Quiz 2 Key
Topic # 3032
DNA and RNA

Inventory the three types of RNA and illustrate the functions of each of them.
Transfer RNA: plays a key role in protein synthesis. Each tRNA molecule can combine
with one a.a. to the new protein building cite in the cytoplasm of the cell.
Ribosomal RNA: Plays a key role in protein synthesis. It helps control the connecting of
the parts of the protein together.
Messenger RNA: Helps complete the building of the protein. Physically sequencing the
a.a. that were carried to the building site by the tRNA and chemically connected by the
rRNA. The mRNA directs the sequence based on the order it obtains from the DNA
molecules.

Given the following code letters, predict to which base each would be bonded.
ACTATGGAGTCTACGTCATGC
TGATACCTCAGATGCAGTACG

List what a DNA molecule is composed of.
Deoxyribose sugar, phosphate adenine, thymine, guanine, cytosine

Design a brief timeline of the history of genetics.
1670's: each sperm contain "little man" and mother was an incubator
1750's: "Blending of Inheritance Theory"
1850's: Gregor Mendel, pea plants, discover of genes, Principle of segregation, Principle
of independent assortment.

Design a chart with the number of chromosomes for cattle, goats, swine humans.
In 2n
CATTLE 30 60
GOATS 30 60
SWINE 40 80
HUMAN 23 46