Molecular
Cancer
Research
Oncogenes and Tumor Suppressors
Tumor Suppressor NF2 Blocks Cellular Migration
by Inhibiting Ectodomain Cleavage of CD44
€ hme1, Yong Li1,
Monika Hartmann1, Liseth M. Parra1,2, Anne Ruschel1, Sandra Bo
1
2
1
Helen Morrison , Andreas Herrlich , and Peter Herrlich
Abstract
Ectodomain cleavage (shedding) of transmembrane proteins
by metalloproteases (MMP) generates numerous essential signaling molecules, but its regulation is not totally understood.
CD44, a cleaved transmembrane glycoprotein, exerts both antiproliferative or tumor-promoting functions, but whether proteolysis is required for this is not certain. CD44-mediated
contact inhibition and cellular proliferation are regulated by
counteracting CD44 C-terminal interacting proteins, the tumor
suppressor protein merlin (NF2) and ERM proteins (ezrin,
radixin, moesin). We show here that activation or overexpression of constitutively active merlin or downregulation of ERMs
inhibited 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced
[as well as serum, hepatocyte growth factor (HGF), or plateletderived growth factor (PDGF)] CD44 cleavage by the metalloprotease ADAM10, whereas overexpressed ERM proteins
promoted cleavage. Merlin- and ERM-modulated Ras or Rac
activity was not required for this function. However, latrunculin
(an actin-disrupting toxin) or an ezrin mutant which is unable
to link CD44 to actin, inhibited CD44 cleavage, identifying a
cytoskeletal C-terminal link as essential for induced CD44
cleavage. Cellular migration, an important tumor property,
depended on CD44 and its cleavage and was inhibited by
merlin. These data reveal a novel function of merlin and suggest
that CD44 cleavage products play a tumor-promoting role.
Neuregulin, an EGF ligand released by ADAM17 from its proform NRG1, is predominantly involved in regulating cellular
differentiation. In contrast to CD44, release of neuregulin from
its pro-form was not regulated by merlin or ERM proteins.
Disruption of the actin cytoskeleton however, also inhibited
NRG1 cleavage. This current study presents one of the first
examples of substrate-selective cleavage regulation.
Introduction
cell-cycle arrest and tumor suppression (1–3). To achieve cell-cycle
arrest, the tumor suppressor protein merlin (neurofibromatosis
type 2; NF2) is recruited to the cytoplasmic tail of CD44, a location
from which it inhibits Ras- and Rac-dependent signaling (1, 4). On
the other hand, CD44 can counteract the tumor suppressor p53. In
order for p53 to act as a tumor suppressor, CD44 expression needs
to be downregulated (5). In addition, CD44 acts as coreceptor for
receptor tyrosine kinases, the most prominent example being c-Met
which depends on the presence of a CD44 splice variant comprising
exon v6 (6). This second function of CD44 promotes tumor growth
and metastasis formation (7–9).
The tumor suppressor protein merlin (NF2), like CD44, is
ubiquitously expressed in mammals. Mice carrying one mutated
nf2 allele are at risk of developing several types of tumors (10).
Merlin is kept inactive in proliferating cells but is activated by
dephosphorylation of 2 serines upon cell–cell contact and/or
hyaluronan binding (ref. 2 and unpublished data). Dephosphorylation is regulated by a signal transduction pathway emerging
from cell–cell and/or hyaluronan–cell contact and involves all ERM
proteins in addition to merlin. Interestingly, while merlin is activated by this process, the ERM proteins are inactivated (11–13).
Several types of analyses have led to proposals on how merlin could
act as a tumor suppressor, for example, by inhibiting mitogenic
signaling, activating the Hippo pathway, and/or promoting the
establishment of adherens junctions (reviewed by ref. 14).
Several years ago, it was discovered that CD44—like numerous
other transmembrane proteins—is subject to ectodomain cleavage
by metalloprotease activity (15, 16), now identified as ADAM10 (a
The ubiquitously expressed surface glycoprotein CD44 is
involved in a number of cellular functions not all of which are
understood in molecular terms. Its role in cell-cycle control has
obtained most attention and it seems mechanistically best understood. Depending on extracellular ligands, intracellular partner
proteins, and/or the inclusion of alternatively spliced exon
sequences, CD44 can act as a tumor suppressor and mediate contact
inhibition or can act alternatively as a tumor promoter and metastasis inducer. Binding of high-molecular-weight hyaluronan causes
1
Leibniz Institute for Age Research, Fritz Lipmann Institute, Jena, Germany. 2Harvard Institutes of Medicine, Renal Division, Brigham and
Women's Hospital, Harvard Medical School, Boston, Massachusetts.
Note: Supplementary data for this article are available at Molecular Cancer
Research Online (http://mcr.aacrjournals.org/).
Current address for Y. Li: Anhui University School of Life Sciences, Hefei, China.
M. Hartmann and L.M. Parra shared first authorship and A. Herrlich and P. Herrlich
shared senior authorship.
Corresponding Authors: Peter Herrlich, Fritz Lipmann Institute, Leibniz Institute
for Age Research, Beutenbergstr. 11, Jena 07745, Germany. Phone:
493641656257; Fax: 4903641656351; E-mail: herrlich@fli-leibniz.de; and
Andreas Herrlich, Harvard Institutes of Health, Renal Division, Brigham and
Women's Hospital, Boston, MA, E-mail: aherrlich@partners.org
doi: 10.1158/1541-7786.MCR-15-0020-T
2015 American Association for Cancer Research.
www.aacrjournals.org
Implications: Investigating transmembrane protein cleavage and
their regulatory pathways have provided new molecular insight
into their important role in cancer formation and possible treatment. Mol Cancer Res; 13(5); 879–90. 2015 AACR.
879
Hartmann et al.
Table 1. Primers used for mutagenesis
Site-directed mutagenesis
Forward primer 50 –30
CD44 KR-Mt
CAGTAGGGCAGCGTGTGGGCAGGCGGCGGCGCTGGTGATC
CD44DICD
GCATTGCTGTCAACTGAAGGAGAAGGTG
CD44Dstalk
GTGATGGCACCTGGCTTATCATC
disintegrin and metalloprotease 10; refs. 17–19). This is followed by
g-secretase–dependent release of the cytoplasmic tail, which promotes the expression of proliferation-promoting genes in the nucleus. Given the tumor-suppressive role of hyaluronan-bound CD44,
ectodomain cleavage would abolish this function. We therefore
investigated how ectodomain cleavage of CD44 might be regulated.
We report here that it is the tumor suppressor protein merlin
itself that prevents CD44 cleavage, supporting the notion that
proteolytic processing of CD44 promotes tumor growth and the
hypothesis that naturally occurring Nf2 mutants that are prone to
malignancies may fail to inhibit CD44 ectodomain cleavage and
thereby its tumor-promoting role. This cleavage regulation is
specific to CD44, as we show that NRG1, the pro-form of the
EGF ligand neuregulin, an ADAM17 substrate and major regulator
of cellular differentiation, is cleaved upon stimulation but is not
regulated by merlin or ERM.
Materials and Methods
Reagents
DNA oligonucleotides (Metabion GmbH); 12-O-tetradecanoylphorbol-13-acetate (TPA), DAPT, latrunculin B, and batimastat
(BB94; Calbiochem); PD98059 (Cell Signaling Technology);
angiotensin II (ARIAD Pharmaceuticals, Inc.), 4-OH tamoxifen,
EGF, FGF (Sigma); hepatocyte growth factor (HGF) and plateletderived growth factor (PDGF; R&D Systems); and CK-548 (Tocris).
Antibodies
Anti-FLAG (M2 and SIG1-25; Sigma) and phosphospecific
antibodies against ezrin (Thr567)/radixin (Thr564)/moesin
(Thr558) and p44/42 MAPK (Thr202/Tyr204; Cell Signaling
Technology); ADAM10 (735–749; Calbiochem or R&D Systems);
ezrin (3C12; Thermo Fisher Scientific); ezrin (C-15), moesin (C15), radixin (C-15), c-Myc (9E10), HA (F-7), NF2 (C-19; C-18; B12), ERK 1 (K-23), NRG antibody (C-20), and actin (I-19; Santa
Cruz Biotechnology Inc.); CD44 (IM7, Becton Dickinson); and
a-tubulin (Abcam). Antibodies directed against human CD44: for
an N-terminal epitope H-CAM F4 (Santa Cruz) and for a Cterminal epitope ARP61023-P050 (Aviva Systems Biology). Rabbit polyclonal antibody recognizing the N-terminus of APP was
provided by Christoph Kaether (http://www.imb-jena.de/"; Fritz
Lipmann Institute - Leibniz Institute for Age Research, Jena,
Germany). All secondary antibodies were from Dako.
Plasmids
The sequence encoding the standard isoform of rat CD44 was
subcloned into the NotI/XbaI sites of pFLAG-myc-CMV-21. CD44
mutants were generated by site-directed mutagenesis. The primers
are listed in Table 1. Plasmids encoding mouse pro-neuregulin-1
(NRG1) have been described (20). FLAG-tagged NRG1 was subcloned into EcoRI and XhoI restriction sites of pFLAG-myc-CMV-21
(Sigma). Sequences encoding tagged CD44 were subcloned from
pFLAG-myc-CMV-21 vector into the EcoRI site of the pCDH-CMVMCS.Bsd viral vector. All constructs were verified by sequencing. For
stable downregulation of NF2, we used the viral vector pLV-H1GIPZ (provided by Cui Yan and Helen Morrison, Jena, Germany).
880 Mol Cancer Res; 13(5) May 2015
Reverse primer 50 –30
GATCACCAGCGCCGCCGCCTGCCCACACGCTGCCCTACTG
CACCTTCTCCTTCAGTTGACAGCAATGC
GATGATAAGCCAGGTGCCATCAC
siRNA sequences
siRNA SMARTpools, cocktail of 4 siRNAs and control "NonTARGETplus Pool" were from Thermo Scientific Dharmacon.
Other siRNA oligonucleotides were from Applied Biosystems/
Ambion. The sequences of the siRNA oligonucleotides are listed
in Table 2. For downregulation of ERM proteins, a mixture of
oligonucleotides targeting ezrin, radixin, and moesin was used.
Definition of growth conditions
Low cell density (exponential growth) ¼ density recorded at 36
hours after seeding of 1.25 104 cells per cm2 (NIH3T3) or 3.65 104 cells per cm2 (RPM-MC). High cell density (confluent growth
condition) ¼ density recorded at 36 hours after seeding of 3.5 104 cells per cm2 (NIH3T3 cells) or 10 104 cells per cm2 (RPMMC cells).
Inhibition of cleavage conditions
Metalloprotease activity was blocked with 5 mmol/L batimastat
(BB94; Calbiochem) 15 minutes before TPA stimulation. g-Secretase activity was blocked by 5 mmol/L DAPT (Sigma) or by 10
mmol/L compound E (Enzo).
Cell migration assays—scratch wound assay
We isolated mouse embryonic fibroblasts from mice with
cd44flox/flox [cd44fl/fl; GT(Rosa)26-CRE (B6/129)] and immortalized these by downregulation of p19ARF. Cd44 gene deletion was
achieved by treatment with tamoxifen. Scratch wound assays were
performed in triplicates in 6-well plates at high cell density (1.5 105 cells per well). Twenty-four hours after seeding, cells were
serum-starved for another 24 hours. Scratches were introduced
with a 200-mL pipette tip and cultures were resupplied with serumcontaining medium. Where indicated, cleavage was inhibited by
adding 5 mmol/L batimastat. Scratches were imaged at 10, 24, and
36 hours after scratching. Wound areas were quantified using
Photoshop and ImageJ software.
Statistical analysis
Intensity of immunoblot bands was quantified using ImageJ
and Image Lab (BioRad) software. All values on histograms are
reported as mean SD. P < 0.05 (Student t test) was considered
significant.
Table 2. siRNA oligonucleotides
GenBank
Target
accession no.
Human ADAM10
NM_001110
Luciferase (control)
Human ezrin
Human radixin
Human moesin
NM_003379
NM_002903
NM_002444
Sense strand
sequence: 50 -. . .-30
GCUAAUGGCUGGAUUUAUU
GGACAAACUUAACAACAAU
CCCAAAGUCUCUCACAUUA
GCAAGGGAAGGAAUAUGUA
CGUACGCGGAAUACUUCGATT
AACCCCAAAGAUUGGCUUUCC
AAGCAGUUGGAAAGGGCACAA
AGAUCGAGGAACAGACUAAGA
Molecular Cancer Research
Merlin/NF2 Blocks Ectodomain Cleavage of CD44
See Supplementary Data for Cell lines, transfections, TCA-DOC
precipitations, coimmunoprecipitation, generation of cell
lysates and analysis
Results
Increased cell density inhibits ectodomain cleavage of CD44
As has been reported previously, CD44 is subject to the metalloprotease ADAM10-dependent ectodomain cleavage and subsequent release of the cytoplasmic CD44 C-terminus by g-secretase
(17–19). Aiming at understanding the regulation of CD44 ectodomain cleavage, we introduced expression constructs encoding
doubly tagged (N- and C- terminal tags) CD44 proteins into
NIH3T3, CD44/ MEFs, RPM-MC, or MDA-MB-231 cells and
examined their proteolytic processing. The N-terminus of CD44
carried a FLAG tag, the C-terminus, a c-myc motif. RPM-MC
human melanoma cells, as well as CD44/ MEFs, do not express
endogenous CD44, which simplified detection of the transfected
molecule, permitted to introduce CD44 mutants, and allowed to
analyze signaling pathways independently of endogenous CD44.
In NIH3T3 and MDA-MD-231 cells, we also investigated the
cleavage of endogenous CD44. NRG1 was similarly tagged by
N-terminal FLAG and C-terminal myc tag. CD44 and NRG1
cleavage was induced by TPA, a phorbol ester that mimics diacylglycerol and activates most protein kinase C (PKC) isoforms.
Cleavage could also be induced by serum factors, by HGF and
PDGF, and, if cells carried the appropriate G-protein–coupled
receptor, by angiotensin II. In most experiments, g-secretase
activity was blocked using the g-secretase inhibitor, DAPT, to
quantitate only the products of the first processing event, ADAMdependent ectodomain cleavage. Omission of DAPT did not
significantly alter our principal results on regulation, but caused
further processing of the C-terminal ADAM-dependent cleavage
product (Supplementary Fig. S1). It is important to note that in
our analysis of CD44 and NRG1 cleavage, we ensured that we
focused exclusively on processing of the substrates after their
proper insertion into the plasma membrane. To ascertain this,
we carried out experiments very shortly after cell surface biotinylation, showing that biotinylated ectodomains, solCD44E and
neuregulin, are indeed released into the supernatant (Supplementary Fig. S2), suggesting cleavage of substrates already present on
the cell surface. However, the effect of transport regulation on
cleavage has not been examined here.
Figure 1A demonstrates the basic cleavage reaction: Transfected
full-length CD44 molecule (CD44fl) is detected by antibodies
directed against the C-terminal myc tag, and the cleaved-off
soluble ectodomain (solCD44E) is recognized by anti-FLAG
antibodies. As expected, vector-transfected control RPM-MC cells
showed no staining (V). In the absence of the cleavage stimulus
(TPA), there was relatively little spontaneous release of
solCD44E, but cleavage was strongly enhanced after treatment
with TPA (Fig. 1A). Both spontaneous and induced cleavages were
blocked by batimastat, an inhibitor of ADAM protease activity.
DAPT had no major effect on the result of ADAM-dependent
cleavage regulation (Fig. 1B, see also control experiments in
Supplementary Fig. S1).
Because CD44 regulates contact inhibition of cells, we wondered whether its cleavage regulation was dependent on cell
density. While spontaneous cleavage was reduced only slightly,
TPA-induced cleavage was markedly diminished by increasing cell
density from 5 105 to 9 105 cells per well of a 6-well plate (for
www.aacrjournals.org
quantitation. see the column diagram of 3 independent
experiments; Fig. 1C). From previous reports, it has been
known that high cell density causes dephosphorylation of both
merlin and its counterplayers, the ezrin–moesin–radixin (ERM)
proteins, by the same protein phosphatase-1 isoenzyme (2).
Dephosphorylation of ERM proteins deactivates them whereas
it activates merlin. In turn, phosphorylation of both ERM
proteins and merlin depends on protein kinase activity during
the exponential growth of cells (21–23). While little phosphoERM could be detected in the absence of a stimulus (left 3 lanes
in Fig. 1C), ERM proteins were strongly phosphorylated upon
TPA treatment of cells (compare lanes 1 and 4, Fig. 1C). As
expected, phosphorylation of ERM proteins declined with
increasing cell density, coinciding with decreased CD44 cleavage (lanes 5 and 6, Fig. 1C). Merlin dephosphorylation follows
exactly that of the ERM proteins (data not shown and Supplementary Fig. S3A).
The tumor suppressor protein merlin inhibits ectodomain
cleavage of CD44
To investigate whether dephosphorylation of ERM proteins
and reduced CD44 ectodomain cleavage with increasing cell
density was not simply coincidental, we tested the effect of overexpression of merlin or of ERM mutants (see below) on CD44induced cleavage in RPM-MC cells. To this end, we first examined
the effect of a constitutively active merlin mutant (NF2-S518A),
which does not require dephosphorylation. These experiments
were done under low cell density conditions at which endogenous
merlin is phosphorylated and inactive, and activated ERM proteins drive proliferation. TPA induced solCD44E release in the
absence of transfected merlin (Fig. 2A; compare lanes 1 and 4, WB:
FLAG). However, expression of the singly mutated active merlin
(NF2-S518A) was sufficient to inhibit solCD44E release in RPMMC cells (Fig. 2A; compare lanes 2 and 5, WB: FLAG; also see
column diagram of quantification of 3 independent experiments), whereas the phospho-mimicking mutant S518D had no
effect (see also similar data obtained in NIH3T3 cells, Supplementary Fig. S4). Cleavage of the ADAM17 substrate neuregulin
(NRG1) in the same cells was not inhibited (Fig. 2B). Quantitations have been compiled as column diagram in Fig. 2A/B'. We can
therefore conclude that the tumor suppressor merlin specifically
inhibits CD44 cleavage by ADAM10 and that merlin does not
interfere with a common signaling pathway addressing ADAM
cleavage in general.
We had previously shown that contact inhibition requires the
binding of dephosphorylated active merlin to the C-terminus
of CD44 via a membrane-proximal basic amino acid sequence,
known as the KR motif (Supplementary Fig. S3B; initially
described as an ezrin-binding site; ref. 1). We therefore followed the idea that cleavage regulation of CD44 might also
require merlin binding to the C-terminus. To investigate this,
we compared cleavage of wild-type CD44 and the CD44
mutant with a complete deletion of the intracellular domain,
ICD (CD44DICD). First, we made sure, by confocal microscopy
and immunostaining, that the deletion mutant was properly
inserted into the plasma membrane (data not shown). Second,
we confirmed that it was still processed by ADAM10 (as is
CD44 wt). Release of solCD44E from CD44DICD was blocked
by siRNA-dependent downregulation of ADAM10 (Fig. 3A,
compare lanes 1 and 2) or by addition of the ADAM inhibitor
batimastat (Fig. 3A, lane 1 vs. 3).
Mol Cancer Res; 13(5) May 2015
881
Hartmann et al.
Figure 1.
Cell density–dependent regulation of CD44 ectodomain cleavage. A, TPA induced ADAM-dependent ectodomain cleavage of CD44. The CD44-negative cell line
RPM-MC was transfected with a doubly tagged expression construct of standard isoform of wild-type CD44 (CD44s). V, vector control. All samples were
treated with g-secretase inhibitor DAPT (5 mmol/L). Batimastat (5 mmol/L) was added as indicated. The cells were kept in logarithmic growth condition. Full-length
CD44 (CD44fl) was detected by an antibody recognizing the C-terminal myc tag. The cleaved ectodomain (solCD44E) was detected in culture supernatants
after TCA-DOC (see Supplementary Materials and Methods) precipitation by an antibody against the N-terminal FLAG tag. Treatment of the cells with 100 ng/mL
phorbol ester (TPA) induced detectable cleavage within 15 minutes and led to accumulation of solCD44E in 3 to 4 hours. Here, TPA treatment was for
3 hours. Actin served as loading control. The cleavage is inhibited by the metalloprotease inhibitor batimastat. B, TPA induced ADAM-dependent ectodomain
cleavage of CD44 in the absence of g-secretase inhibition (no DAPT). C, high cell density inhibits ectodomain cleavage of CD44. RPM-MC cells transfected with
tagged CD44 as in A were seeded into 6-well plates at different densities, as indicated. Cells were treated with 100 ng/mL TPA for 4 hours. The amount of cell lysates
loaded on the gel was normalized to actin levels. CD44 cleavage was detected by the release of CD44DE (membrane-bound cleavage product lacking the
ectodomain) and by c-Myc immunoblot in cell lysates. TPA-induced generation of the membrane-bound cleavage product (CD44DE) was diminished with increasing
cell density. At the same time, merlin (not shown) and the ERM proteins were dephosphorylated (middle). The 62-kDa band ( ) likely represents endogenous
c-Myc; the 40-kDa band ( ) is unspecific. Representative blots are shown. The intensity of immunoblot bands was quantified with ImageJ. Histograms
5
5
5
show mean values of relative level of cleavage SD from 3 independent experiments ( , P ¼ 0.000924 for 5 10 vs. 7 10 and P ¼ 0.000211 for 5 10
5
5
vs. 9 10 ). Levels of phospho-ERM proteins relative to that at the density of 5 10 are indicated within the immunoblot.
We then compared the action of merlin mutants on cleavage of
full-length CD44 (WtCD44; first six lanes, Fig. 3B) and of CD44
with deletion of the ICD (CD44DICD; lanes 7–12, Fig. 3B; see also
the top column diagram and the loading scheme in Supplementary Fig. S7) as well as on cleavage of the noncleaved mutant
CD44-KR-Mt (bottom column diagram, Fig. 3B). Indeed, absence
of the entire CD44 intracellular domain as well as mutation of the
KR motif prevented the inhibitory effect of merlin on cleavage.
The topmost first panel in Fig. 3B, shows the level of endogenous
(inactive) merlin and of the transfected merlin mutants. The third
panel shows detection of the released solCD44E and the fourth
panel the full-length molecules (both detected with anti-FLAG
antibodies). As already shown in Fig. 2, constitutively active NF2S518A, but not NF2-S518D, inhibited full-length CD44 cleavage
(lanes 5 and 6, Fig. 3B). Interestingly, total absence of the
cytoplasmic tail of CD44 caused significant spontaneous ectodomain cleavage (lane 7, Fig. 3B), suggesting that the ICD suppressed spontaneous cleavage and was required for TPA-induced
882 Mol Cancer Res; 13(5) May 2015
regulation. However, TPA was still able to increase cleavage to
some extent (compare lanes 7 and 10, Fig. 3B; also see Discussion). Both spontaneous and induced solCD44E release from the
CD44DICD mutant was resistant to inhibition by constitutively
active merlin NF2-S518A (compare lanes 8 and 11, Fig. 3B). Note
that NF2-S518D had little to no effect on this release (lanes 9 and
12, Fig. 3B). A quantitation of 3 independent experiments with
CD44DICD is shown in the top column diagram. Strong cleavage
coincided with the appearance of several solCD44E bands (Fig. 3A
and B). We assume that this might be due to the presence of several
ADAM10 cleavage sites on CD44. The CD44KR-Mt mutant was
barely inducible by TPA and not inhibited by merlin (see bottom
column diagram in Fig. 3B), as one would expect because the
mutation destroys the merlin-binding site. For comparison,
another ADAM substrate, the amyloid precursor protein, APP, is
shown in the second panel of Fig. 3B. TPA induced cleavage of
both CD44 and of APP (compare lanes 1 and 4, Fig. 3B); however,
cleavage of the ADAM17 substrate APP was not affected by merlin
Molecular Cancer Research
Merlin/NF2 Blocks Ectodomain Cleavage of CD44
Figure 2.
The tumor suppressor merlin (NF2) downregulates CD44 ectodomain cleavage. A, RPM-MC cells were cotransfected with tagged CD44 (as in Fig. 1) and merlin
mutant expression constructs (or vector control, "V"). The cells were kept at low cell density so that endogenous merlin is not activated. Therefore, the
vector control lanes show TPA-induced cleavage (lanes 1 and 4) similarly to Fig. 1A. The action of merlin can however be determined by introducing a mutant that
mimics dephosphorylation. The dephosphorylation-mimicking merlin mutant NFS518A (constructs as described in ref. 46) inhibited CD44 cleavage (shown
for the released solCD44E and the residual membrane-bound fragment CD44DE; compare lanes 2 and 5). The phospho-merlin mimicking inactive mutant NFS518D
did not affect the cleavage induction (lanes 3 and 6). Because of the similar migration of merlin and CD44, these 2 proteins were detected on separate
gels, and respectively 2 subsequent loading controls are shown. B, corresponding experiment as in (A) shows the result for another ADAM substrate, the neuregulin
precursor NRG1. Merlin-dependent inhibition was specific for CD44, as NRG1 was not affected. The histograms in A/B0 show mean values of relative level of
cleavage SD from 3 independent experiments ( , P ¼ 0.000337).
(compare lanes 5, 6 and 11, 12, Fig. 3B). Also, cleavage of the
ADAM10 substrate c-Met was merlin-resistant (data not shown).
Consistent with this neither APP nor c-Met does, to our knowledge, carry a KR motif in its C-terminus.
Our results using the CD44 ICD deletion and the KR-Mt
mutant suggest that merlin interaction with the ICD of CD44 is
necessary for its cleavage regulating function. Importantly,
CD44 was coprecipitated with merlin only if its ICD was intact
(Fig. 3C). Mutation of the KR motif abolished merlin interaction (Supplementary Fig. S3B), identical to the ICD deletion
(Fig. 3C). Similarly, the absence of merlin regulation on neuregulin release (Fig. 2B) and the resistance of APP, c-Met, and
NRG1 cleavage to regulation by merlin further strengthens
the idea of substrate-specific regulation of ectodomain cleavage
and confirms our assertion that merlin exerts a direct specific
effect on CD44 and its cleavage, rather than interfering with
a cleavage regulatory signaling pathway common to these
3 substrates.
The action of ERM proteins and the mechanism of merlindependent inhibition of CD44 ectodomain cleavage
CD44 C-terminally bound merlin mediates contact inhibition
predominantly by blocking Ras and Rac activity. This is counteracted by ERM proteins, which promote Ras and Rac activation.
www.aacrjournals.org
A well-studied mechanism has shown that Ras is activated by ERM
proteins interacting with both Ras and the guanine nucleotide
exchange factor and activator of Ras, son of sevenless (SOS;
ref. 24). Because active merlin inhibits CD44 ectodomain cleavage, we were wondering whether its Ras inhibitory action was
required for this effect and in turn whether cleavage required ERM
protein–dependent Ras activation.
Upon downregulation of all 3 ERM proteins using siRNA, TPAinduced cleavage was indeed significantly reduced [detected by
the reduced release of solCD44E (N-terminal FLAG tag) and of the
membrane-bound cleavage product CD44DE (C-terminal c-myc
tag); Fig. 4A]. Neuregulin release, however, was not affected by
downregulation of ERMs (Fig. 4B). If the ERM-induced Ras
activation was required for CD44 cleavage, a constitutively active
Ras pathway should bypass ERM protein requirement and cause
constitutive cleavage. We thus turned on the Ras pathway by
transfecting an ERM-independent dominant-active SOS (DASOS, tagged with HA to visualize its expression; ref. 25; called
SOS-F in ref. 26) and compared its effect on cleavage in control
cells (empty vector, V), cells expressing CD44 full length
(WtCD44), and cells carrying CD44 with a mutant KR domain
(CD44 KR-MT), the motif required for interaction of CD44 with
merlin and ERM proteins (see above; ref. 1). In control cells
lacking CD44 expression (empty vector control lanes 1–4
Mol Cancer Res; 13(5) May 2015
883
Hartmann et al.
Figure 3.
The cleavage repression by merlin is substrate-specific and requires the intracellular domain (ICD) of CD44. A, complete deletion mutant of the CD44 ICD
was transfected into RPM-MC cells. Immunostaining showed proper insertion into the plasma membrane (not shown). The cells were treated with TPA for
3 hours. Cleavage (lane 1) was absent upon downregulation of ADAM10 (lane 2; see reduced expression of the ADAM10 precursor A10P) or treatment with batimastat
(lane 3). C, control siRNA. B, cleavage of CD44DICD is resistant to merlin inhibition. CD44 wild-type or CD44 lacking the ICD, both tagged with N-terminal
FLAG, were cotransfected with plasmids encoding merlin mutants (or vector) as in Fig. 2. solCD44E is detected by anti-FLAG. In the same cells, the cleavage
of endogenous amyloid precursor protein, APP, was determined by immunoblot using an ectodomain-specific antibody recognizing released solAPPE. CD44
cleavage was quantitated from 3 independent experiments as shown in the column diagram ( , P ¼ 0.000870). The full-length molecules of WtCD44 and
CD44DICD show the size difference only in 6% gel. The ICD deletion mutant generated significant amounts of solCD44E in the presence or absence of TPA. This
indicates that the ICD represses cleavage and is needed for regulated processing. Mutation of the KR motif of the ICD prevents induced cleavage and was
like the ICD deletion, resistant to merlin (NF2, see column diagrams). C, we had shown in the past that activated merlin exerts its function upon binding to a basic
amino acid stretch in the membrane proximal part of the cytoplasmic domain of CD44. Indeed, merlin coprecipitates CD44 only in the presence of the cytoplasmic
tail (experiment shown was done in NIH3T3 cells). The KR mutant does not interact with merlin (Supplementary Fig. S3B).
in Fig. 4C; see also the experimental setup table in Supplementary
Fig. S7), DA-SOS caused phosphorylation of a downstream target
of Ras, Erk, to the same degree, as did TPA stimulation (Fig. 4C,
compare lanes 2 and 3). DA-SOS in the presence of TPA further
enhanced phospho-Erk (Fig. 4C, lane 4), which might be
explained, although does not prove, by their different mechanisms of action: DA-SOS activates Ras, whereas TPA acts downstream of Ras, adding to the activation of the pathway. DA-SOS
did neither enhance spontaneous (Fig. 4C, lane 6) nor TPAinduced (Fig. 4C, lane 8) release of WtCD44 ectodomain
(solCD44E). Cleavage of mutant CD44 KR-Mt barely responded
to TPA treatment (Fig. 4C, compare lanes 9 and 11) and this block
could not be overcome by DA-SOS (lanes 10 and 12). The column
884 Mol Cancer Res; 13(5) May 2015
diagram shows a quantitation of 3 independent experiments.
Finally, an inhibitor of MEK, a downstream effector of Ras,
blocked Erk phosphorylation but did not affect CD44 cleavage
(Fig. 5A). We therefore conclude that CD44 cleavage is independent of an active Ras–Erk signaling pathway.
Given that the SOS-Ras activating function of ERM proteins was
not required for CD44 ectodomain cleavage, we explored other
putative options. To this end, we exploited transfections with
ezrin mutants. Overexpression of ezrin mutants should compete
out endogenous ERM proteins. This is possible because in our
cultured cells, all 3 ERM proteins are redundant with respect to Ras
activation and this redundancy can be overcome by overexpression of an active mutant of one of the ERMs. We therefore tested
Molecular Cancer Research
Merlin/NF2 Blocks Ectodomain Cleavage of CD44
Figure 4.
ERM proteins promote CD44 cleavage.
A, downregulation of all 3 ERM proteins
reduce CD44 cleavage. RPM-MC cells
were transfected as in Fig. 1A. Cells
were grown at low density. The
expression of ERM proteins was
downregulated in about 98% of the
cells by a mixture of siRNAs targeting
all 3 members of the ERM protein
family, ezrin, radixin, and moesin
(nontargeting siRNA "C" was used as
control). Downregulation of ERM
proteins inhibited ectodomain
cleavage of CD44. B, NRG1 cleavage is
resistant to downregulation of ERM
proteins. Setup of the experiment as in
A, except that double-tagged NRG1
was transfected as cleavage substrate.
C, constitutive activation of the Ras
pathway does not stimulate CD44
cleavage. Overexpression of an HAtagged dominant active SOS mutant
(DA-SOS, 24) that is permanently
membrane-associated, activates
Ras—as detected by phosphorylated
Erk—independently of the presence of
ERM proteins and TPA treatment.
Histogram shows mean values of
relative level of solCD44E SD from
3 independent experiments (Wt: V vs.
DA-SOS, P ¼ 0.53955; KR-Mt: V vs.
DA-SOS, P ¼ 0.932614).
whether overexpressed ezrin mutants could reveal the function of
ERM proteins that was required for CD44 cleavage. Figure 5B
shows the effect of overexpressed ezrin wt or ezrin mutants. In the
absence of TPA stimulation, we detected no CD44 cleavage
irrespective of transfected ezrin constructs (as detected by cleavage
product CD44DE; lanes 1–5; Fig. 5B). TPA-induced cleavage is
shown in lanes 6 to 10. Neither wild-type ezrin (Fig. 5B, compare
lanes 6 and 7) nor a phospho-mimicking mutant T567D (Fig. 5B,
lane 8) affected CD44 cleavage, suggesting that endogenous ERM
proteins are so abundant that additional transfected ezrin constructs made no difference. Somewhat surprisingly, however, the
"inactive" ezrin T567A mutant inhibited CD44 cleavage (Fig. 5B,
lane 9) suggesting that it competed with the endogenous ERM
proteins for a cleavage regulatory component.
A possible lead toward this putative component and the
cleavage regulatory function of ezrin was generated by the effect
of the ezrin mutant R579A which cannot interact with F-actin
(27). This mutant inhibited CD44 cleavage (Fig. 5B, lane 10),
highlighting the possible need for an actin link to achieve CD44
cleavage. Interestingly, in respect to its inability to bind to actin,
ezrin R579A mimics the cleavage inhibitory merlin whose Cterminus also cannot interact with F-actin (28, 29). These observations propose that disrupting F-actin would exert a similar
inhibitory effect. We tested this assumption by adding an increasing amount of latrunculin, an inhibitor known to block actin
polymerization (30). Short-term treatment (30 minutes) of the
cells with 0.75 to 1.0 mg/mL of latrunculin indeed inhibited CD44
cleavage (Fig. 5C). This result made us wonder whether a link to
the actin cytoskeleton were specific for the ERM-dependent substrate CD44. This was not the case: NRG1 cleavage depended also
on an intact actin cytoskeleton (Fig. 5D).
www.aacrjournals.org
Physiologic stimuli induce ectodomain cleavage in different
normal and cancer cells
TPA mimics a signaling process that is activated by numerous
physiologic stimuli. Therefore, such stimuli should also result in
ectodomain cleavage. This is indeed the case: in HEK293T cells
that stably overexpress the angiotensin receptor (HEKNE in Fig.
5D), angiotensin II strongly induced neuregulin release. In the
triple-negative breast cancer cell line MDA-MB-231, we were able
to induce either endogenous or transfected CD44 cleavage by
serum (see below in Fig. 7B and C), HGF, PDGF, LPA and,
moderately, by FGF and EGF (Fig. 6A and B). MDA-MB-231 cells
were also responsive to TPA. TPA- or HGF-induced cleavage of
endogenous CD44 or overexpressed CD44 was inhibited by
expression of constitutively active merlin (S518A; Fig. 6B). CD44
cleavage was also induced in MEF cells (see below: Fig. 7A). We
conclude that the pathway regulating CD44 cleavage is addressed
by many extracellular stimuli.
CD44 cleavage is required for cellular migration
According to our data, CD44 cleavage is a property of proliferating cells. This property as well as its blockade by the tumor
suppressor NF2 (contact inhibition) should also be relevant for
the control of cancer cells. We therefore explored whether CD44
cleavage was needed for cancer-relevant cellular phenotypes related to their proliferative capabilities: mobility and migration. To
this end, we subjected MEF and MDA-MB-231 cells grown in
confluent monolayers to scratch assays and measured their ability
to close the scratch wound. After plating and scratching, cells were
supplied with FCS that contains factors like LPA that we have
shown to induce ectodomain cleavage. Using MEFs from mice
with floxed cd44 alleles, we could compare cells expressing
Mol Cancer Res; 13(5) May 2015
885
Hartmann et al.
Figure 5.
Mechanism of ERM protein–dependent CD44 cleavage. A, inhibition of the Ras pathway does not affect CD44 cleavage. NIH3T3 cells were seeded in 6-well
plates at low cell density. The cells were transfected as in Fig. 1A. Cells were pretreated with increasing concentrations of MEK1 inhibitor (PD98059) for
30 minutes and afterward stimulated with 100 ng/mL TPA for 4 hours. The effect of PD98059 was confirmed by its inhibition of Erk phosphorylation. Inhibition of the
MEK-ERK pathway had no effect on CD44 cleavage. B, effect of overexpressed ezrin mutants on CD44 cleavage. RPM-MC cells were cotransfected with
plasmids encoding N-terminal FLAG and C-terminal HA-tagged CD44 and plasmids encoding myc-tagged ezrin mutants (described in ref. 46): T567A (inactive),
T567D (active), R579A (not interacting with F-actin) and treated as in Fig. 1A. Overexpressed mutant ezrins compete with endogenous ERM proteins for
cleavage-relevant interactions. C, block of actin polymerization inhibits CD44 cleavage. RPM-MC cells were transfected with a plasmid encoding wild-type CD44
and treated with DAPT as in Fig. 1A. To block actin polymerization (F-actin), latrunculin B was added at the concentrations indicated. Thirty minutes after
addition of latrunculin B, cells were stimulated with 100 ng/mL TPA for 30 minutes. D, neuregulin release is inhibited by interference with F-actin. HEKNE
wt cells (HEK293T-AT1R þpB-Flag-NRG1-EGFP) were pretreated with a vehicle control (DMSO) or with the Arp2/3 inhibitor CK-548 in increasing concentrations
(0–15 mmol/L) alone or before angiotensin II (1 nmol/L) stimulation. NRG1 cleavage was detected by immunoblotting using NRG1 antibodies. Angiotensin II
was able to induce NRG1 cleavage in the absence (lane 2) but not in the presence of CK-548 (lanes 6–8).
CD44 with CD44-null cells (after CRE-dependent excision) and
we also could substitute the cells with CD44 mutants. Supplementary Figure S6 shows photographic examples of the original
scratch assay. The left picture of each condition tested shows the
scratch at time 0 and the original cell number as indicated in the
square. The right picture of each condition tested shows the same
scratch wound after 24 hours and the percentage of the wound
area still open. Quantitation of 3 experiments has been compiled
in Fig. 7A. Treatment with the ADAM inhibitor batimastat strongly inhibited wound closure of migration-competent cells. CD44
plus cells (cd44fl/fl) repaired the scratch wound efficiently
(remaining wound area 21% after 24 hours, Supplementary Fig.
S6, panel 1, and Fig. 7A). Downregulation of merlin (NF2) by
stably integrated shRNA enhanced the migration (0% wound
886 Mol Cancer Res; 13(5) May 2015
remaining, Supplementary Fig. S6, panel 2, >2% in the quantitation of Fig. 7A). There was almost no wound closure by CD44null cells (CD44/ after CRE induction, see Supplementary
Materials and Methods and Supplementary Fig. S5). In these
cells, NF2 was also downregulated (Supplementary Fig. S6, panel
3, and Fig. 7A). Although cd44/:nf2þ/þ was not obtained, the
data suggest that NF2 did not address a pathway other than CD44.
However, re-introducing CD44 wt partly re-established migration
(remaining wound area 30% after 24 hours in the absence of
merlin, Supplementary Fig. S6, panel 4, and Fig. 7A). This partial
rescue might be explained by the fact that CD44wt cDNA overexpression does not generate certain splice variants of CD44 that
would be expressed under physiologic conditions but are missing
in CD44/ cells. Most importantly, stable transfection of the
Molecular Cancer Research
Merlin/NF2 Blocks Ectodomain Cleavage of CD44
MDA-MB-231
A
Myc-tagged transfected CD44 wt
1.4
1.2
1
0.8
Wt CD44
0.6
0.4
0.2
0
Control TPA
B
EGF PDGF FGF
Myc-tagged transfected CD44 wt
Endogenous CD44
1.2
0.8
0.6
–TPA
+TPA
0.4
0.2
1
0.8
Control
0.6
+HGF
0.4
0.2
0
V
S518A
noncleavable mutant CD44-KR-Mt as well as of a CD44 mutant
that lacks the stalk region including the ADAM cleavage site could
not rescue the wound-healing deficiency of CD44-null MEFs
(Supplementary Fig. S6, panels 5 and 6, and Fig. 7A). These
results clearly indicate that CD44 cleavage is required for a cancer
relevant phenotype, cellular migration and that this function is
negatively controlled by merlin.
MDA-MB-231 cells closed the scratch wound faster than MEFs.
At 24 hours after scratching, wounds were totally closed (note that
wound area normalized to the 0 time point; Fig. 7B). Expression of
active merlin (NF2S518A) inhibited wound healing. Inactive
merlin (NF2S518D) had less effect (Fig. 7B and C). Interestingly,
spontaneous migration was enhanced and the inhibition by
merlin rescued by expression of solCD44E (Fig. 7C) suggesting
a role of CD44 ectodomain cleavage in migration.
Discussion
The activity state of both merlin and ERM proteins is controlled
by signaling pathways that address specific protein kinases (e.g.,
PAK) and phosphatases (e.g., PP1). A hyaluronan–CD44–dependent signaling pathway (or cell–cell contact) favors dephosphorylation of ERM proteins and merlin, deactivating ERM proteins
and activating merlin, thus establishing tumor suppression capabilities. Growth factor stimulation, in turn, activates ERM proteins
and inactivates merlin, favoring growth and tumor development.
In this context, our results on CD44 cleavage inhibition by merlin
permit the following conclusions:
When activated by a cell density–dependent signaling
pathway, merlin prevents CD44 ectodomain cleavage,
coinciding with and preserving contact inhibition of cells.
www.aacrjournals.org
Relative levels of CD44DE
1
0
*
LPA
1.2
Relative levels of CD44DE
Figure 6.
Induction of CD44 cleavage by
physiologic stimuli in the breast
cancer cell MDA-MB-231. A, growth
factor–dependent cleavage
induction. MDA-MB-231 cells were
transfected with the double-tagged
CD44 construct as in Fig. 1A. B, merlin
inhibits TPA- or HGF-induced CD44
cleavage in MDA-MB-231 cells. Left,
detection of cleavage of endogenous
CD44 expression using human CD44
specific antibodies. Right, cells had
been transfected with tagged CD44.
A and B, cells were treated for 1 hour
with 50 ng/mL of growth factors or
100 nmol/L TPA.
Relative levels of CD44DE
1.6
S518D
V
S518A
S518D
Regulation by merlin represents an example of substrateselective cleavage regulation. NRG1 and APP, in our cells
studied, are subject to substrate-specific regulation different
from CD44.
CD44 cleavage appears to serve a tumor-promoting process by
enhancing proliferation/migration of cells, including cancer
cells.
TPA-induced CD44 shedding from the cell surface is regulated by ERM proteins and merlin, in contrast to other ADAM
substrates, such as NRG1, c-Met, and APP. Interestingly, in
neural cells, purinergic P27 receptor–induced APP cleavage
required ERM proteins (31). Rather than direct interaction of
the APP ICD with ERM proteins, this event required downstream signaling induced by ERM proteins. However, ERM
activation was not always associated with the induction of APP
shedding. Nerve growth factor (NGF) and benzoylbenzoyl ATP
triggered ERM phosphorylation, but only the latter led to APP
shedding (31). Apparently, signaling pathways can diverge after
ERM activation. Similar to our results with CD44, TPA-induced
L-selectin shedding in lymphocytes was regulated by direct
interaction of ERM proteins with a proximal basic amino acid
region in the cytoplasmic domain of L-selectin (32). The
important conclusion from these reports is that substrates are
specifically selected for cleavage.
Does this mean we can disregard other forms of regulation? Not
at all. Regulation of ADAM activity has been widely studied (33–
36). As example, we have seen ADAM activation by TPA in one of
our experiments, where despite constitutive cleavage of the ICDless CD44, TPA was still able to increase cleavage to some extent
(compare lanes 7 and 10, Fig. 3B). However, CD44 is, in addition,
specifically selected for cleavage on the substrate level.
*
*
Mol Cancer Res; 13(5) May 2015
887
Hartmann et al.
MDA-MB-231
C
A
**
**
****
+Batimastat
Control
80
+solCD44E
60
40
20
0
% Wound gap remaining
–/
–
–/
–
MDA-MB-231
NF2D
100
80
Control
60
+solCD44E
40
20
0
V
60%
Control
50%
NF2S518A
40%
NF2S518D
30%
20%
10%
0%
10
24
48
Hours after scratching
NF2A
NF2D
After 36 h
% Wound gap remaining
% Wound gap remaining
NF2A
After 24 h
–/
–
B
100
V
–/
–
% Wound gap remaining
80
70
60
50
40
30
20
10
0
Control
% Wound gap remaining
After 12 h
MEFs
100
80
Control
60
+solCD44E
40
20
0
V
NF2A
NF2D
Figure 7.
Merlin inhibits cellular migration through block of CD44 cleavage. A, quantitation of 3 series of scratch assays using immortalized MEFs from mice with
fl/fl
floxed cd44 alleles (Cd44 ; GT(Rosa)26-CRE (B6/129) and derivatives of these cells. Examples of the original photographs are shown in Supplementary Fig. S6.
fl/fl
fl/fl
Cd44 cells express the endogenous CD44. Cd44 /shNF2, same cells with stable downregulation of merlin. After CRE-induced disruption of the cd44
/
alleles (cd44 ), the cells were infected with viral constructs encoding CD44 wt or the noncleavable mutants: CD44-KR-Mt and CD44stalk-del. Supplementary
Figure S5 shows the levels of merlin and CD44 in the analyzed MEFs lines. B and C, scratch assays using MDA-MB-231 cells. The cells were infected by lentiviral
merlin constructs where indicated. C, rescue of cleavage-dependent migration by expression of the soluble CD44 ectodomain. To resolve the time course
better, the temperature was reduced to 30 C.
Importantly, regulation of ectodomain cleavage by a tumor
suppressor protein has not been observed previously. It suggests
that CD44 cleavage serves a tumor-promoting function. This
notion is further strengthened by the documentation that CD44
cleavage participates substantially in the regulation of cellular
migration. Migration is inhibited by merlin and can be rescued by
soluble CD44 ectodomain (Fig. 7). A role of CD44 in cellular
migration has been observed previously (15, 17, 37–42). For
instance, CD44 promoted invasion of glial cell tumor cells by its
ability to bind hyaluronan (37). CD44 mediated migration of
pancreatic cancer cells in conjunction with MT1-MMP (38). It has
been suggested that cleavage is involved by the fact that inhibition
of metalloproteases reduced migration (15); conversely, coexpression of metalloprotease with CD44 enhanced migration (42).
We have described elsewhere that CD44 homodimerization is a
precondition for ectodomain cleavage (M. Hartmann and colleagues; submitted for publication). Expectedly, ligation by antiCD44 antibodies induced metalloprotease-dependent CD44
888 Mol Cancer Res; 13(5) May 2015
ectodomain release and migration in the aggressive tumor cell
line U251MG (17, 41). Ligation-induced cleavage and migration
was counteracted by expression of a dominant-negative Rac
mutant (17, 41), suggesting that Rac signaling preceded cleavage.
Our results are compatible with these data. Merlin action on
cleavage did, however, not need to interfere with Ras/Rac (see
below). Expression of soluble CD44 ectodomain, however, prevented cleavage (M. Hartmann and colleagues; submitted for
publication) which seems to contradict our finding that expression of soluble CD44 enhanced migration. We have no straightforward explanation for this observation. Further analyses will be
needed. The influence on migration may depend on the substratum the cells are placed on, the time course of adhesion/deadhesion and on adhesion molecules other than CD44.
The cleavage-promoting role of ERM proteins matches their
overexpression in tumors (43–45). However, we ruled out that
ERM-induced cleavage regulation requires their activation of the
Ras and Rac pathway by demonstrating that an ERM-independent
Molecular Cancer Research
Merlin/NF2 Blocks Ectodomain Cleavage of CD44
constitutive activation of Ras did not influence CD44 cleavage.
Ezrin mutants defective in activating guanine nucleotide exchange
factors, for example, R579A or T567A prevented induced cleavage
(Fig. 5B and data not shown). On the basis of the dominantnegative effect of the ezrin actin-link mutant R579A and our
results using actin-disrupting latrunculin, we hypothesize that a
CD44 F-actin link plays a role in the induction of its proteolysis.
We have shown previously that short-term treatment with latrunculin causes only highly specific pathway disruptions (46). What
the F-actin link might contribute is currently speculative. Does it
support the assembly of CD44 and its protease ADAM10 in the
plane of the plasma membrane? Interestingly, neuregulin release
was also sensitive to an actin poison. We do however not know
whether and how NRG1 is linked to F-actin.
Another intriguing observation has been reported: the induction of CD44 cleavage by treating cells with hyaluronate oligosaccharides (16). Low-molecular-weight hyaluronan does not
cause activation of merlin whereas high-molecular-weight hyaluronan does (1, 3). We assume that the oligosaccharides activate
cleavage-inducing signaling pathways in a CD44-independent
manner (47). The oligosaccharides induce metalloprotease
expression in the absence of CD44 (47). Also, the hyaluronate
receptor TLR-4 (48) may cause the phenotype observed.
How does merlin interfere with CD44 cleavage? If ERMinduced Ras activity is not needed for cleavage regulation, one
could assume that merlin also does not act through its Rasinhibiting function. Our merlin mutant data indeed prove this
to be correct. Ras inhibition by merlin requires that the protein is
dephosphorylated at position S518 (ref. 2 and unpublished data).
Dephosphorylation of S518 does not suffice for tumor suppression (but is followed by a second dephosphorylation at S272
upon cell–cell contact; unpublished data). However, the merlinmutant NF2-S518A used in our studies, mimicking the single
dephosphorylation, sufficed to inhibit CD44 cleavage. Because
S272 dephosphorylation does not occur in growing cells (unpublished data), our data indicate that full tumor suppressor activity
of merlin, and thus Ras pathway blockade was not required for
inhibition of CD44 cleavage. How then does merlin act? Merlin
does not carry a C-terminal F-actin–binding domain. Thus, by
replacing ERM proteins on the CD44 C-terminus, it likely disrupts
the link to the actin cytoskeleton. We consider this a plausible
mechanism.
In the end, it is likely that ERM phosphorylation is needed to
promote cleavage. Structural studies of moesin showed that
phosphorylation releases an inhibitory interaction of its C- and
N-terminus (39). In this context, it is puzzling that inactive ezrin
T567A exerts a dominant-negative effect on cleavage. Interestingly, a corresponding inactive moesin mutant, T558A, inhibits the
formation of microvilli-like structures (40), suggesting that ezrin
T567A could still compete with a cleavage-relevant interaction
partner.
We leave a few questions open that we cannot answer at this
point. Only a fraction of CD44 is subjected to induced (or
spontaneous) cleavage (see also Fig. 1 in ref. 46). One does not
need to demand complete cleavage because the reaction is to
generate highly active components, particularly evident in the
release of growth factors. Mechanistically, partial cleavage indicates, however, that in addition to the ICD modification, another
condition must be met to induce proteolysis. Possibly, this
condition is fulfilled if the CD44 ICD is deleted. Then no regulation is required and cleavage becomes constitutive (Fig. 3B).
Another open and highly interesting question concerns the role of
CD44 cleavage in vivo, particularly in cancer. One might expect
that tumors shed CD44 ectodomain at an increased rate and via
this mechanism not only generate CD44 ICD, which drives the
expression of proliferation-inducing genes in the nucleus, but also
that cleavage products of the CD44 ectodomain might exert
additional defined roles in cancer.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors' Contributions
Conception and design: M. Hartmann, A. Herrlich, P. Herrlich
Development of methodology: M. Hartmann, Y. Li, H. Morrison
Acquisition of data (provided animals, acquired and managed patients,
provided facilities, etc.): M. Hartmann, L.M. Parra, A. Ruschel, S. B€
ohme
Analysis and interpretation of data (e.g., statistical analysis, biostatistics,
computational analysis): M. Hartmann, L.M. Parra, A. Ruschel, Y. Li, P. Herrlich
Writing, review, and/or revision of the manuscript: M. Hartmann, L.M. Parra,
A. Herrlich, P. Herrlich
Administrative, technical, or material support (i.e., reporting or organizing
data, constructing databases): L.M. Parra, S. B€
ohme
Study supervision: P. Herrlich, H. Morrison, A. Herrlich
Other (figure design): P. Herrlich, L.M. Parra
Acknowledgments
The authors thank the administrative staff of the institute for help, their
technicians, laboratory manager Birgit Pavelka, Christoph Kaether for advise on
APP and for providing reagents.
Grant Support
This study was supported by the Leibniz Institute for Age Research and the
Jungstiftung (fellowship to M. Hartmann). A. Herrlich was supported by
NIDDK R00DK077731, M. Hartmann by a fellowship of the Jung Foundation,
and P. Herrlich by DFGHE551.
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received January 13, 2015; accepted January 16, 2015; published OnlineFirst
February 4, 2015.
References
1. Morrison H, Sherman LS, Legg J, Banine F, Isacke C, Haipek CA, et al. The
NF2 tumor suppressor gene product, merlin, mediates contact inhibition
of growth through interactions with CD44. Genes Dev 2001;15:968–80.
2. Jin H, Sperka T, Herrlich P, Morrison H. Tumorigenic transformation by
CPI-17 through inhibition of a merlin phosphatase. Nature 2006;442:
576–9.
3. Tian X, Azpurua J, Hine C, Vaidya A, Myakishev-Rempel M, Ablaeva J, et al.
High-molecular-mass hyaluronan mediates the cancer resistance of the
naked mole rat. Nature 2013;499:346–9.
www.aacrjournals.org
4. Morrison H, Sperka T, Manent J, Giovannini M, Ponta H, Herrlich P.
Merlin/neurofibromatosis type 2 suppresses growth by inhibiting the
activation of Ras and Rac. Cancer Res 2007;67:520–7.
5. Godar S, Ince TA, Bell GW, Feldser D, Donaher JL, Bergh J, et al. Growthinhibitory and tumor- suppressive functions of p53 depend on its repression of CD44 expression. Cell 2008;134:62–73.
6. Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H. CD44 is
required for two consecutive steps in HGF/c-Met signaling. Genes Dev
2002;16:3074–86.
Mol Cancer Res; 13(5) May 2015
889
Hartmann et al.
7. Todaro M, Gaggianesi M, Catalano V, Benfante A, Iovino F, Biffoni M, et al.
CD44v6 is a marker of constitutive and reprogrammed cancer stem cells
driving colon cancer metastasis. Cell Stem Cell 2014;14:342–56.
8. G€
unthert U, Hofmann M, Rudy W, Reber S, Z€
oller M, Haussmann I, et al. A
new variant of glycoprotein CD44 confers metastatic potential to rat
carcinoma cells. Cell 1991;65:13–24.
9. Matzke A, Herrlich P, Ponta H, Orian-Rousseau V. A five-amino-acid
peptide blocks Met- and Ron-dependent cell migration. Cancer Res 2005;
65:6105–10.
10. McClatchey AI, Saotome I, Mercer K, Crowley D, Gusella JF, Bronson RT,
et al. Mice heterozygous for a mutation at the Nf2 tumor suppressor locus
develop a range of highly metastatic tumors. Genes Dev 1998;12:1121–33.
11. Fehon RG, McClatchey AI, Bretscher A. Organizing the cell cortex: the role
of ERM proteins. Nat Rev Mol Cell Biol 2010;11:276–87.
12. Bretscher A, Edwards K, Fehon RG. ERM proteins and merlin: integrators at
the cell cortex. Nat Rev Mol Cell Biol 2002;3:586–99.
13. Ivetic A, Ridley AJ. Ezrin/radixin/moesin proteins and Rho GTPase signalling in leucocytes. Immunology 2004;112:165–76.
14. Li W, Cooper J, Karajannis MA, Giancotti FG. Merlin: a tumour suppressor
with functions at the cell cortex and in the nucleus. EMBO Rep 2012;
13:204–15.
15. Okamoto I, Kawano Y, Tsuiki H, Sasaki J, Nakao M, Matsumoto M, et al.
CD44 cleavage induced by a membrane-associated metalloprotease plays a
critical role in tumor cell migration. Oncogene 1999;18:1435–46.
16. Sugahara KN, Murai T, Nishinakamura H, Kawashima H, Saya H,
Miyasaka M. Hyaluronan oligosaccharides induce CD44 cleavage and
promote cell migration in CD44-expressing tumor cells. J Biol Chem
2003;278:32259–65.
17. Murai T, Miyazaki Y, Nishinakamura H, Sugahara KN, Miyauchi T, Sako Y,
et al. Engagement of CD44 promotes Rac activation and CD44 cleavage
during tumor cell migration. J Biol Chem 2004;279:4541–50.
18. Anderegg U, Eichenberg T, Parthaune T, Haiduk C, Saalbach A, Milkova L,
et al. ADAM10 is the constitutive functional sheddase of CD44 in human
melanoma cells. J Invest Dermatol 2009;129:1471–82.
19. Stamenkovic I, Yu Q. Shedding light on proteolytic cleavage of CD44: the
responsible sheddase and functional significance of shedding. J Invest
Dermatol 2009;129:1321–4.
20. Herrlich A, Klinman E, Fu J, Sadegh C, Lodish H. Ectodomain cleavage of
the EGF ligands HB-EGF, neuregulin1-beta, and TGF-alpha is specifically
triggered by different stimuli and involves different PKC isoenzymes.
FASEB J 2008;22:4281–95.
21. Shaw RJ, Paez JG, Curto M, Yaktine A, Pruitt WM, Saotome I, et al. The Nf2
tumor suppressor, merlin, functions in Rac-dependent signaling. Dev Cell
2001;1:63–72.
22. Kissil JL, Johnson KC, Eckman MS, Jacks T. Merlin phosphorylation by p21activated kinase 2 and effects of phosphorylation on merlin localization.
J Biol Chem 2002;277:10394–9.
23. Xiao G-H, Beeser A, Chernoff J, Testa JR. p21-activated kinase links Rac/
Cdc42 signaling to merlin. J Biol Chem 2002;277:883–6.
24. Geißler KJ, Jung MJ, Riecken LB, Sperka T, Cui Y, Schacke S, et al. Regulation
of Son of sevenless by the membrane-actin linker protein ezrin. Proc Natl
Acad Sci U S A 2013;110:20587–92.
25. Aronheim A, Engelberg D, Li N, al-Alawi N, Schlessinger J, Karin M.
Membrane targeting of the nucleotide exchange factor Sos is sufficient for
activating the Ras signaling pathway. Cell 1994;78:949–61.
26. Sibilia M, Fleischmann A, Behrens A, Stingl L, Carroll J, Watt FM, et al. The
EGF receptor provides an essential survival signal for SOS-dependent skin
tumor development. Cell 2000;102:211–20.
27. Saleh HS, Merkel U, Geißler KJ, Sperka T, Sechi A, Breithaupt C, et al.
Properties of an ezrin mutant defective in F-actin binding. J Mol Biol
2009;385:1015–31.
28. Xu HM, Gutmann DH. Merlin differentially associates with the microtubule and actin cytoskeleton. J Neurosci Res 1998;51:403–15.
890 Mol Cancer Res; 13(5) May 2015
29. Lallemand D, Saint-Amaux AL, Giovannini M. Tumor-suppression functions of merlin are independent of its role as an organizer of the actin
cytoskeleton in Schwann cells. J Cell Sci 2009;122:4141–9.
30. Morton WM, Ayscough KR, McLaughlin PJ. Latrunculin alters the actinmonomer subunit interface to prevent polymerization. Nat Cell Biol
2000;2:376–8.
31. Darmellah A, Rayah A, Auger R, Cuif M-H, Prigent M, Arpin M, et al. Ezrin/
radixin/moesin are required for the purinergic P2 7 receptor (P2 7R)dependent processing of the amyloid precursor protein. J Biol Chem
2012;287:34583–95.
32. Ivetic A, Florey O, Deka J, Haskard DO, Ager A, Ridley AJ. Mutagenesis of
the ezrin-radixin-moesin binding domain of L-selectin tail affects shedding, microvillar positioning, and leukocyte tethering. J Biol Chem
2004;279:33263–72.
33. Díaz-Rodríguez E, Montero JC, Esparís-Ogando A, Yuste L, Pandiella A.
Extracellular signal-regulated kinase phosphorylates tumor necrosis factor
alpha-converting enzyme at threonine 735: a potential role in regulated
shedding. Mol Biol Cell 2002;13:2031–44.
34. Xu P, Derynck R. Direct activation of TACE-mediated ectodomain shedding
by p38 MAP kinase regulates EGF receptor-dependent cell proliferation.
Mol Cell 2010;37:551–66.
35. Le Gall SM, Maretzky T, Issuree PDA, Niu X-D, Reiss K, Saftig P, et al.
ADAM17 is regulated by a rapid and reversible mechanism that controls
access to its catalytic site. J Cell Sci 2010;123:3913–22.
36. Adrain C, Zettl M, Christova Y, Taylor N, Freeman M. Tumor necrosis factor
signaling requires iRhom2 to promote trafficking and activation of TACE.
Science (New York, NY) 2012;335:225–8.
37. Jiang W, Zhang Y, Kane KT, Collins MA, Simeone DM, Pasca di Magliano M,
et al. CD44 regulates pancreatic cancer invasion through MT1-MMP. Mol
Cancer Res 2015;13:9–15.
38. Kim Y, Kumar S. CD44-mediated adhesion to hyaluronic acid contributes to mechanosensing and invasive motility. Mol Cancer Res 2014;
12:1416–29.
39. Pearson MA, Reczek D, Bretscher A, Karplus PA. Structure of the ERM
protein moesin reveals the FERM domain fold masked by an extended actin
binding tail domain. Cell 2000;101:259–70.
40. Oshiro N, Fukata Y, Kaibuchi K. Phosphorylation of moesin by rhoassociated kinase (Rho-kinase) plays a crucial role in the formation of
microvilli-like structures. J Biol Chem 1998;273:34663–6.
41. Schulz A, Geißler KJ, Kumar S, Leichsenring G, Morrison H, Baader SL.
Merlin inhibits neurite outgrowth in the CNS. J Neurosci 2010;30:
10177–86.
42. Kajita M, Itoh Y, Chiba T, Mori H, Okada A, Kinoh H, et al. Membrane-type
1 matrix metalloproteinase cleaves CD44 and promotes cell migration.
J Cell Biol 2001;153:893–904.
43. Wang G, Mao W, Zheng S. MicroRNA-183 regulates Ezrin expression in
lung cancer cells. FEBS Lett 2008;582:3663–8.
44. Saito S, Yamamoto H, Mukaisho K-i, Sato S, Higo T, Hattori T, et al.
Mechanisms underlying cancer progression caused by ezrin overexpression
in tongue squamous cell carcinoma. PLoS One 2013;8:e54881.
45. Yu Y, Khan J, Khanna C, Helman L, Meltzer PS, Merlino G. Expression
profiling identifies the cytoskeletal organizer ezrin and the developmental homeoprotein Six-1 as key metastatic regulators. Nat Med 2004;
10:175–81.
46. Sperka T, Geißler KJ, Merkel U, Scholl I, Rubio I, Herrlich P, et al. Activation
of Ras requires the ERM-dependent link of actin to the plasma membrane.
PLoS One 2011;6:e27511.
47. Fieber C, Baumann P, Vallon R, Termeer C, Simon JC, Hofmann M, et al.
Hyaluronan-oligosaccharide-induced transcription of metalloproteases.
J Cell Sci 2004;117:359–67.
48. Taylor KR, Trowbridge JM, Rudisill JA, Termeer CC, Simon JC, Gallo RL.
Hyaluronan fragments stimulate endothelial recognition of injury through
TLR4. J Biol Chem 2004;279:17079–84.
Molecular Cancer Research