice were then
anesthetized with avertin and killed by cervical dislocation before embryos were dissected into cold PBS. The
yolk sac or a small piece of the embryo was used for genotyping. For organ analysis, mice were anesthetized with
avertin and transcardially perfused with 4% paraformaldehyde. Organs were postfixed in paraformaldehyde
overnight and then dehydrated and embedded in paraffin. Five micron microtome sections were cut. Slides
were then rehydrated, stained with routine hematoxylin
and eosin, and coverslipped. Embryo and tissue images
were captured with a SPOT RT digital camera.
ACKNOWLEDGMENTS
We thank Gail Martin for the loxp-frt-Neo-frt construct.
Special thanks to Jan Parker-Thornberg and Richard
Behringer for reagents and use of the MD Anderson Core
facility.
LITERATURE CITED
Au K-S, Williams A, Gambello M, Northrup H. 2004. Molecular genetic
basis of tuberous sclerosis complex: From bench to bedside.
J Child Neurol 19:699–709.
genesis DOI 10.1002/dvg
Consortium ECTS. 1993. Identification and characterization of the
tuberous sclerosis gene on chromosome 16. Cell 75:1305–1315.
Franz D, Leonard J, Tudor C, Chuck G, Care M, Sethuraman G, Dinopoulos A, Thomas G, Crone K. 2006. Rapamycin causes regression of
astrocytomas in tuberous sclerosis complex. Ann Neurol 59:490–
498.
Gomez MR, editor. 1999. Tuberous sclerosis complex, 3rd ed. New
York: Oxford University Press.
Hyman M, Whittemore V. 2000. National Institutes of Health Consensus
Conference: The tuberous sclerosis complex. Arch Neurol 57:
662–665.
Jansen L, Uhlmann E, Crino P, Gutmann D, Wong M. 2005. Epileptogenesis and reduced inward rectifier potassium current in tuberous
sclerosis complex-1-deficient astrocytes. Epilepsia 46:1871–1880.
Kenerson H, Dundon T, Yeung R. 2005. Effects of rapamycin in the
Eker rat model of tuberous sclerosis complex. Pediatr Res 57:
67–75.
Kobayashi T, Minowa O, Kuno J, Mitani H, Hino O, Noda T. 1999. Renal
carcinogenesis, hepatic hemangiomatosis, and embryonic lethality
caused by a germ-line Tsc2 mutation in mice. Cancer Res 59:
1206–1211.
Kobayashi T, Minowa O, Sugitani Y, Takai S, Mitani H, Kobayashi E,
Noda T, Hino O. 2001. A germ-line Tsc1 mutation causes tumor
development and embryonic lethality that are similar, but not
identical to, those caused by Tsc2 mutation in mice. Proc Natl
Acad Sci USA 98:8762–8767.
Kwiatkowski D, Zhang H, Bandura J, Heiberger K, Glogauer M,
el-Hashemite N, Onda H. 2002. A mouse model of Tsc1 reveals
sex-dependent lethality from liver hemangiomas, and up-regulation of p70S6 kinase activity in Tsc1 null cells. Hum Mol Genet
11:525–534.
Lee L, Sudentas P, Dabora S. 2006. Combination of rapamycin analog
(CCI-779) and interferon-gamma is more effective than single
agents in treating a mouse model of tuberous sclerosis. Genes
Chromosomes Cancer 45:933–944.
Onda H, Lueck A, Marks P, Warren H. 1999. Tsc2þ/ mice develop
tumors in multiple sites that express gelsolin and are influenced
by genetic background. J Clin Invest 104:687–695.
Rodriguez C, Buchholz F, Galloway J, Sequerra R, Kasper J, Ayala R,
Stewart A, Dymecki S. 2000. High-efficiency deleter mice show
that FLPe is an alternative to Cre-loxP. Nat Genet 25:139–140.
Uhlmann E, Wong M, Baldwin R, Bajenaru M, Onda H, Kwiatkowski D,
Yamada K, Gutmann D. 2002. Astrocyte-specific TSC1 conditional
knockout mice exhibit abnormal neuronal organization and
seizures. Ann Neurol 52:285–296.
van Slegtenhorst M, deHoogt R, Hermans C, Nellist M, Janssen B,
Verhoef S, Lindhout D, Ouweland A, Halley D, Young J, Burley M,
Jeremiah S, Woodward K, Nahmias J, Fox M, Ekong R, Osborne J,
Wolfe J, Povey S, Snell RG, Cheadle JP, Jones AC, Tachataki M,
Ravine D, Sampson JR, Reeve MP, Richardson P, Wilmer F, Munro
C, Hawkins TL, Sepp T, Ali JB, Ward S, Green J, Yates JR,
Kwiatkowska J, Henske EP, Short MP, Haines JH, Jozwiak S, Kwiatkowski DJ. 1997. Identification of the tuberous sclerosis gene
TSC1 on chromosome 9q34. Science 77:805–808.
Wilson C, Idziaszczyk S, Parry L, Griffiths D, Lazda E, Bayne R, Smith A,
Sampson J, Cheadle J. 2005. A mouse model of tuberous sclerosis
1 showing background specific early post-natal mortality and metastatic renal cell carcinoma. Hum Mol Genet 14:1839–1850.