PROTOPLAST FUSION OF LOLIUM PERENNE
AND LOTUS CORNICULATUS FOR GENE
INTROGRESSION
A thesis submitted in partial fulfilment of the
requirements for the Degree of Doctor of
Philosophy (Ph.D.)
at
Lincoln University
By S. V. Raikar
Lincoln University
2007
Abstract of thesis submitted in partial fulfilment of the requirements for the
Degree of Doctor of Philosophy
Protoplast fusion of Lolium perenne and Lotus corniculatus for gene introgression
by Sanjeev V. Raikar
Lolium perenne is one of the most important forage crops globally and in New Zealand. Lotus
corniculatus is a dicotyledonous forage that contains valuable traits such as high levels of
condensed tannins, increased digestibility, and high nitrogen fixing abilities. However,
conventional breeding between these two forage crops is impossible due to their markedly
different taxonomic origin. Protoplast fusion (somatic hybridisation) provides an opportunity for
gene introgression between these two species. This thesis describes the somatic hybridisation, the
regeneration and the molecular analysis of the putative somatic hybrid plants obtained between
L. perenne and L. corniculatus.
Callus and cell suspensions of different cultivars of L. perenne were established from immature
embryos and plants were regenerated from the callus. Of the 10 cultivars screened, cultivars
Bronsyn and Canon had the highest percentage of callus induction at 36% each on 5 mg/L 2,4D. Removal of the palea and lemma which form the seed coat was found to increase callus
induction ability of the embryos. Plant regeneration from the callus was achieved when the callus
was plated on LS medium supplemented with plant growth regulators at different
concentrations. Variable responses to shoot regeneration was observed between the different
cultivars with the cv Kingston having the lowest frequency of shoot formation (12%).
Different factors affecting the protoplast isolation of L. perenne were investigated. The highest
protoplast yield of 10×106 g-1FW was obtained when cell suspensions were used as the tissue
source, with enzyme combination ‘A’ (Cellulase Onozuka RS 2%, Macerozyme R-10 1%,
Driselase 0.5%, Pectolyase 0.2%), for 6 h incubation period in 0.6 M mannitol. Development of
microcolonies was only achieved when protoplasts were plated on nitrocellulose membrane with
a L. perenne feeder layer on PEL medium. All the shoots regenerated from the protoplast-derived
calli were albino shoots.
The highest protoplast yield (7×106 g-1FW) of L. corniculatus was achieved from cotyledons also
with enzyme combination ‘A’ (Cellulase Onozuka RS 2%, Macerozyme R-10 1%, Driselase
0.5%, Pectolyase 0.2%), for 6 h incubation period in 0.6 M mannitol. The highest plating
efficiency for L. corniculatus of 1.57 % was achieved when protoplasts were plated on
nitrocellulose membrane with a L. perenne feeder layer on PEL medium. The highest frequency of
i
shoot regeneration (46%) was achieved when calli were plated on LS medium with NAA (0.1
mg/L) and BA (0.1 mg/L).
Protoplast fusion between L. perenne and L. corniculatus was performed using the asymmetric
somatic hybridisation technique using PEG as the fusogen. L. perenne protoplasts were treated
with 0.1 mM IOA for 15 min and L. corniculatus protoplasts were treated with UV at 0.15 J/cm2
for 10 min. Various parameters affecting the fusion percentage were investigated. Successful
fusions were obtained when the fusions were conducted on a plastic surface with 35% PEG
(3350 MW) for 25 min duration, followed by 100 mM calcium chloride treatment for 25 min. A
total of 14 putative fusion colonies were recovered. Shoots were regenerated from 8 fusion
colonies. Unexpectedly, the regenerated putative hybrid plants resembled L. corniculatus plants.
The flow cytometric profile of the putative somatic hybrids resembled that of L. corniculatus.
Molecular analysis using SD-AFLP, SCARs and Lolium specific chloroplast microsatellite
markers suggest that the putative somatic hybrids could be L. corniculatus escapes from the
asymmetric protoplast fusion process. This thesis details a novel Whole Genome Amplification
technique for plants using Strand Displacement Amplification technique.
Keywords: Lolium perenne, Lotus corniculatus, callus, cell suspension, protoplasts, shoot
regeneration, protoplast fusion, polyethylene glycol, plant growth regulators, putative hybrid
colonies, secondary digest-amplified fragment length polymorphism, whole genome
amplification, strand displacement amplification
ii
Contents
Abstract
i
Contents
iii
List of Tables
viii
List of Figures
x
List of Abbreviations
xii
Chapter 1
Literature review
1
1.1
Introduction
1
1.2
Protoplasts
4
1.2.1
History of protoplasts
4
1.2.2
Isolation of protoplasts
5
1.2.3
Culture of protoplasts
5
1.2.4
Protoplast fusion
6
1.3
Callus cell suspensions and protoplast culture of Lolium
9
1.4
Protoplasts from Lotus corniculatus
13
1.5
Analytical techniques for hybrid plants
13
1.6
Objectives of this thesis
14
Chapter 2
Establishment of a Lolium perenne culture system for
protoplast isolation
15
2.1
Introduction
15
2.2
Materials and methods
17
2.2.1
Plant material
17
2.2.2
Surface sterilisation
17
2.2.3
Callus induction and cell suspension initiation
17
2.2.4
Shoot regeneration
18
2.3
Results
19
2.3.1
Axenic seeds
19
2.3.2
Callus induction
20
2.3.3
Cell suspension initiation
22
2.3.4
Plant regeneration from callus
25
Discussion
27
2.4
Chapter 3
Protoplast isolation and shoot regeneration from Lolium
perenne
31
iii
3.1
Introduction
31
3.2
Materials and methods
33
3.2.1
Tissue source for protoplast isolation
33
3.2.2
Protoplast isolation
33
3.2.3
Protoplast purification
34
3.2.4
Protoplast culture
35
3.2.5
Shoot regeneration
37
3.2.6
Statistical analysis
37
3.3
Results
3.3.1
39
Protoplast isolation
39
3.3.1.1
Effect of different tissue types
3.3.1.2
Effect of different enzyme combinations on the yield and
viability of protoplasts
39
41
3.3.1.3
Effect of incubation time on protoplast yield and viability 42
3.3.1.4
The effect of osmolarity on the protoplast yield
3.3.1.5
Protoplast isolation from different cultivars of
42
43
Lolium perenne
3.3.2
Protoplast culture
44
3.3.3
Shoot regeneration
46
3.4
Discussion
48
Chapter 4
Isolation and regeneration of Lotus corniculatus
4.1
4.2
protoplasts
53
Introduction
53
Materials and methods
57
4.2.1
Plant material
57
4.2.2
Protoplast isolation
57
4.2.3
Protoplast purification
58
4.2.4
Protoplast culture
58
4.2.5
Shoot regeneration
59
4.3
Results
4.3.1
60
Protoplast isolation
60
4.3.1.1
Protoplast isolation with different enzyme combinations 60
4.3.1.2
Effect of different tissue types on the isolation of
protoplasts
61
iv
4.3.1.3
Effect of incubation time on protoplast yield and viability 63
4.3.1.4
Effect of osmolarity on protoplast yield and viability
4.3.2
63
Protoplast culture and regeneration
65
4.4
Discussion
69
Chapter 5
Asymmetric somatic hybridisation between
monocotyledonous Lolium perenne and
5.1
5.2
dicotyledonous Lotus corniculatus
72
Introduction
72
Materials and methods
75
5.2.1
Protoplast isolation of L. perenne cv Bronsyn
75
5.2.2
Protoplast isolation of L. corniculatus cv Leo
75
5.2.3
Inactivation of L. perenne protoplasts
75
5.2.4
Genome fragmentation of L. corniculatus protoplasts
75
5.2.5
Protoplast fusion method
76
5.2.5.1
Effect of polyethylene glycol
5.2.5.2
Effect of surface type and calcium chloride concentration 76
5.2.6
Observation of fusion products
5.2.7
Culture of fused protoplasts and formation of protoplast
5.2.8
5.3
77
Shoot regeneration from protoplast fusion colonies
77
78
Inactivation of Lolium perenne protoplasts with iodoacetamide
(IOA)
5.3.2
78
UV treatment of Lotus corniculatus protoplasts for genome
5.3.3
fragmentation
78
Protoplast fusion
81
5.3.3.1
Protoplast fusion at different levels of PEG concentration 81
5.3.3.2
Effect of duration of PEG treatment on fusion frequency 83
5.3.3.3
Effect of different surface types on the frequency of
fusions
5.3.3.4
84
Effect of calcium chloride treatment on the fusion
frequency
5.3.4
5.4
77
fusion colonies
Results
5.3.1
76
85
Fusion colony formation and shoot regeneration
Discussion
87
91
v
Chapter 6
Molecular analysis of asymmetric fusion products between
Lolium perenne and Lotus corniculatus
96
6.1
Introduction
96
6.2
Materials and methods
99
6.2.1
Ploidy analysis
99
6.2.2
Genomic DNA extration
99
6.2.3
Amplification of genomic DNA
99
6.2.4
SD-AFLP analysis
100
6.2.4.1
SD-AFLP template preparation
6.2.4.2
Selective amplification and analysis using genetic
6.2.4.3
analyser
101
SD-AFLP band isolation
102
6.2.5
Cloning and sequencing
6.2.6
Application of SCAR (Sequence Characterised Amplified
102
Region)
6.2.7
100
102
Chloroplast Microsatellite marker analysis (Simple
Sequence Repeats-SSR) of the fusion colonies and
the parents
6.3
103
Results
105
6.3.1
Ploidy analysis
105
6.3.2
Whole Genome Amplification of fusion colonies
107
6.3.3
Chloroplast Microsatellite marker analysis
108
6.3.4
SD-AFLP analysis
109
6.3.5
Analysis using Sequence Characterised Amplified
Regions (SCARs)
6.4
113
Discussion
114
Chapter 7
Concluding discussion
118
7.1
Background
118
7.2
Thesis overview
119
7.3
Future directions
124
7.4
Perspectives
125
References
126
Acknowledgments
153
vi
Appendix 1
Species description
155
a. Lolium perenne
155
b. Lotus corniculatus
156
Appendix 2
Flow cytometric analysis
157
Appendix 3
Polyacrylamide gel preparation
165
Appendix 4
Publications and presentations
169
vii
List of Tables
Table 1.1
Genetic transformation of Lolium perenne
3
Table 1.2
Somatic hybridisation in forage and turf grasses
9
Table 1.3
Reports on isolation of protoplasts from Lolium sp.
11
Table 1.4
Summary of 2,4-dichlorophenoxy acetic acid used in callus
induction
Table 2.1
12
Axenic status (% ± S.E.) of Lolium perenne cv Bronsyn seeds after
surface-sterilisation treatments
Table 2.2
19
Plant regeneration (%+ S.E.) from calli of different
cultivars at different concentrations of plant growth regulators
Table 2.3
25
Frequency (%+ S.E.) of albino and green shoot
formation from various cultivars
26
Table 3.1
Protoplast yield from different tissues of Lolium perenne cv Bronsyn
40
Table 3.2
Effect of different enzyme combinations on the yield and
viability of Lolium perenne cv Bronsyn protoplasts from cell
suspensions
Table 3.3
41
Effect of incubation time on the yield and viability of
Lolium perenne cv Bronsyn protoplasts from cell suspensions
Table 3.4
42
The effect of osmolarity on the yield and viability of
Lolium perenne cv Bronsyn protoplasts
43
Table 3.5
Protoplast isolation from different cultivars of Lolium perenne
44
Table 3.6
Plating efficiencies of Lolium perenne cv Bronsyn protoplasts with
different culture systems and media
Table 3.7
46
Shoot regeneration from Lolium perenne cv Bronsyn protoplast derived callus
colonies on LS medium with various growth hormones
47
Table 4.1
Studies involving the use of Lotus corniculatus protoplasts
55
Table 4.2
Yield and viability of Lotus corniculatus cv Leo protoplasts
isolated from cotyledons at different enzyme combinations
Table 4.3
Protoplast yield and viability from different tissues of
Lotus corniculatus cv Leo
Table 4.4
61
Yield and viability of Lotus corniculatus cv Leo protoplasts
following different incubation periods
Table 4.5
60
Protoplast yield and viability of Lotus corniculatus cv Leo at
viii
63
different osmolarities
Table 4.6
64
Plating efficiencies (%+S.E.) of Lotus corniculatus cv Leo
protoplasts with different culture systems and media
Table 4.7
65
Shoot regeneration from protoplast derived callus colonies
on LS medium with various growth hormones
67
Table 5.1
Somatic hybridisation involving Lolium and Lotus species
74
Table 5.2
Viability of Lolium perenne cv Bronsyn protoplasts treated with IOA
(mean%+ S.E.)
Table 5.3
78
Viability of Lotus corniculatus cv Leo protoplasts treated with UV for
10 min
Table 5.4
80
Fusion frequency between Lolium perenne and Lotus corniculatus at
different PEG concentrations with different molecular weights
Table 5.5
Fusion frequency after PEG treatment at different time
intervals
Table 5.6
83
Fusion frequency between Lolium perenne and Lotus corniculatus
with different surface types
Table 5.7
82
84
Fusion frequency (% + S.E.) between Lolium perenne and
Lotus corniculatus at different concentrations and durations of
CaCl2 2H2O
Table 5.8
85
Optimum levels of different factors for the asymmetric
protoplast fusion between Lolium perenne and Lotus corniculatus
87
Table 5.9
IOA concentration used previously for different grasses
91
Table 6.1
The oligonucleotide adaptors and primers used for SD-AFLP
template preparation
101
Table 6.2
SCAR markers designed using Primer3 software
103
Table 6.3
cpSSR primer sequences as per McGrath et al. (2006)
104
Table 6.4
Genome size of fusion colonies as detected from the flow
cytometric analysis
Table 6.5
105
SD-AFLP markers identified from different selective SD-AFLP
primers
110
Figure 1.1
Schematic diagram of symmetric and asymmetric fusions
7
Figure 2.1
Effect of different 2,4-D concentrations on callus induction from
List of figures
Lolium perenne cultivars after 5 weeks in culture
ix
20
Figure 2.2
Freshly induced callus from Lolium perenne
Figure 2.3
Callus induction from Lolium perenne cv Bronsyn seeds
with and without a seedcoat
Figure 2.4
21
21
Effect of 2,4-dichlorophenoxyacetic acid on the growth of
Lolium perenne cv Bronsyn cell suspensions after 4 weeks
22
Figure 2.5
Cell suspension culture of Lolium perenne
23
Figure 2.6
Growth curve for Lolium perenne cv Bronsyn cell suspension
culture
24
Figure 2.7
Types of cells observed in the cell suspensions
24
Figure 2.8
Shoot regeneration from callus of Lolium perenne cv Bronsyn
27
Figure 3.1
Isolation purification and culture of protoplasts
34
Figure 3.2
Culture of protoplasts using liquid medium
35
Figure 3.3
Culture of protoplasts using the embedding technique
36
Figure 3.4
Culture of protoplasts using bead-type culture technique
36
Figure 3.5
Culture of protoplasts using nitrocellulose membrane with the
feeder layer technique
Figure 3.6
37
Freshly isolated Lolium perenne cv Bronsyn protoplasts from cell
suspensions
Figure 3.7
40
Lolium perenne cv Bronsyn protoplast culture on nitrocellulose
membrane with feeder-layer
Figure 3.8
45
Shoot regeneration from Lolium perenne cv Bronsyn
protocolonies 6 weeks after culture
46
Figure 4.1
Different stages of Lotus corniculatus development
56
Figure 4.2
Freshly isolated Lotus corniculatus cv Leo protoplasts with
intact green chloroplasts
62
Figure 4.3
Lotus corniculatus cv Leo protoplasts isolated in 0.8M osmolarity
64
Figure 4.4
Lotus corniculatus cv Leo microcolonies developing from protoplasts
using the nitrocellulose membrane-feeder layer technique
Figure 4.5
66
Shoot regeneration of Lotus corniculatus cv Leo after culture of
protoplast derived callus on shoot regeneration medium
68
Figure 5.1
Gel image of UV treated Lotus corniculatus cv Leo cotyledons DNA
80
Figure 5.2
Protoplast fusion between Lolium perenne and Lotus corniculatus
82
Figure 5.3
Effect of calcium chloride concentration on protoplast fusion
86
Figure 5.4
Protoplast-fusion colonies between Lolium perenne and
x
Lotus corniculatus
88
Figure 5.5
Shoot regenerated from putative fusion colony
88
Figure 5.6
Root formation from shoots of the putative hybrid colonies
89
Figure 5.7
Transfer and growth of in vitro putative hybrid and
Lotus corniculatus plantlets
Figure 6.1
90
Strand Displacement Amplification using phi29 DNA
polymerase (From GE Healthcare).
98
Figure 6.2
Ploidy levels of Lotus corniculatus and fusion colony FC4
106
Figure 6.3
Whole Genome Amplification of small protoplast fusion
colonies with GenomiPhiTM V2 DNA Amplification Kit using
the SDA technique.
Figure 6.4
107
SD-AFLP profile of amplified and non-amplified
Lotus corniculatus, Lolium perenne and fusion colonies generated
using PstI+G and MstI+G/AC selective primers.
Figure 6.5
SD-AFLP analysis of fusion products PstI+G/ MseI+NNN
selective primers.
Figure 6.6
Figure 6.7
108
111
SD-AFLP polymorphic bands reamplified using selective
primers AAT, AGA and AAG.
112
Amplification of SCAR markers.
113
xi
List of Abbreviations
2,4-D
2,4-dichlorophenoxy acetic acid
°C
degrees centigrade
AFLP
amplified fragment length polymorphism
BA
benzyl amino purine
BLAST
basic local alignment search tool
bp
base pair
cm
centimeter
cp
chloroplast
CTAB
cetyl trimethyl ammonium bromide
cv
cultivar
DNA
deoxyribonucleic acid
dNTP
deoxyribonucleotide triphosphate
EDTA
ethylenediamine tetraacetic acid
FC
fusion colony
FDA
fluorescein diacetate
Fig
figure
FITC
fluorescein isothiocyanate
FW
fresh weight
g
gram
h
hour
ha
hectare
IAA
indole acetic acid
IOA
iodoacetamide
J
joules
L
liter
l.s.d.
least significant difference
M
molar
MES
2-(N-Morpholino)ethanesulphonic acid
mg
milligram
min
minutes
mL
milliliter
mM
millimolar
µl
microliter
xii
µm
micrometer
NAA
naphthalene acetic acid
NCBI
National Center for Biotechnology Information
NER
Nucleotide excision repair
ng
nanogram
NT
not tested
PCR
polymerase chain reaction
PEG
polyethylene glycol
PGR
plant growth regulator
pmoles
picomoles
RITC
rhodamine isothiocyanate
rpm
revolutions per minute
SCAR
sequence characterised amplified region
SDA
strand displacement amplification
SD-AFLP
secondary digest amplified fragment length polymorphism
SSR
simple sequence repeats
Tm
melting temperature
Ta
annealing temperature
UV
ultra violet light
WGA
whole genome amplification
xiii
CHAPTER 1.
LITERATURE REVIEW
1.1
Introduction
Plant breeding has been the backbone of human civilisation for thousands of years.
Thousands of years ago early farmers already understood the benefit of selecting plants so
that they could use the best seeds in the following season. This tradition continues even
today, and with the aid of sophisticated molecular and biotechnological tools, plant
breeders aim to develop new improved varieties. The aim of this thesis is to use the highly
sophisticated biotechnological tool ‘somatic hybridisation’ to enable gene introgression
between two very important forage crops Lolium perenne L. and Lotus corniculatus L.
Lolium
Monocotyledonous grasses are known for their forage qualities for ruminant animals
throughout the world. They are particularly important in temperate regions where grasses
have become a natural diet for ruminant animals. Temperate regions account for 80% of
the world’s cow milk production and 70% of the world’s beef production (Wilkins &
Humphreys, 2003) and thus the scope for grass as a feed has constantly increased in these
regions. The cultivated acreage under grassland is estimated to be twice that of other
arable vegetable and fruit crops. Grasses commonly cultivated include perennial ryegrass
(Lolium perenne), Italian ryegrass (Lolium multiflorum), hybrid ryegrass (Lolium × boucheanum)
and tall fescue (Festuca arundinacea), which are members of the Graminae family (Refer
appendix 1 for species description of L. perenne). Worldwide, perennial ryegrass is by far
the most important of these species, both in terms of seed sales (Burgon et al., 1997) and
land area covered. Its use as a turf grass is also well known. Grasses also help in the
stabilisation of soil for agriculture and enhancement of the environment through multiple
uses like forage conservation and turf.
In New Zealand, L. perenne is the most widely sown pasture grass species (Belgrave et al.,
1990), with 7 million ha sown, providing forage for 60 million sheep and cattle (Siegel et
al., 1985). The importance of L. perenne to the forage industry is shown by the efforts of
the scientific community to improve the performance of this species. Attempts have been
made through conventional breeding to increase seed production, to improve tolerance to
1
pulling while grazing (Thom et al., 2003), to improve water soluble carbohydrate, fibre,
concentration of alkaloid toxins and traits associated with persistency, including tolerance
to a range of biotic and aboitic stresses (Wilkins & Humphreys, 2003).
Genetic improvement of Lolium species through conventional breeding has been
particularly difficult. It is outbreeding and heterozygous, making it very unstable for
crosses between and within species, thus limiting the use of inbreeding to concentrate the
desired genes in the rapid development of new cultivars (Kaul, 1990). Lolium, which is an
amphidiploid, has a high level of homologous pairing between the different genomes,
leading to genetic instability and loss of hybridity in subsequent generations (Yamada &
Kishida, 2003). Moreover, it takes five to six generations to transfer a trait within a
species into high yielding locally adapted cultivars through conventional breeding, and
one has to plant a large number of progeny to enable selection of plants with the
appropriate combination of traits (Sharma et al., 2002). Biotechnology, which is now
routinely applied in crop improvement programmes, has the ability to by-pass these
difficulties that restrict conventional breeding programmes. Techniques such as tissue
culture, genetic engineering (GE), protoplast isolation and somatic and molecular
hybridisations are well established in higher plants (Sharma et al., 2002). They have also
been successfully used in Lolium sp. to enable gene introgression (Spangenberg et al.,
1995a; 1995b; Wang et al., 1997; Wu et al., 1997) and as hybridisation methods (Takamizo
et al., 1991; Cremers-Molenaar et al., 1992; Spangenberg et al., 1994). Genetic engineering
studies have already been successfully conducted in perennial ryegrass (Lolium perenne)
with the production of transgenic plants (Table 1.1).
2
Table 1.1 Genetic transformation of Lolium perenne
Transgenes
Method
Result
Reference
HPT
Biolistics
Transformed calli
Hensgens et al., 1993
HPT, gusA
Biolistics
Transformed calli
van der Maas et al., 1994
HPT, gusA
Biolistics
Transgenic plants
Spangenberg et al., 1995
NPTII, gusA
HPT, gusA
PEG mediated Transgenic plants
DNA uptake
into
protoplasts
Silicon carbide Transgenic plants
fibre mediated
transformation
Biolistics
Transgenic plants
Dalton et al., 1999
Lol p1, Lol p2
Biolistics
Wu et al., 1997
HPT
Transgenic plants
Wang et al., 1997
Dalton et al., 1998
HPT: Hygromycin phosphotransferase; gusA: ß-glucuronidase; NPTII: Neomycin
phosphotransferase II; Lol p: Ryegrass pollen allergen
Lotus
Some of the most common pasture crops also include the dicotyledonous legumes white
clover (Trifolium repens), and bird’s foot trefoil (Lotus corniculatus). Lotus corniculatus has been
also tested as a forage plant in New Zealand. It shows high persistence and continued
production under moderate soil fertility conditions in the drier high country regions.
About 300 lines and cultivars have been tested in New Zealand (Scott et al., 1995). L.
corniculatus also contains condensed tannins that in feeding studies have increased wool
production by 18% and milk protein secretion in ewes (Wang et al., 1996a; Min et al.,
1998; 2001). Also, like all legumes, L. corniculatus is a N2 fixing crop, has a lower ratio of
cell wall material to cell content and therefore fragments easily across the leaf blade upon
grazing. It has been successfully demonstrated that it can be grown in drought prone
areas (Duke, 1981; Scott et al., 1995). (Refer Appendix 1 for species description).
The objective of this project is to attempt to transfer some of the agriculturally useful
traits from Lotus corniculatus into Lolium perenne using the biotechnology technique of
‘protoplast fusion’. As Lotus and Lolium are unrelated, with Lotus a dicotyledonous species
and Lolium a monocotyledonous species, conventional breeding techniques are not
3
possible. Protoplast fusion or somatic hybridisation has been used in crop improvement
programmes for combining genes even from unrelated species with much success
(Christey 2004; Davey et al., 2005). The technique involves the fusion of two protoplasts
in order to transfer some traits from the donor species to the recipient species. In
addition to nuclear DNA introgression, cytoplasmic organellar genome alterations are
also possible. This project involves fusion between monocotyledonous and
dicotyledonous plants. A similar monocotyledonous-dicotyledonous fusion has been
successfully carried out previously between Oryza sativa L. (rice; a monocotyledonous
species) and Daucus carota L. (carrot; a dicotyledonous species) (Kisaka et al., 1994).
Somatic hybrid calli between rice (Oryza sativa) and Birdsfoot trefoil (L. corniculatus) have
also been obtained (Nakajo et al., 1994).
Such technology could lead to improved Lolium in terms of its palatability, introduction of
condensed tannins, drought resistance, nitrogen fixing abilities, etc. As this project does
not use GE technology there may be less public concern about the subsequent use of any
plants regenerated in this study.
1.2
Protoplasts
1.2.1
History of protoplasts
Protoplasts are cells without cell walls and are bound by the plasma membrane. The term
protoplasts was first coined in 1880 by Vonn Hannstein (Cocking, 2000). Subsequently,
Klercker (1892) made the first crude preparations of plant protoplasts which was
subsequently refined by Plowe, who isolated protoplasts from the cells of onion
epidermis by plasmolysis in sucrose (Cocking, 2000). Later, Cocking (1960), isolated
protoplasts from root tips of tomato seedlings using enzymatic digestion of cell walls.
This technique of
enzymatic digestion of cell walls for release of protoplasts later
revolutionised plant science and has been especially useful in plant breeding. Since then
protoplasts have been isolated from all major groups of plants including algae and fungi.
During the 1990’s the protoplast technology was overshadowed by GE and the use of
Agrobacterium and the biolistic technologies for gene introgression. However, in recent
times, advances in genomics, proteomics and metabolomics have stimulated renewed
interest in these osmotically fragile cells. Furthermore, because of public fears to
4
recombinant DNA technologies, renewed interest has been shown in gene transfer via
protoplast fusion.
1.2.2
Isolation of Protoplasts
Protoplast isolation and culture is dependent on many factors. One of the most important
factors is the availability of an appropriate totipotent tissue source, so that isolation of
protoplast is achieved as and when required. Seasonal variation, which affects the
totipotency of protoplasts isolated from glass-house grown plants can be effectively
managed using in vitro grown tissue (Davey et al., 2005). Embryogenic cell suspensions
have been the preferred tissue source for viable protoplasts in cereals. Ma et al. (2003)
used embryogenic cell suspensions established from friable callus initiated from immature
inflorescences as a source of totipotent protoplasts of rye. Likewise, cell suspensions have
been used as the preferred source tissue for protoplast isolation in Lolium and Festuca
(Wang et al., 1995) Saccharum spp. (Taylor et al., 1992), Festuca (Zaghmout & Torello, 1990)
and Musa spp since protoplasts isolated from leaf mesophyll and callus have been
recalcitrant in culture in monocotyledonous species (Assani et al., 2002). Other factors
which influence protoplast release are enzyme solution, duration of enzyme incubation,
thickening of cell walls (Sinha et al., 2003) and stress endured during protoplast isolation.
Protoplast isolation per se is a stress-inducing procedure (Papadakis & RoubelakisAngelaskis, 2002), particularly during enzymatic isolation with the accumulation of
peroxidases and degradation products that induces cell lysis, especially in cereals (Cutler et
al., 1989). Commun et al. (2003) reported the production of phytoalexins in protoplasts of
Vitis spp. which may account for the loss of protoplast viability. Other studies have
confirmed that leaf protoplasts of Brassica napus and Petunia hybrida experience stress
during isolation (Watanabe et al., 2002) with increase in polyamines initiating senescence
especially in B. napus.
1.2.3
Culture of Protoplasts
Techniques used in the culture of protoplasts play a very important role in the
regeneration of protoplasts. Protoplasts from different species and different tissue source
react differently to different media. The initial period of protoplast culture in the chosen
medium until the formation of the primary cell wall represents a critical phase to
withstand the turgor pressure exerted by cytoplasm. In some cases gradual reduction of
the osmotic pressure by diluting the culture medium with a solution of similar
5
composition, but of reduced osmotic pressure is essential for sustaining mitotic division
(Davey et al., 2005). Pelletier et al. (1983) used a series of media with reduced
concentrations of osmoticum for the regeneration of protoplasts from Raphanus and
Brassica species. The major plant growth regulators, auxins and cytokinins are normally
essential for sustained protoplast growth (Davey et al., 2005). Several procedures have
been used for the culture of protoplasts, of which the most common involve the
embedding of protoplasts between sheets of agarose and solidified medium (Shillito et al.,
1983), blocks of semi-solidified medium with embedded protoplasts cultured in
conditioned medium (Kyozuka et al., 1987), culture of protoplasts in liquid medium and,
membrane filter-nurse culture method (Lee et al., 1989). Other innovative approaches
have also been used to stimulate regeneration from protoplasts such as electrostimulation
of protoplast division (Davey et al., 1996; Li et al., 1990; Dijak et al., 1986), use of artificial
gas carriers such as perfluorocarbon liquids and haemoglobin solutions to stimulate
growth of protoplasts of Petunia hybrida (Lowe et al., 2003).
1.2.4
Protoplast Fusion
Protoplast fusion, or somatic hybridisation is a biotechnological tool that has been used in
crop improvement programmes for breeding between two species. It involves the fusion
of protoplasts of the two species of interest to enable completely de novo combinations of
nuclear and or cytoplasmic genomes. This can result in the incorporation of nuclear or
cytoplasmic traits from one parent to the other. Somatic hybridisation, involving mainly
somatic cells, could circumvent barriers such as sexual incompatability and therefore
becomes a possible choice for gene(s) transfer between intergeneric, sexually compatible
or incompatible combinations for effective use of valuable germplasm (Liu et al., 2005).
Somatic hybridisation is achieved via symmetric fusion or asymmetric fusion which could
give rise to symmetric hybrids, and asymmetric hybrids, respectively in terms of nuclear
constitution (Fig 1.1).
6
Recepient
Donor
UV
IOA
PEG
PEG
Symmetric hybridisation
Figure 1.1 Schematic
asymmetric fusions
Asymmetric hybridisation
diagram
of
symmetric
and
Inset in the picture shows other possible combinations
with mitochondrial and chloroplast genomes
Symmetric hybrids involves the incorporation of total genomes of both the parents and is
associated with two disadvantages, introduction of too much of exotic genetic material
accompanying the expected genes and genetic imbalances which leads to somatic
incompatability (Liu et al., 2005). These limitations could cause either abnormal growth
and development of the somatic hybrids or regeneration of hybrids with low fertility
(Wang et al., 1989; Sherraf et al., 1994; Spangenberg et al., 1994; Kisaka et al., 1998; Hu et
al., 2002; Wang et al., 2003). However, asymmetric fusion allows transfer of partial
genomes from one species to another. During the asymmetric fusion process, the nuclear
genome of the donor line is fragmented prior to fusion by agents such as gamma or Xrays (Dudits et al., 1980; Lui & Deng 1999; Zubko et al., 2002) or UV (Jain et al., 1988; Xia
et al., 1996, 1998, 1999, 2003; Zhou et al., 2001 2002; Cheng & Xia, 2004) and the
recipient protoplasts are metabolically inactivated e.g. by use of iodoacetamide (IOA).
These treatments ensure that both parents are unable to undergo cell division. However,
7
when protoplast fusion occurs between these species, the induced deficiencies
complement one another and permit cell division. This establishes a positive selection
that only allows development of fused protoplasts. Thus after fusion, the unfused
protoplasts die, whereas by the process of metabolic complementation, only viable
somatic hybrids can be obtained and divide in culture (Sidorov et al., 1981). This concept
has been successfully used in the intraspecific transfer of cytoplasmic male sterility in L.
perenne (Creemers-Molenaar et al., 1992a). Spangenberg et al. (1995) obtained intergeneric
somatic hybrids between Festuca and Lolium whereas Yan et al. (2004) was able to transfer
bacterial blight resistance trait from Oryza meyeriana to Oryza sativa ssp. japonica using the
asymmetric somatic hybridisation technique. Studies have also shown that asymmetric
somatic hybrids often have higher regeneration and rooting capacity as well as increased
fertility compared to symmetric hybrids in a range of plants (Bates et al., 1987; Fahleson et
al., 1994; Skarzhinskaya et al., 1996; Forsberg et al., 1998a).
Several reports of successful somatic hybridisation between forage and turf grasses have
been published (Table 1.2). Successful fusions between monocotyledonous and
dicotyledonous plants, and regeneration of plants from the fused products have also been
previously demonstrated by Kisaka et al. (1994, 1997). They used asymmetric
hybridisation methods to successfully demonstrate the fusion of protoplasts between rice
(Oryza sativa L.) and carrot (Daucus carota L.), and between barley (Hordeum vulgare L.) and
carrot (D. carota L.).
Protoplast fusions have been conducted using chemical (Kao & Michayluk, 1974) and
electrofusion methods (Bates, 1985). Polyethylene glycol (PEG) is the most widely used
chemical for protoplast fusion. PEG is more favorable to electrofusion methods because
of its easy availability, ease to handle, and its relative success in protoplast fusion of
various plants (Sundberg et al., 1987; Creemers-Molenaar et al., 1992a; Yan et al., 2004).
Durieu & Ochatt (2000) observed that electrofusion induces heavy mechanical shocks to
the protoplasts and even though the presence of Ca+2 ions in the electrofusion solutions
protects the membrane, protoplasts can explode after fusion. Furthermore electrofusion
requires expensive laboratory equipment.
8
Table 1.2 Somatic hybridisation in forage and turf grasses
Plant species combination
Result
Reference
Takamizo et al., 1991
Festuca arundinacea
(Tall fescue)
Lolium multiflorum
(Italian ryegrass)
Festuca arundinacea
Lolium multiflorum
Lolium perenne
(Perennial ryegrass)
Lolium perenne
Symmetric
somatic hybrid
plants
Asymmetric
somatic hybrid
plants
Cybrid calli
Pennisetum
americanum
(Pearl millet)
Panicum maximum (Guinea
grass)
Somatic hybrid
calli
Ozias-Akins et al., 1986
Pennisetum
americanum
Saccharum officinarum
(Sugarcane)
Somatic hybrid
calli
Tabaeizadeh et al.,
1986
Pennisetum
americanum
Triticum monococcum
(Einkorn)
Somatic hybrid
calli
Vasil et al., 1988
1.3
Spangenberg et al.,
1994
Cremeers-Molenaar et
al., 1992
Callus cell suspensions and protoplast culture of Lolium
Establishment of callus or cell suspension cultures is a prerequisite as they are the only
source for totipotent protoplasts in grasses, since mesophyll-derived protoplasts from
monocotyledonous species rarely undergo sustained mitotic division (Potrykus & Shillito,
1986; Vasil, 1988; Potrykus, 1990). Callus and cell suspension cultures have been used
extensively in Lolium species for the isolation and culture of protoplasts (Table 1.3).
Addition of the auxin, 2,4-dichlorophenoxyacetic acid (2,4-D) to basic Murashige and
Skoog medium has resulted in the induction of callus, which also gives a higher
regeneration frequency (Altepeter & Posselt, 2000). The concentration of 2,4-D is vital
9
for the regeneration of green plants from the induced callus (Table 1.4). Increased
concentrations of 2,4-D lead to more rapid decline of the regeneration frequency during a
prolonged culture period (Altepeter & Posselt, 2000). Creemers-Molenaar et al., (1989)
have observed that higher 2,4-D concentrations result in the regeneration of more albino
shoots and less green shoots. Thus this project will establish the optimum concentration
of 2,4-D for producing the optimum percentage of green plants. Zaghmout and Torello
(1992) have described embryogenic callus as nodular, compact, and white or opaque,
whereas non-embryogenic callus is yellowish to translucent, crystalline and friable.
10
Table 1.3. Reports on isolation of protoplasts from Lolium sp.
Species
Explant
Culture type1
Media2
Results
Reference
Increased no. of
green shoots
Morphogenic
suspensions &
green shoots
Altpeter &
Posselt 2000
Olesen et al.
1996
Morphogenic
suspensions &
green shoots
Green and albino
plants
Olesen et al.
1995
Source1
L perenne
Chopped seeds
Cell Suspension
MS
L. perenne
Chopped seeds
Cell suspension
MS
L. perenne
Anthers
Cell suspension
MS, K
L. perenne
Caryopses, stem
tissues
Callus, cell
suspension
L. perenne
Seeds, immature Cell suspension
inflorescence
(½)MS
with B5
vits
MS, RY-2
L. perenne
Seeds, immature Callus, cell
inflorescence
Suspension
MS, RY-2
Microcalli and
green shoots
L. perenne
Embryos/Seeds
Cell suspension
MS, K
Albino shoots
L. perenne
Seeds
Callus
MS
Albino and green
shoots
L. temulentum
Seeds
Callus, Cell
suspension
MS
Albino and green
shoots
Zaghmout
& Torello
1992
CreemersMolenaar et
al. 1992
CreemersMolenaar et
al. 1989
Dalton,
1988
Torello &
Symington
1984
Wang et al.,
2002
L. multiflorum,
L. perenne, L
boucheanum
L. multiflorum,
Seeds
Callus, Cell
suspension
MS, AA
Albino and green
shoots
Wang et al.,
1995
Seeds
Callus, Cell
suspension
MS, AA
Albino and green
shoots
Wang et al.,
1993
Immature
inflorescence
Callus, Cell
Suspension
MS
Albino and green
shoots
CreemersMolenaar et
al., 1988
L. perenne, L
boucheanum
L. perenne, L.
multiflorum
Microcalli
1. Callus or cell suspension cultures were initiated from the explant source shown and used for protoplast
isolation
2. MS: MS medium (Murashige and Skoog 1962); K: Kao’s media, Kao 1977; RY-2: Yamada et al., 1986;
AA: Amino acid media, Muller and Grafe, 1978
11
Table 1.4 Summary of 2,4-dichlorophenoxy acetic acid used in callus induction
Species
2,4-D level
Results
Reference
(mg/L)
L. temulentum
5
Albino and green shoots
Wang et al., 2002
L.perenne
L. perenne
5
4
Alteper & Posselt 2000
Olesen et al., 1995
L. multiflorum, L.
perenne, L boucheanum
4
Green plants
Morphogenic suspensions
and green shoots
Albino and green shoots
L. perenne
6
Green and albino plants
L. perenne
5
Microcalli and green shoots
L. perenne
10
Albino shoots
Zaghmout & Torello
1992
Creemers-Molenaar et al.,
1989
Dalton 1988a
Wang et al., 1993
Protoplasts have been isolated from L. perenne by several groups with much success
(Table 1.3). In all of these cases, the source of protoplasts has been embryogenic cell
suspensions as mesophyll-derived protoplasts in monocot species are unable to undergo
mitotic divisions (Potrykus & Shillito, 1986; Vasil 1988; Potrykus, 1990). The age of cell
suspensions has been shown to be particularly important for the isolation of protoplasts
capable of regenerating into plants. Wang et al. (1993) observed that 4-30% of the
protoplasts isolated from 4-8 month old embryogenic suspension cultures were able to
produce green plants.
Protoplast culture and regeneration has been successfully demonstrated using the above
techniques (Section 1.2.3) (Zaghmout & Torello, 1992; 1990). Zaghmout and Torello
(1992) have shown that the mixed nurse method of protoplast plating resulted in a higher
percentage of protoplasts reforming cell walls and resuming cell division. They were able
to get a higher yield of protoplasts after incubation of suspension cells in an enzyme
mixture without agitation. Conditioned medium has also been used to increase the plating
efficiency of protoplasts (Cremeers-Molenaar et al., 1992).
12
1.4
Protoplasts from Lotus corniculatus
Akashi et al. (2000) have successfully isolated protoplasts and regenerated plants of L.
corniculatus from root cultures. Previous work on Lotus protoplasts includes that of Webb
et al., (1987) from leaves and cotyledons, Niizeki and Saito (1986) from callus, Ahuja et al.
(1983) from etiolated hypocotyls and cotyledons, Vessabutr and Grant (1995) from green
cotyledons, and Rashid et al., (1990) from root hairs. Researchers have shown that the L.
corniculatus protoplast yield varies with the type of tissue (Vessabutr & Grant, 1995). L.
corniculatus protoplasts have been used for fusion with different plants. Somatic hybrid
plants were produced after fusion of L. corniculatus protoplasts with L. conimbricensis
protoplasts (Wright et al., 1987). Somatic hybrid calli was obtained from protoplast fusion
between dicotyledonous L. corniculatus and monocotyledonous Oryza sativa (Nakajo et al.,
1994) and from fusion between L. corniculatus and Medicago sativa (Niizeki, 2001).
1.5
Analytical techniques for hybrid plants
The use of flow cytometry in detecting the ploidy level gives an indication of the status of
the regenerated fusion plants (Hu et al., 2002). Flow cytometry has been used in many
studies involving different crops to detect the ploidy level in somatic hybrids (Wang et al.,
2005; Guo et al., 2004; Takami et al., 2004; Xiao et al., 2004). However, detection of the
ploidy level using flow cytometry alone is insufficient to identify somatic hybrids in a
reliable manner (Liu et al., 2005). Molecular analysis of the fusion products using
molecular markers truly gives an in depth knowledge of the fine details of events that
might have occurred during the fusion process and is ideal for confirmation of hybridity
(Liu et al., 2005). To date several molecular marker methods have been used, such as
Random Amplified Polymorphic DNA (RAPD), Restriction Fragment Length
Polymorphism (RFLP), Amplified Fragment Length Polymorphism (AFLP), Cleaved
Amplified Polymorphic Sequences (CAPS) and Simple Sequence Repeats (SSRs)
(Sakamoto & Takeguchi, 1991; Bauer-Weston et al., 1993; Hansen & Earle, 1997; Zubko
et al., 2002; Xia et al., 2003). AFLP is a PCR based marker system that is relatively cheap,
easy, fast and reliable for generating hundreds of informative genetic markers. The time
and cost efficiency, replicability and resolution of AFLPs are superior or equal to those of
other markers (RAPD, RFLP, microsatellites) (Mueller & Wolfenbarger, 1999). Genetic
analysis of the somatic hybrids generated from protoplast fusions using the AFLP
13
technique has been reported in earlier studies (Barone et al., 2002; Holme et al., 2004; Ge
et al., 2006). Furthermore, this technique has been used to distinguish varietal differences
in ryegrass (Roldan-Ruiz et al., 1997). Roldan-Ruiz et al., (2000) differentiated the ryegrass
cultivars, Merbo and Herbie, by their AFLP profiles. AFLP markers have also been used
for genetic diversity assessment in perennial ryegrass (Guthridge et al., 2001) and tall
fescue (Mian et al., 2000).
1.6
Objectives of this thesis
The aim of this thesis is to investigate the use of asymmetric somatic hybrdisation for
gene introgression between monocotyledonous Lolium perenne and dicotyledonous Lotus
corniculatus. In order to achieve this goal the following objectives were established.
1. To establish an in vitro culture system such as callus or cell suspension of L.
perenne so that the tissue is readily available for isolation of protoplasts as and
when required.
2. To isolate and regenerate protoplasts from L. perenne from the established
tissue source from 1 and to investigate the factors which would have an
impact on the isolation and regeneration procedure of protoplasts.
3. To isolate and regenerate protoplasts from L. corniculatus and to investigate the
factors which would have an impact on the isolation and regeneration
procedure of protoplasts.
4. To investigate factors affecting asymmetric protoplast fusion between
monocotyledonous L. perenne and dicotyledonous L. corniculatus and to
investigate callus formation and plant regeneration from the fused protoplasts.
5. To investigate the hybridity status of the fusion products using molecular
markers.
14
CHAPTER 2.
ESTABLISHMENT OF A LOLIUM PERENNE CULTURE SYSTEM FOR
PROTOPLAST ISOLATION
2.1
Introduction
Establishment of a culture system to provide a regular supply of tissue material is one of
the most important steps for any tissue culture experiment, including protoplast isolation.
These culture systems could be callus, cell suspensions or other axenic explants and can
be obtained in many different ways from many different sources. Callus can be induced
from different parts of the plant ranging from seed, stem, and inflorescence and cell
suspensions can in turn be obtained from the callus.
Lolium perenne commonly known as the ‘perennial ryegrass’ is a monocotyledonous species
and over the years it has been observed that callus and cell suspensions are the only
source for totipotent protoplasts. Protoplasts derived from the mesophyll tissue or any
other tissue rarely undergo sustained mitotic divisions in monocotyledons (Potrykus &
Shillito, 1986; Vasil, 1988; Potrykus, 1990) except in some isolated cases eg., plant
regeneration from mesophyll protoplasts of rice (Gupta & Pattanayak, 1993).
Monocotyledonous species where cell suspensions have been the preferred source of
material include rice, rye, banana (Assani et al., 2001), and leek (Buiteveld et al.,1993).
Another advantage of having in vitro material such as callus and cell suspensions is that, in
vitro grown plants effectively eliminate the seasonal variation which affects the
reproducibility of protoplasts if green-house grown plants are used (Davey et al., 2005). It
is therefore necessary to establish callus and cell suspensions of L. perenne in order to
provide a regular supply of in vitro tissue material for isolation of protoplasts as and when
required and also to eliminate any seasonal variation.
Callus is initiated in response to wounding and as a result of sustained cell division due to
the presence of plant growth regulators in the medium such as 2,4-dichlorophenoxyacetic
acid (2,4-D) (van Overbeck, 1935). Continuous agitation of this callus in liquid medium
with plant growth regulators yields a cell suspension culture. Embryogenic cell
suspensions have been the preferred source of tissue material in protoplast isolation
experiments with L. perenne (Altpeter & Posselt, 2000; Spangenberg et al., 1995a; Wang et
al., 1997; Dalton et al., 1998, 1999) and other monocotyledonous species as mentioned
15
earlier. Protoplasts isolated from cell suspensions tend to have higher shoot regenerating
ability. Regeneration of soil-grown plants from embryogenic cell suspension cultures and
protoplasts has been described for grasses in the genera Agrostis (Asano & Sugiura, 1990;
Terakawa et al., 1992; Asano et al., 1994), Dactylis (Horn et al., 1988) Festuca (Wang et al.,
1993; Spangenberg et al., 1994; Dalton, 1988a), Lolium (Wang et al., 1993; CreemersMolenaar et al., 1989; Wang et al., 1995), Paspalum (Akashi et al., 1993) and Poa (Nielsen et
al., 1993). Even though efficient and reproducible protocols have been established for the
induction of callus and cell suspensions from which mature soil grown plants have been
developed for various forage and turf grasses, each species and each cultivar has its own
specific response to callus induction and establishment of cell suspensions.
This chapter therefore focuses on obtaining callus and cell suspensions from different
cultivars of L. perenne as an ideal source tissue for protoplast isolation. Factors such as
concentration of sterilising agent and the duration of treatment with sterilising agent for
obtaining axenic explants, as well as the auxin concentration in the medium are
investigated.
Furthermore, the regeneration ability of the resulting callus and cell
suspensions into new plants are assessed as a basis to facilitate recovery of plants from
protoplast-derived micro and macro colonies.
16
2.2
Materials and methods
2.2.1 Plant Material
Ten different cultivars of Lolium perenne L. viz. ‘Bronsyn’ (Speciality Grains and Seeds,
Christchurch, New Zealand) ‘Impact’, ‘Cannon’, ‘Kingston’, ‘Marsden’, ‘Meridian’, ‘Aries’,
‘Extreme’ (Pyne Gould Guinness Wrightson Limited, Christchurch, New Zealand)
‘Arrow’ (Agriseeds, Christchurch, New Zealand) and ‘Aberdart’ (Germinal Seeds,
Christchurch, New Zealand) were tested for their tissue culture response with respect to
induction of callus and isolation of protoplasts from induced callus and cell suspensions.
2.2.2 Surface sterilisation
The seeds of different cultivars were briefly immersed in 70% ethanol followed by
immersion in 0.75-3.5% Na-hypochlorite (diluted from commercial bleach, Dynawhite
Jasol, New Zealand) for 10-90 min with occasional stirring. The seeds were then rinsed
three times with sterile water. The axenicity was determined after 1 week in culture.
2.2.3 Callus induction and cell suspension initiation
The surface sterilised seeds were plated on hormone-free LS medium (Linsmaier &
Skoog, 1965) with 3% sucrose, solidified with 0.8% agar (Danisco, New Zealand) and
cultured in sterile plastic containers (80 mm diameter × 50 mm high; Vertex Plastics,
Hamilton, NZ). Ten seeds were sown in each container and cultured in the darkness at
25°C. Germinating embryos were excised after 2 days and plated on LS medium with 500
mg/L casein hydrolysate (enzymatic), 3% (w/v) sucrose, and solidified with 0.8% agar.
The media was sterilised in autoclave (Burns & Ferrall Ltd. New Zealand) at 121°C, 20
lb/in2 for 15 min. The auxin 2,4-dichlorophenoxyacetic acid (2,4-D) (GIBCO, USA) at 4
different concentrations (2.5-10 mg/L) was used for initiating callus and cell suspensions.
Callii appearing 4-6 weeks later was maintained by subculture onto the same medium
fortnightly. Friable callus was induced after repeated subculture and used for establishing
cell suspensions and for the isolation of protoplasts. At each concentration of 2,4-D 100
seeds of each cultivar were plated. The experiments were repeated three times.The callus
induction rate was determined after 6 weeks of culture as:
17
Callus induction rate (%) = No. of calli formed/Total no. of immature embryos
plated × 100
Cell suspensions were initiated in 125 ml Erlenmeyer flasks with 35 ml of liquid LS
medium supplemented with 2,4-D at various concentrations (2.5-10 mg/L). The flasks
were cultured at 25°C at low light intensity on a rotary shaker (MaxQ 4000,
Barnstead/Lab-Line) agitated at 100 rpm on a 45×45 cm platform with a 30 cm orbit
diameter. The cell suspension were subcultured every 10 days by replacing 2/3rd of the
suspension with fresh LS medium. A growth curve was determined for the cell
suspensions and the log phase cells were utilised for protoplast isolation. The growth
curve was produced by determining the fresh weight of the cells in a 5 ml aliquot of the
cell suspension every 10 days from the initiation of the experiment for a period of 40
days. The experiments were repeated three times. The cell suspension cultures were
observed under a microscope (Leitz Labovert, Germany) under low magnification (10x).
Some cell preparations were stained with 300µl of Lugol’s solution consisting of iodine
5%, potassium iodide 10% in distilled water 85% to observe starch granules.
2.2.4
Shoot regeneration
The calli obtained from the different cultivars were plated on LS medium (Linsmaier
&Skoog, 1965) with different concentrations of auxin and cytokinins, solidified with 0.8%
agar (Danisco, New Zealand) in sterile plastic containers (80 mm diameter × 50 mm high;
Vertex Plastics, Hamilton, NZ). The calli were cultured at 25°C and 80 µmolm-2s-1 under
16:8 light:dark photoperiod using cool white fluorescent tubes. In each plastic container 5
calli were plated and a total of 30 calli were plated for each cultivar. The experiments was
repeated three times. The number calli regenerating shoots were counted to determine the
percentage shoot regeneration from calli of each cultivar.
The data collected from the above experiments was subjected to analysis of variance
(ANOVA) using the software GenStat-Ninth Edition Version 9.2.0.0.
18
2.3
Results
2.3.1
Axenic seeds
During the surface-sterilisation of seeds from different cultivars it was observed that the
lower concentrations of Na-hypochlorite (0.75 and 1.5%) were not effective in inhibiting
the growth of fungal endophyte present in the seeds. Concentrations of 1.5% resulted in
axenic Bronsyn seeds at frequencies between 25-64% depending on exposure time (Table
2.1). Higher concentrations of Na-hypochlorite increased the frequency of recovering
axenic seeds without affecting their viability. The lowest exposure to Na-hypochlorite
resulting in 100% axenic seeds was 3.0% for 60 min. Further increases in the Nahypochlorite concentration and treatment duration yielded 100% axenic seeds without
decreasing their viability. As a result of these experiments for all subsequent experiments
seeds were surface sterlised in 3.0% Na-hypochlorite for 60 min.
Table 2.1 Axenic status (% ± S.E.) of Lolium perenne
cv Bronsyn seeds after surface-sterilisation treatments
Time
(min)
Na-hypochlorite concentration (%)
0.75
1.5
3.0
3.5
10
12 ± 2
25 ± 3
36 ± 5
54 ± 3
30
12 ± 2
29 ± 1
58 ± 7
90 ± 5
60
16 ± 2
30 ± 2
100 ± 0
100 ± 0
90
22 ± 5
65 ± 6
100 ± 0
100 ± 0
S.E.=Standard Error; number of seeds per treatment=100, each
treatment was repeated 3 times
2.3.2
Callus induction
The ten different cultivars screened for callus induction showed a varied response at
different levels of 2,4-D. The callus induction was determined after 6 weeks incubation.
ANOVA established highly significant interactions between cultivars and 2,4-D
concentrations (Fs=8.19; df=27, 78; P<0.001) suggesting that the cultivars showed
different responses to 2,4-D concentrations. The different cultivars also showed highly
19
significant differences in callus initiation (Fs=106.6; df=9,78; P<0.001). The cultivars
Bronsyn, Canon, Impact and Kingston all exhibited significantly higher callus induction
callus induction (%)
frequencies than the other six cultivars (based on l.s.d.=2.703% at 5% level) (Fig 2.1).
45
2.5 mg/L
40
5 mg/L
35
7.5 mg/L
30
10 mg/L
25
20
15
10
5
m
e
Ex
tre
Ar
ie
s
sd
en
an
M
ar
id
i
ar
t
M
er
w
Ab
er
d
Ar
ro
n
pa
ct
Ki
ng
st
on
Im
an
o
C
Br
on
sy
A
n
0
Figure 2.1 Effect of different 2,4-D concentrations on callus
induction from Lolium perenne cultivars after 5 weeks in
culture. Error bars represent standard error of 3 replications, each with
100 seeds
The different responses of cultivars in callus induction suggests the presence of genetic
variability for tissue culture aptitude between the cultivars. Freshly induced callus is
shown in Figure 2.2.
20
Figure 2.2 Freshly induced callus from Lolium perenne after 6 weeks in culture.
The palea and lemma which form the seed coat were found to have an influence on the
callus induction ability of the seeds. When Bronsyn seeds without the seed coat were
plated on callus induction medium at different levels of 2,4-D, the callus induction
frequency was 5-10% higher in seeds without the seed coat compared to the seeds with
Callus Induction (%)
the seed coat at all levels of 2,4-D (P<0.001; l.s.d.=3%; df=3, 14) (Fig 2.3).
45
w ith seedcoat
40
w ithout seedcoat
35
30
25
20
15
10
5
0
2.5
5
7.5
10
2,4-D concentration (mg/l)
Figure 2.3 Callus induction from Lolium
perenne cv Bronsyn seeds with and without
seedcoat.
Error bars represent standard error of 3
replications each with 100 seeds.
21
2.3.3
Cell suspension initiation
Established cell suspensions of Bronsyn were investigated for their growth at different
levels of 2,4-D. The greatest cell suspension growth was observed at 5.0-7.5 mg/L 2,4-D
(Fig 2.4). Figure 2.5 shows cell suspensions initiated from L. perenne with globular cell
clumps.
Growth (g/5 ml culture)
0.5
0.4
0.3
0.2
A
B
0.1
0
0
2.5
5
7.5
2,4-D concentration (mg/l)
10
Figure 2.4 Effect of 2,4-dichlorophenoxyacetic acid on
the growth of Lolium perenne cv Bronsyn cell
suspensions after 4 weeks.
Error bars represent standard error of 3 replications Fs =1.70; df=4, 10;
P=0.226; l.s.d.at 5% =0.1706.
22
A
B
Figure 2.5 Cell suspension culture of Lolium perenne. A.
Cell suspension 1 week after subculture; B. Globular cell
suspension clumps, Bar = 1mm
During the growth of cell suspensions, a typical sigmoid growth curve was obtained with
the log phase between 10-20 days from the initiation of the culture (Fig. 2.6). During the
initiation of callus and cell suspensions two types of cells were observed. Cells with dense
granular starch material and cells without starch granules (Fig 2.7). Both types of cells
yielded cell suspensions when 200 mg of callus was incubated in liquid LS medium
containing 2,4-D (5 mg/L) and casein hydrolysate (500 mg/L). Cells without starch
granules consisted of elongated cells. In the later experiments involving protoplast
isolation it was observed that the cells with dense granular starch material released
protoplasts more readily than cells without starch granules.
23
Growth (g/5 ml culture)
0.3
0.2
0.1
0
5
10
20
30
40
Days
Figure 2.6 Growth curve for Lolium perenne cv
Bronsyn cell suspension culture.
Error bars represent standard error of 3 replications. Cell
mass in 5ml suspension culture.
A
Figure 2.7
B
Types of cells observed in the cell suspensions.
A. Cells with dense starch granules, bar=50µm B. Cells without starch granules, bar=100µm
24
2.3.4
Plant regeneration from callus
Various auxin and cytokinin concentrations were investigated for their effect on plant
regeneration from the calli of the different cultivars (Table 2.2). ANOVA established that
there was a highly significant interaction between cultivars and PGR during shoot
regeneration (Fs=118.62; df=27,56; P<0.001). While there were highly significant
differences between regeneration frequencies of the cultivars (Fs=15.16; df=15,68;
P<0.001), each cultivar preferred a different PGR to achieve high regeneration. Impact
gave the highest response with kinetin, whereas the other three preferred BA.
Table 2.2 Plant regeneration (%+ S.E.) from calli of different cultivars at
different concentrations of plant growth regulators
PGR
2,4-D
BA
Kinetin
Control
Concentration
Cultivars
(mg/L)
Bronsyn
Impact
Canon
Kingston
0.1
67.3 + 4.1
43.0 + 3.6
30.0 + 4.3
41.6 + 2.5
1.0
60.0 + 4.3
43.0 + 4.5
44.0 + 5.2
0.0 + 0.0
0.1
68.0 + 3.0
59.3 + 5.8
31.0 + 3.6
91.0 + 3.6
1.0
61.0 + 2.6
50.6 + 2.0
52.6 + 4.1
98.0 + 2.8
0.1
52.3 + 4.0
89.6 + 2.0
9.6 + 2.0
56.6 + 4.7
1.0
39.3 + 2.0
28.3 + 4.1
25.6 + 4.0
67.6 + 3.5
0
34.3 + 3.2
63.0 + 5.1
0.0 + 0.0
51.0 + 6.5
S.E.= standard error; each experiment was repeated 3 times. (l.s.d.=6.335 at 5% level)
25
Futhermore, the frequency of albino shoots formed during the regeneration process
varied between the cultivars, with Impact having the highest frequency of albino shoots
whereas Kingston had the lowest incidence of albino shoot formation (Table 2.3). The
formation of albino and green shoots is shown in Figure 2.8.
Table 2.3 Frequency (%+ S.E.) of
albino and green shoot formation
from various cultivars
Cultivar
Albino
Green
Bronsyn
26 + 3
74 +3
Canon
24 + 3
76 + 3
Impact
35 + 2
65 + 2
Kingston
12 + 5
88 + 5
Meridian
20 + 6
80 + 6
Marsden
18 + 1
82 + 1
Aries
26 + 2
74 + 2
Arrow
17 + 5
83 + 5
Aberdart
26 + 4
74 + 4
Extreme
27 + 2
73 + 2
S.E.= standard error each experiment was
repeated 3 times, number of calli plated per each
experiment= 30
26
A
B
Figure 2.8 Shoot regeneration from callus of Lolium perenne
cv Bronsyn
A. Green shoot formation; B. Albino shoot formation
27
2.4
Discussion
One of the important prerequisites for successful protoplast isolation and shoot
regeneration is the availability of axenic non-contaminated cell cultures. Such axenic
cultures can be obtained by surface sterilisation of the plant part that would be used for
the initiation of the callus or cell suspension cultures, such as leaf explants, seeds,
inflorescence. Obtaining axenic cultures of L. perenne explants is particularly difficult due
to the presence of the endophytic fungi Neotyphodium lolii (Glen et al., 1996, Shiba &
Sugawara, 2005).
In previous studies different methods have been employed to obtain axenic cultures.
Dalton (1988b) working with Festuca arundinacea and L. perenne treated seeds with 100%
sodium hypochlorite solution followed by imbibition of the seeds in distilled water, then
further treatment with 10% sodium hypochlorite solution. Wang et al. (2002a) working
with L. temulentum, treated seeds on 2 consecutive days with 100% sodium hypochlorite
and 3% calcium hypochlorite respectively.
L. perenne has a thick seed coat palea and lemma, which protects the inner seed from
harsh surrounding environmental conditions. In order to obtain 100% axenic seed
treatments with 3% Na-hypochlorite for a duration of 60 min were necessary (Table 2.1).
A further increase in the concentration and treatment duration gave similar results
without affecting the seed viability. The approach used in this study avoided the extra
treatment of soaking the seeds overnight in sterile water or retreatment with bleach as
performed in earlier studies (Dalton, 1988; Wang et al., 2002a). Increasing the duration of
treatment of the sterilizing agent allows better penetration and better chances for
eliminating the contaminating fungi thus ensuring axenic material for induction of callus.
When different cultivars of L. perenne were screened for callus induction great variability
in their response was observed. Cultivar ‘Bronsyn’ along with ‘Cannon’ had the highest
callus induction frequency of 36% each, whereas ‘Aberdart’ had the lowest callus
induction frequency of 2% (Figure 2.2). The cultivar ‘Meridian’ did not form any callus at
2.5 mg/L 2,4-D, but there was an increasing trend in callus induction frequency from 510 mg/L of 2,4-D, whereas other cultivars showed the highest callus induction
frequencies at 5 and 7.5 mg/L concentration with gradual decrease at 10 mg/L
28
concentration. These results reflect the ability of different cultivars to form callus at
different levels of 2,4-D. These variations in response to callus induction of the different
cultivars of L. perenne could be due to genetic variation. Genetic variability between
cultivars for tissue culture response has been shown to exist in earlier studies on L. perenne
(Roldan-Ruiz et al., 2000, Olesen et al., 1995, Olesen et al., 1996, Creemars-Molenaar et al.,
1988). Genotypic effects on the frequency of callus induction from immature embryos
was also shown in several studies of cereals (Luhrs and Lorz, 1987; Hanzel et al., 1985;
Chevrier et al., 1990). Bhaskaran and Smith (1990) expressed the views that the genetic
basis of variability in tissue culture response and morphogenesis is most likely due to
differences in hormone metabolism within the explant which is established by the level of
gene expression for individual hormones by the genotype. The present study once again
confirms that the genetic variability between the cultivars significantly influences the
callus inducing ability. Further experiments with ‘Bronsyn’ showed that the callus
induction increased with removal of the palea and lemma by 5-10% at all levels of 2,4-D
tested (Figure 2.3). A similar method was adopted by Wang et al. (2002a). The removal of
palea and lemma increased the callus induction rate. The remainder of the cultivars were
not screened for the effect of palea and lemma on the callus induction. It was assumed
that they would exhibit a similar response to Bronsyn. Besides, the removal of palea and
lemma was time consuming for only a 5-10% increase in callus induction.
Cell suspensions were initiated from friable callus. During the induction process two
types of callus types were seen. Globular callus with nodules and undistinguished mass of
cells filled with dense granular starch particles. The former failed to initiate any cell
suspensions whereas the latter proliferated easily in the suspension giving rise to cell
suspensions from which protoplasts could be isolated easily.
Lolium perenne is an outbreeding species and pronounced differences among embryogenic
cell lines with respect to suspension formation could be genotype dependent. Each seed
within a cultivar could represent a different genotype. Such genotypic effect have been
demonstrated for regeneration from single genotype derived cultures of L. perenne (Olesen
et al., 1995). Thus, while working with transformation experiments of Lolium species,
Wang et al. (1993) used single genotype derived embryogenic suspensions in order to
eliminate genotypic differences among the regenerants or transformants. Such approaches
have also been applied in other out breeding grasses such as Festuca (Spangenberg et al.,
1995b; Wang et al., 1993). This suggests that for the initiation of cell suspensions for L.
29
perenne, it is important to screen a large number of seeds for more responsive genotypes
cultivars with a high amenability to culture in liquid medium. Similar views were
expressed by Asano and Sugiura (1990) while working with Agrostis alba.
Plant regeneration from the callus was achieved when the callus was plated on LS
medium supplemented with plant growth regulators at different concentrations. The
variability in the response to shoot regeneration of the different cultivars depicts the
variability within the cultivars of L. perenne. The variation between cultivars in the
frequency of the shoot regeneration (Table 2.2) and the frequency of albino shoot
formation from callus further reflects the genetic variation for these traits in L. perenne.
The changes leading to albino plant formation in somatic in vitro culture are not known,
but studies with perennial ryegrass reveal a large genotypic influence on albino plant
frequencies (Olesen et al., 1995). Similar differences in tissue culture responses were
demonstrated in perennial ryegrass turf type cultivars (Bradley et al., 2001) and apomictic
cultivars of buffel grass (Colomba et al., 2006).
The results have demonstrated the differences in the tissue culture response of some of
the commercially elite L. perenne cultivars. These elite cultivars with high capacity for
callus induction and plant regeneration could be used in breeding experiments to obtain
somaclonal variants which would enable a new class of cultivars with greater amenability
to tissue culture. The responses shown by the 10 cultivars tested for plant regeneration
from callus represent the potential for in vitro studies of L. perenne forage type cultivars.
30
CHAPTER 3.
PROTOPLAST ISOLATION AND SHOOT REGENERATION FROM
LOLIUM PERENNE
3.1
Introduction
Lolium perenne is a monocotyledonous species belonging to the family Poaceae. Isolation
of protoplasts and regeneration of plants from protoplasts has always been difficult
from monocotyledonous species. Protoplasts isolated from mesophyll tissue rarely
undergo sustained mitotic division (Potrykus and Shillito, 1986; Vasil, 1988; Potrykus,
1990) and are thus recalcitrant to regeneration. Therefore, callus and embryogenic cell
suspensions have been extensively used as the source of protoplasts in Lolium species
(Wang et al., 1993) and other monocotyledons (Nielsen et al., 1993; Taylor et al., 1992).
Protoplasts are formed by the enzymatic degradation of the cell wall. The plant cell wall
is composed of the primary and secondary cell wall. A typical primary plant cell wall is
made up of cellulose microfibrils (9-25%), hemicellulose (25-50%), pectins (10-35%),
and proteins (10%) while a secondary cell wall is composed of cellulose (40-80%),
hemicellulose (10-40%), and lignin (5-25%) (Esau, 1977; Bidlack, 1990; Salisbury and
Ross, 1992). The production of protoplasts depends on the successful digestion of both
the primary and secondary cell wall components.
Protoplast isolating enzyme mixtures contain enzymes that degrade these cell wall
components and are formulated depending on the composition of the cell walls of the
tissue used for protoplast isolation. Specific commercial formulations of enzymes have
been used for the degradation of each of these components for example
Cellulase – Onozuka-RS : Degradation of cellulose
Macerozyme –R 10 and Pectolyase : Degradation of pectin
Driselase : Degradation of cellulose, pectin and hemicellulose
A combination of these enzymes at appropriate levels ensures in the degradation of the
cell wall leaving behind only cell contents surrounded by the plasma membrane - the
protoplasts. The culture medium in which the enzyme mixture is made has a large
31
bearing on the physiology of the protoplasts and affects their yield and viability. One of
the crucial factors in the preparation of the enzyme mixture is the osmolarity of the
medium. Since protoplasts are bound only by the plasma-membrane which separates the
inner cell contents from the outer medium, maintaining the osmotic pressure is of
utmost importance to ensure the protoplasts don’t burst. The dynamics of osmotic
water permeability influences the dynamics of activation of plasma-membrane
aquaporins which controls flow of ions in and out of protoplasts (Moshelion et al.,
2004).
The efficient production of viable protoplasts is influenced by different important
factors.
1) The type of tissue used during isolation and its physiological state
2) The type of enzymes used to digest cell wall components
3) The incubation period
4) The osmolarity of the enzyme mixture
These parameters coupled with other factors have a large influence on the digestion of
the cell wall and the release of protoplasts. They also have an impact on the
physiological state of the isolated protoplasts which, in turn, influences the regeneration
potential of the protoplasts. Regeneration of the protoplasts also depends on the type of
tissue used during the isolation process.
In this chapter the impact of the different factors influencing the protoplast isolation
and regeneration ability of L. perenne was investigated. Ten cultivars of L. perenne, viz cv
Bronsyn, cv Impact, cv Kingston, cv Canon, cv Arrow, cv Aberdart, cv Meridian, cv
Marsden, cv Aries and cv Extreme were investigated for their response to generate
protoplasts and regeneration of plants from protoplasts with emphasis on cultivar
‘Bronsyn’.
32
3.2
Materials and methods
3.2.1
Tissue source for protoplast isolation
a) Etiolated leaves: Sterile seeds were germinated in the dark on hormone-free LS
medium. After 5 days the etiolated leaves from the germinated seeds were used
for the isolation of the protoplasts. The leaves were finely chopped prior to
incubation in the enzyme mixture.
b) Callus: Friable callus derived from mature seed embryos was obtained after
repeated subculturing in the darkness at 25 °C on LS medium with 5 mg/L 2,4D. Callus was used for protoplast isolation 5-6 days after subculture
c) Cell suspensions: Cell suspensions derived from embryo derived callus were
maintained in liquid LS medium with 5 mg/L 2,4-D and used for protoplast
isolation 5 days after subculturing.
3.2.2
Protoplast isolation
Protoplasts were isolated from etiolated leaves, callus and cell suspensions from
different cultivars. A variety of enzyme combinations at various concentrations were
tested. These enzymes included Cellulysin (Sigma-Aldrich, USA), Onozuka RS (Yakult
Honsha Co., Ltd.), Onozuka R-10 (Yakult Honsha Co., Ltd.), Macerozyme R-10 (Yakult
Honsha Co., Ltd.), Driselase (Sigma-Aldrich, USA) and Pectolyase (Sigma-Aldrich,
USA). Different enzyme buffers which included 3 different osmolarity strengths (0.2 M0.8 M Mannitol) were tested for their effect on protoplast isolation and viability. The
enzymes were dissolved in their respective buffer solutions of Mannitol and calcium
chloride (CaCl2.2H2O) (M+C) and filter sterilised using 0.45 µm sterile filter units
(Sartorius Minisart® Vivascience AG, Hannover, Germany). Protoplast isolation for
different time intervals (6, 12, 24 h) was investigated to test the effect of incubation
period on the release of protoplasts and their viability. The above protoplast isolation
factors of source tissue, enzyme combination, osmolarity and incubation time were
standardised for cv Bronsyn. During protoplast isolation 10 mg of tissue was incubated
in 5 ml of enzyme mixture in sterile plastic Petri dishes. The optimum conditions were
then used for other cultivars to investigate their protoplast releasing abilities. All the
isolations were done under continuous shaking in the darkness at 25°C on an orbital
shaker (IKA-VIBRAX-VXR, IKA Labortechnik, STAUFEN Germany, 20×40 cm
platform with 7 cm orbit diameter) at 40 rpm.
33
3.2.3
Protoplast purification
After incubation the enzyme-protoplast mixture was filtered through a 45µm nylon
mesh in order to remove the undigested plant material. The solution was transferred to
10 mL Falcon tubes and centrifuged at 18 g for 5min. The supernatant enzyme solution
was discarded and the protoplast pellet was resuspended in 10 mL isolation buffer M+C
with 5 mM MES, pH 5.8. The above procedure of centrifugation and resuspension of
protoplasts in isolation buffer (M+C) was repeated three times to remove any traces of
enzyme. The final protoplast pellet was resuspended in 5 ml of isolation buffer (M+C).
The protoplasts were counted using a haemocytometer and the viability was tested by
staining the protoplasts using fluorescein diacetate (FDA) (Pfaltz & Bauer Inc., USA).
FDA (0.2% in acetone) stock was used for staining the protoplasts. The protoplasts
were then visualised under a fluorescent microscope (Olympus BH2 Research
Microscope). Viable protoplasts were spotted as bright green whereas no fluorescence
was observed with non viable protoplasts. The protoplast isolation and purification is
shown in Fig 3.1
Figure 3.1 Isolation, purification and culture of protoplasts
34
3.2.4
Protoplast culture
Different methods and media were evaluated for the culture of protoplasts. Four well
established culture methods, viz. culture in liquid medium, embedding, nurse cultures
and culture on nitrocellulose membrane (0.8 µm gridded, Millipore, USA) with feeder
cell layers, were used. LS medium, ½ LS medium (Half strength of major and minor
salts, vitamins and sucrose), MLS (Yamada et al., 1986) and PEL medium (Pelletier et al.,
1983) were evaluated for the culture of protoplasts.
A)
Culture of protoplasts in liquid medium
For the culture of protoplasts in liquid medium, 2 ml of the desired medium was
placed in 24-well plates (12.8×8.5×2.0 cm dimensions) (Greiner Bio-one,
Germany) (Fig 3.2). The protoplasts were then cultured in these wells at a
density of approximately 4-5×105/ml. The plates with the protoplasts were
incubated in darkness at 25°C for 48 h and then cultured under 80 µmol m-2s-1
with a 16:8 h light dark photoperiod to facilitate cell wall and colony formation.
Figure 3.2 Culture of protoplasts using liquid medium
B)
Culture of protoplasts by embedding
During embedding culture the protoplasts at a density of approximately 45×105/ml were spread thinly on already solidified LS medium and warm molten
(34°C) LS medium with agarose (Amresco, USA) was carefully poured over the
top to embed the protoplasts (Fig 3.3). The molten agar was slowly swirled prior
35
to solidifying for even distribution of the protoplasts. The plates were then
cultured in the darkness at 25°C.
Protoplasts
embedded in agarose
Agar 0.8%
Figure 3.3 Culture of protoplasts using the embedding technique
C)
Culture of protoplasts using bead-type culture technique
In the bead-type culture technique the protoplasts at a density of approximately
4-5×105/ml were embedded in agarose medium. Blocks of the solidified agarose
with protoplasts were then scooped and cultured in liquid conditioned medium
(Cell-free medium from 3 day old L. perenne suspension culture) (Fig 3.4). The
protoplasts were cultured in the darkness at 25°C.
Blocks of agarose with protoplasts
Conditioned culture medium 20 ml
Figure 3.4 Culture of protoplasts using bead-type culture
technique
36
D)
Culture of protoplasts on nitrocellulose membranes with a feeder
layer
For the culture on nitrocellulose membrane with a feeder layer, a thin layer of
cells (3 ml) from a 5 day old L. perenne cell suspension culture, were spread on
already solidified medium in 7 cm Petri dish. Sterile nitrocellulose membranes
were placed on the thin layer of cells and protoplasts (at a density of
approximately 4-5×105/mL) were then spread on the nitrocellulose membrane
(Fig 3.5). The plates were cultured in darkness at 25°C until the appearance of
the micro-colonies.
Nitro cellulose membrane
Protoplasts
Solidified PEL medium
Figure 3.5 Culture of protoplasts using nitrocellulose membrane with the
feeder layer technique
3.2.5
Shoot regeneration
The protoplast derived calli were plated on LS medium (Linsmaier & Skoog, 1965) with
different concentrations of auxin and cytokinins, solidified with 0.8% agar (Danisco,
New Zealand) in sterile plastic containers (80 mm diameter × 50 mm high; Vertex
Plastics, Hamilton, NZ). The calli were cultured at 25°C and 80µE m-2s-1 under 16:8
light:dark photoperiod using cool white fluorescent tubes. In each plastic container 5
calli were plated and a total of 20 calli were plated for shoot regeneration. The
experiments was repeated three times. The number of calli regenerating shoots were
counted to determine the percentage shoot regeneration.
37
3.2.6
Statistical analysis
The data collected from the above experiments was subjected to statistical analysis using
GenStat-Ninth Edition Version 9.2.0.0. Data in terms of protoplast counts was
collected wherein individual protoplasts were counted on a compound microscope
(Olympus BH2 Research Microscope) using a haemacytometer. Viability was
determined by counting the total number of protoplasts emitting fluorescence under
UV after staining with FDA. The count was taken 3 times. The experiments were
repeated 3 times to ascertain the consistency of the results.
38
3.3
Results
3.3.1
Protoplast Isolation
3.3.1.1 Effect of different tissue types on protoplast isolation
Three types of tissues, viz. etiolated leaves (5 days old) obtained from germinating
seedlings in the dark, callus (5 days after subculture) derived from mature embryos, and
fast growing cell suspensions (5 days after subculture) derived from friable callus, were
used to determine the best tissue source for high yield protoplasts. Figure 3.6 shows
freshly isolated protoplasts from L. perenne cell suspensions.
ANOVA determined that the different tissue sources showed highly significant
differences in the protoplast yield (Fs=53.14; df=2, 6; P<0.001), but not significant
differences in protoplast viability (Fs=1.77; df=2, 6; P=0.249). These experiments
showed that etiolated leaves from germinating seedlings produced the least protoplasts
with a yield of 0.1 × 106 protoplasts g-1 FW. In contrast, growing cell suspensions
produced the highest yield of
10.0 × 106 protoplasts g-1 FW which was significantly
higher compared to the yields obtained from etoliated leaves and callus tissue (based on
l.s.d.=2.4 × 106 at the 5% level) (Table 3.1). Protoplasts isolated from cell suspensions
had a higher viability however, this was not significantly different from the viability of
protoplasts isolated from etiolated leaves and callus tissue (based on l.s.d.=14% at the
5% level) (Table 3.1). These experiments demonstrate that less organised tissues such as
cell suspension are more suitable for protoplast isolation than organised tissues such as
leaves. It was noted that cell suspension cells with a high degree of starch accumulation
(Fig 2.7 Chapter 2) had better release of protoplasts and relatively higher cell division
frequency (data not shown).
39
Table 3.1 Protoplast yield from different tissues of Lolium perenne cv Bronsyn
Tissue source
Yield × 106(+ S.E.)
Etiolated leaves
0.1 + 2.0
Viability (%+ S.E.)
71 + 4
Callus
4.0 + 1.0
77 + 6
Cell suspensions
10.0 + 0.0
82 + 8
S.E. = Standard error; Each experiment was repeated three times,
Yield = no. of protoplasts per g fresh weight; Enzyme ‘A’: Cellulase Onozuka RS 2%, Macerozyme R-10
1%, Driselase 0.5%, Pectolyase 0.2% was used for isolation of protoplasts.
Figure 3.6 Freshly isolated Lolium perenne cv Bronsyn protoplasts from cell
suspensions
40
3.3.1.2 Effect of different enzyme combinations on the yield and viability of
protoplasts
Four different enzyme combinations were formulated in order to investigate their effect
on the release of protoplasts and their viability. All the enzyme combinations formulated
yielded protoplasts. ANOVA showed that the yield of protoplasts differed highly
significantly between the enzyme treatments (Fs=430.63; df=3, 8; P<0.001). The
enzyme combination ‘A’ with Onozuka RS 2%, Macerozyme R-10 1%, Driselase 0.5%
and Pectolyase 0.2% resulted in highest yield of 10.8 × 106 protoplast g-1 FW with a
viability of 82%. The enzyme combination ‘C’ with only Onozuka RS 2% and
Macerozyme R-10 1% resulted in the lowest yield of 0.07 × 106 protoplast g-1 FW with a
viability of 78%. The results show that the presence of pectolyase increased the
protoplast yield (Table 3.2). The yield obtained from enzyme combination ‘A’ was
significantly different (based on l.s.d.=0.78 × 106 at the 5% level) from the yield
obtained from the remainder of the enzyme combinations. ANOVA showed that the
viability of protoplasts was not significantly different from the various enzyme
combinations (Fs=0.50; df=3, 8; P=0.694).
Table 3.2 Effect of different enzyme combinations on the yield and viability of
Lolium perenne cv Bronsyn protoplasts from cell suspensions
Enzyme combination
Yield × 106 (+ S.E.) Viability (%+ S.E.)
g-1 FW
A
10.8 + 0.8
82 + 8
B
0.22 + 0.0
78 + 4
C
0.07 + 0.0
78 + 8
D
0.60 + 0.1
83 + 4
A: Cellulase Onozuka RS 2%, Macerozyme R-10 1%, Driselase 0.5%, Pectolyase 0.2%
B: Cellulase Onozuka RS 2%, Macerozyme R-10 1%, Pectolyase 0.2%
C: Cellulase Onozuka RS 2%, Macerozyme R-10 1%,
D: Cellulase Onozuka RS 2%, Driselase 0.5%, Pectolyase 0.2%
S.E. = Standard error, Each experiment was repeated three times;
Yield = no. of protoplasts per g fresh weight
41
3.3.1.3 Effect of incubation time on protoplast yield and viability
Experiments on the length of tissue incubation in the enzyme mixture demonstrated no
significant effects on protoplast yield (Fs=2.07; df=2, 6; P=0.207), but highly significant
effects on protoplast viability (Fs=128.31; df=2, 6; P<0.001). As the tissue incubation
period increased there was a decrease in the viability of the recovered protoplasts. At 24
h incubation period though there was a high yield of 2.8 × 107 protoplast g-1 FW, but
the corresponding viability was very low at 34%. In contrast, protoplast isolation for
only 6 h incubation had a yield of 0.9 × 107 protoplast g-1 FW with corresponding
viability of 83% (Table 3.3).
Table 3.3 Effect of incubation time on the yield and viability of Lolium perenne
cv Bronsyn protoplasts from cell suspensions
Duration (h)
Yield × 107 (+ S.E.)
Viability (%+ S.E.)
6
0.9 + 0.3
83 + 2
12
2.5 + 1.3
47 + 2
24
2.8 + 1.6
34 + 2
S.E. = Standard error, Yield = no. of protoplasts per g fresh weight; Each experiment was repeated 3
times. The enzyme used during the isolation of protoplasts was Enzyme combination A (Cellulase
Onozuka RS 2%, Macerozyme R-10 1%, Driselase 0.5%, Pectolyase 0.2%) in 0.6 M mannitol.
3.3.1.4 The effect of osmolarity on the protoplast yield
The best enzyme combination from section 3.3.1.2 was used to investigate the effect of
osmolarity on protoplast yield and viability. At 0.2 M mannitol the protoplast yield was
considerably lower (Table 3.4) and the protoplasts expanded in size (~75 µm diameter)
and ultimately bursted. At 0.4 M and 0.6 M mannitol more normal sized (45-50 µm
diameter) protoplasts were released, with the highest protoplast yield at 0.6 M mannitol.
The isolation of protoplasts at 0.8 M mannitol reduced protoplast yield with shrunken
protoplasts due to the high osmotic pressure. The viability of the protoplasts
substantially decreased in 0.8 M mannitol. ANOVA of the data showed that there were
highly significant differences in the yield (Fs=338.31; df=3, 8; P<0.001), and viability
42
(Fs=28.77; df=3, 8; P<0.001) of the protoplasts. A significantly high yield of protoplasts
was obtained when isolated at 0.6 M mannitol (based on l.s.d.=0.77 × 106, at the 5%
level). The viability of the protoplasts obtained at 0.8 M was significantly lower (based
on l.s.d.=11% at the 5% level).
Table 3.4 The effect of osmolarity on the yield and viability of Lolium perenne cv
Bronsyn protoplasts
Osmolarity (M)
Yield × 106 ± S.E.
Viability (%)
0.2
0.06 ± 0.0
77 ± 7
0.4
2.40 ± 0.6
76 ± 3
0.6
10.19 ± 0.4
82 ± 7
0.8
3.40 ± 0.3
43 ± 6
Yield = no. of protoplasts per g fresh weight. The enzyme used during the isolation of protoplasts was
Enzyme combination A (Cellulase Onozuka RS 2%, Macerozyme R-10 1%, Driselase 0.5%, Pectolyase
0.2%) for 6 h incubation period
3.3.1.5 Protoplast isolation from different cultivars of Lolium perenne
Ten cultivars of L. perenne were tested to investigate whether the potential for protoplast
isolation had a genetic component. Cell suspension cultures established from each of
these cultivars (as described in section 2.2.3) were used as the source tissue for
protoplast isolation. Cultivars Bronsyn, Impact, Cannon, Kingston and Arrow were able
to release protoplasts, whereas cultivars Aberdart, Meridian, Marsden, Aries and
Extreme failed to release any protoplasts at the optimum conditions determined for
Bronsyn (Table 3.5). ANOVA established signficant differences between cultivars in the
yield (Fs=74.16; df=4, 10; P<0.001) and viability (Fs=5.61; df=4, 10; P=0.012) of the
protoplasts. Of the 5 cultivars successfully releasing protoplasts, cv Impact yielded the
highest number (11 ± 0.5 × 106 protoplasts g-1FW) with 90% viability, whereas, cv
Arrow yielded the lowest number of protoplasts (0.01 ± 0.0 × 106 protoplasts g-1FW)
with 72% viability. Protoplasts isolated from Impact had dense cytoplasm. The yield of
protoplasts from cv Bronsyn and cv Impact was significantly higher than the yields
obtained from the rest of the cultivars (Table 3.5) (based on l.s.d.=2.12 × 106 at the 5%
43
level). The viability of protoplasts obtained from cv Arrow was significantly lower when
compared to the rest of the cultivars (based on l.s.d.=10% at the 5% level).
Table 3.5 Protoplast isolation from different cultivars of Lolium perenne1
Cultivar
Yield × 106 ± S.E.
Viability (% ± S.E.)
Bronsyn
10.80 ± 0.4
82 ± 5
Impact
11.00 ± 0.5
90 ± 2
Cannon
0.04 ± 0.2
88 ± 1
Kingston
0.09 ± 0.0
77 ± 2
Arrow
0.01 ± 0.0
72 ± 4
1Cultivars
Aberdart, Meridian, Marsden, Aries and Extreme failed to release protoplasts.
S.E: Standard error, Yield = no. of protoplasts per g fresh weight; each experiment was repeated 3 times.
3.3.2
Protoplast culture
Different methods and media were attempted for protoplast culture. The 5 cultivars of
L. perenne yielding protoplasts were screened for protoplast culture. Only protoplasts
isolated from Bronsyn were able to undergo cell division and form micro-colonies.
Protoplasts isolated from the other four cultivars were found to be recalcitrant to
culture and could not be induced to undergo any cell division using any of the media
and culture methods attempted (data not shown). Protoplasts isolated from Bronsyn
were able to undergo divisions in the liquid medium however could not proceed beyond
the 4-5 cell stage (Table 3.6). Consistent colony formation and highest plating efficiency
of 0.16% was observed with nitrocellulose membrane culture method with feeder-layer
(Table 3.6 Fig 3.2). Embedding and bead-type culture methods were unsuccessful in
initiating cell division (Table 3.6).
44
A
Control without
L. perenne feeder
layer
B
LS medium with L.
perenne feeder
layer
PEL medium with L.
perenne feeder layer
C
Figure 3.7 Lolium perenne cv Bronsyn protoplast culture on nitrocellulose
membrane with feeder-layer A: Effect of feeder-layer on protoplast culture; B: Protocolonies
2 weeks after culture of protoplasts; C: Protocolonies 6 weeks after culture of protoplasts
45
Table 3.6 Plating efficiencies of Lolium perenne cv Bronsyn protoplasts with
different culture systems and media
Plating efficiencies with various culture systems
Liquid
Embedding
Bead-type
Culture
Nitrocellulose
membrane and
media
feeder layer
LS
0.01 + 0.00
0.00
0.00
0.04 + 0.03
½ LS
0.00
0.00
0.00
0.00
MLS
0.00
0.00
0.00
0.00
PEL
0.00
0.00
0.00
0.16 + 0.02
Plating efficiency: No. of microcolonies formed/ No. of protoplasts plated × 100; LS: Linsmaier and
Skoog medium; 1/2LS: Linsmaier and Skoog medium with Half strength of major and minor salts,
vitamins and sucrose; MLS: modified Linsmaier and Skoog medium (Yamada et al., 1986); PEL (Pelletier
et al., 1983)
S.E. = Standard error
3.3.3
Shoot regeneration
The microcolonies formed from the Bronsyn protoplasts were plated on LS medium
with different combinations of the growth hormones 2,4-D, BA, and kinetin. Shoot
morphogenesis was observed 10-14 days after transfer to regeneration medium (Fig 3.8).
All the shoots regenerated from the protocolonies were albino. The highest shoot
regeneration frequency of 23% was observed with the combination of 0.1 mg/L 2,4-D
and 0.1 mg/L BA. The control medium without any hormones failed to produce any
shoots (Table 3.7).
Figure 3.8 Shoot regeneration from Lolium perenne cv Bronsyn protocolonies 6
weeks after culture of protoplasts
46
Table 3.7 Shoot regeneration from Lolium perenne cv Bronsyn protoplast
derived callus colonies on LS medium with various growth hormones
Plant
Growth Concentration
Shoot
regeneration
Regulator
(mg/L)
2,4-D
0.1
16 + 1
1.0
0
0.1
13 + 2
1.0
00 + 0
Kinetin
0.1
20 + 2
2,4-D/BA
0.1/0.1
23 + 1
BA/Kinetin
0.1/0.1
10 + 2
Control
0
BA
(%)+ S.E
0
S.E.= Standard error for 3 replications of 20 calli
47
3.4
Discussion
The protoplast yield from L. perenne varied markedly with the type of tissue used during
isolation (Table 3.1). Protoplasts isolated from the leaf tissues were recalcitrant to
regeneration confirming earlier findings (Vasil et al., 1990), while those isolated from
callus tissues showed varied degrees of totipotency. The variability in the isolation of
protoplasts from the different tissues might also be attributed to the cell wall
composition of the individual tissues. Occurrence of higher xylan in the epidermal walls
than in the other cell types such as sclerenchyma cells, pith cells, and vascular bundle
zone cells were noted by Hatfield et al. (1999) while working sorghum. Investigations on
the cell wall composition of the different tissue types used in the current research might
be helpful in providing an answer to the variability of protoplast isolation from different
tissue types.
Formulation of the enzyme mix suitable for protoplast isolation has always influenced
the release of protoplasts in most of the plant species from which protoplasts have been
isolated and influences the subsequent yield, viability and regeneration ability (Ma et al.,
2003; Akashi et al., 2000; Taylor et al., 1992; Vessabutr & Grant, 1995). The
combinations of enzyme mixtures used during the isolation of L. perenne protoplasts had
positive and negative influences (Table 3.2). Positive influences have been the increase
in the protoplast yield and decrease in the incubation time, while negative influences
have been the reduction in the viability and loss of totipotency. An effective enzyme
combination should be able to give a high yield of protoplasts without affecting the
viability. In the current study, addition of driselase and pectolyase in small amounts of
0.5% and 0.2% respectively, greatly increased protoplast yield to 1.1 × 107 protoplasts g-1
FW without compromising viability. It thus suggests that the cell wall of Lolium perenne
contains amounts of pectin and other components such as hemicellulose which have a
significant impact on the release of protoplasts.
In the current study, callus cells and suspension cells with increased accumulation of
starch proved to be a better source for protoplast isolation and subsequent cell divisions
for micro-colony formation. The suspension cells with such high accumulation of starch
48
were compact and nodular (Fig 2.4B, 2.7A Chapter 2). This feature was used as an
important characteristic in identifying protoplast generating callus and cell suspension
tissue suitable for protoplast isolation. This supports similar findings by Gram et al.
(1996) wherein starch accumulation was noted to enhance cell division from pea
protoplasts. Gram et al. (1996) observed a 4 fold increase in the starch accumulation
prior to initiation of cell divisions.
The ultimate aim after the isolation of protoplasts is their regeneration to plants. The
regeneration is controlled by many factors starting from the initial protoplast culture to
the culture of micro and macro protocolonies. Among the 10 cultivars which were used
for protoplast isolation, only protoplasts from cultivar Bronsyn were able to form
protocolonies albeit at a very low frequency (0.15%). Several procedures have been used
for the culture of protoplasts, of which the most common involve the embedding of
protoplasts between sheets of agarose and solidified medium (Shillito et al., 1983), blocks
of semi-solidified medium with embedded protoplasts cultured in conditioned medium
(Kyozuka et al., 1987), culture of protoplasts in the liquid medium and, membrane filternurse culture method (Lee et al., 1989). Of the various methods used, the liquid culture
and membrane filter-nurse culture method yielded positive results. Microcolonies could
be formed when the protoplasts were cultured in LS and PEL media only, using the
liquid culture and the membrane filter-nurse culture method. Colonies formed in the LS
liquid medium could not proceed beyond the 4-5 cell stage. This could be due to the
lack of the stimulating factor which was otherwise provided by the membrane filternurse culture method which resulted in continued divisions of the newly formed cells
resulting in microcolonies. This membrane filter-nurse culture method has also been
demonstrated successfully in other plants such as Brassica species (Christey, 2004). One
of the factors which is affected by the enzyme mixture during isolation of protoplasts is
the actin network. Brière et al. (2004) found that the actin network in freshly isolated
protoplasts was in complete disarray due to the digestion of the cell wall matrix by the
cocktail of enzymes which in turn greatly affects the regenerating ability of the
protoplasts. Pasternak et al. (2002) while working with alfalfa (Medicago sativa) protoplasts
observed that the pH of the liquid medium decreased drastically from 5.8 to 4.8 during
the initial 2 days of protoplasts culture at which time no dividing cells were observed
and the cells were effectively blocked from entering the S phase of the cell cycle. The
successful regeneration of the protoplasts on nitrocellulose membrane could be due to
the shielding of the protoplasts from the pH fluctuation in culture medium. From the
49
data obtained during the isolation procedure of Lolium protoplasts which included
parameters such as enzyme combinations, different osmolarity levels and different
incubation periods, the possibility of pH interfering with the totipotency of Lolium
protoplasts cannot be ruled out.
The very basis of regeneration in tissue cultures is the fact that somatic plant cells are
totipotent and can be stimulated to regenerate into whole plants in vitro, via
organogenesis or somatic embryogenesis, if supplemented with the optimum hormone
level and nutritional conditions (Skoog & Miller, 1957). The difficulties associated in the
culture and regeneration of monocotyledonous species from protoplasts has been
attributed to the genomic changes associated with differentiation (Heseman and
Schröder, 1982). The reduction of regeneration ability and even its loss is a general
phenomenon observed among undifferentiated cell cultures (Jain, 2001). The current
study indicates that protoplast isolation from Lolium perenne can be easily achieved from
different cultivars using enzymatic digestion of cell walls. The protoplast yield changes
with different cultivars perhaps due to differences in the cell wall constitution. In the
current study a plating density of 4-5 × 105 protoplasts/mL was used. The highest
plating efficiency of 0.15% was achieved when the protoplasts were plated on
nitrocellulose membrane with a L. perenne feeder layer on PEL medium. Formation of
protocalli from protoplasts is comparatively low when considered with other plant
species and varies greatly among the different cultivars tested. This could be governed
by genetic make up of the individual plants as seen in the variation observed during
callus induction, shoot regeneration, protoplast isolation and colony formation among
various cultivars (Chapter 2).
Protoplast derived callus colonies of L. perenne cv Bronsyn showed a varied response to
the different PGR during the shoot regeneration experiment. Shoot regeneration was
mostly stimulated at lower concentrations of all the PGRs tested (Table 3.7). The
highest percentage of shoot regeneration was achieved in the presence of 0.1 mg/L 2,4D and 0.1 mg/L BA. Regeneration was also achieved in the presence of low levels of
2,4-D 0.1 mg/L concentration and colonies on control medium with no PGRs did not
show any regeneration. There was no regeneration observed from the protoplast derived
callus colonies from other cultivars. The requirements of PGRs only in small
concentrations might be an explanation of the role of exogenous PGRs as stimulating
agent for endogenous auxin IAA (Indole-Acetic-Acid) which would propel somatic
50
embryogenesis. Michalczuk et al., (1992a, 1992b) while working with carrot cells noted
that exogenous 2,4-D stimulates the accumulation of large amounts of endogenous IAA
and hypothesised that the embryogenic competence of carrot cells was closely
associated with the several fold increase in the endogenous IAA levels.
All the regenerated shoots from protoplast derived callus colonies of L. perenne cv
Bronsyn were albino. There are a number of factors which might effect the regenerating
status of the plants into either a green plant or an albino plant. These could be
environmental or culture conditions. The genotype of the culture plants (Moieni &
Sarrafi, 1995), has been shown to be involved as some cultivars produce high
proportion of albino plants among regenerants while other cultivars produce low
proportions (Löschen-berger & Heberle-Bors, 1992). A high rate of albino culture
(100%) was observed in Triticum durum during microspore culture (Hadwiger &
Heberle-Bors, 1986). Albino plants were also recovered in the previous studies on L.
perenne during regeneration from cell suspension cultures (Wang et al., 2002) and during
regeneration from protoplast derived calli from different cultivars (Wang et al., 1995).
Olesen et al. (1995) also observed albino plants during the somatic in vitro culture
response of L. perenne. The occurrence of albino plants in the current study could be due
to somaclonal variation, which might have resulted in deletions and rearrangements
within the nuclear and the plastid genomes. Such phenomena have been observed in
microspore derived albino wheat (Day & Ellis, 1984; Gülly, 1996; Hofinger, 1999),
barley (Day & Ellis, 1985; Dunford & Walden, 1991; Mouritzen & Bach-Holm, 1994)
and rice (Harada et al., 1991, 1992),
where molecular studies revealed large-scale
deletions and rearrangements in the plastid genome. Ankele et al. (2005) noted that the
causes of an albino phenomenon cannot be related to any single defect, but the
mechanism is more complex since several factors seem to be involved in the formation
of an albino phenotype. The occurrence of albino plants was detected in L. perenne in
1984 (Torello & Symington 1984) but the cause remains unsolved. A systematic
application of new and more sensitive molecular marker techniques might be helpful in
understanding the albino phenomena. The inability of the other cultivars to regenerate
shoots from protoplast derived calli could be due to the accumulation of changes in
genetic make up of the individual cultivars during the callus and cell suspension cultures.
Genotypic influence on levels of tissue culture induced variation has been indicated in
several studies (Mohmand & Nabors, 1990; Puolimatka & Karp, 1993). A thorough
molecular analysis on the different cultivars would help in detecting the level of
51
susceptibility to tissue culture induced variations in the genetic makeup of the different
cultivars.
52
CHAPTER 4
ISOLATION
AND
REGENERATION
OF
LOTUS
CORNICULATUS
PROTOPLASTS
4.1
Introduction
The legume, Lotus corniculatus, is a dicotyledonous species that has been tested as a forage
plant in New Zealand. L. corniculatus (Fig. 4.1) belongs to the family Fabaceae and is a
tetraploid with 2n=4x=24. It is a glabrous to sparsely pubescent perennial plant, though
not a long-lived perennial with a life span of 2-4 years. It shows high persistence and
continued production under moderate soil fertility conditions in the drier high country
regions. More than 300 lines and cultivars have been tested in New Zealand (Scott et al.,
1995). Lotus corniculatus also contains condensed tannins which in feeding studies have
been shown to increase wool production by 18% and milk protein secretion in ewes
(Wang et al., 1996b; Min et al., 1998; 2001). Also, like all legumes, L. corniculatus is a N2
fixing crop, has a lower ratio of cell wall material to cell content and therefore fragments
easily across the leaf blade upon grazing thus increasing its digestibility. It has been
successfully demonstrated that it can be grown in drought prone areas (Duke, 1981; Scott
et al., 1995). These traits makes L. corniculatus a strong contender as a breeding partner
with the more popular forage crop L. perenne. L. corniculatus and L. perenne are widely
divergent taxonomically and conventional breeding between the two species would be
technically impossible. Somatic hybridisation, which has been developed and used
successfully for gene introgression over the past 20-30 years, would be an ideal technique
for the transfer of traits from L. corniculatus to L. perenne. As a prerequisite, isolation of
viable protoplasts from L. corniculatus is absolutely essential for successful progress
towards protoplast fusion between L. perenne and L. corniculatus.
The ability to isolate protoplasts and regenerate them into plantlets provides plenty of
opportunities for crop improvement programmes. The importance of isolation of L.
corniculatus protoplasts has already been demonstrated and utilised successfully for
interspecific and intergeneric fusion for crop improvement (Table 4.1). It provides a
system for protoplast fusion (somatic hybridisation), somaclonal variation and plant
transformation.
53
Protoplast isolation from L. corniculatus has been accomplished from different tissues such
as root, leaves, cotyledons, hypocotyls, and callus (Table 4.1). Regeneration of plantlets
has been achieved from the isolated protoplasts and the protoplasts have been utilised in
successful inter-specific and intergeneric somatic hybridisations.
This chapter examines factors involved in the protoplast isolation, micro-colony
formation and plantlet regeneration of L. corniculatus. Parameters investigated include: the
source tissue, cell wall digesting enzyme combinations, duration of tissue incubation in
the enzyme, osmolarity, methods for micro-colony formation, and the type of growth
hormones used for plant regeneration. The results obtained provide the basis for an
efficient protocol for isolation of protoplasts from L. corniculatus for use in asymmetric
somatic hybridisation with L. perenne protoplasts.
54
Table 4.1 Studies involving the use of Lotus corniculatus protoplasts
Species
Aim
L. corniculatus cv.
Protoplast isolation
Viking
and regeneration
L. corniculatus cv. Leo
Protoplast isolation
Protoplast source
tissue
Reference
Callus
Niizeki & Saito, 1986
Leaves and cotyledons
Webb & Watson, 1991
Etiolated hypocotyls;
Wright et al., 1987
and regeneration
L. corniculatus cv. Leo;
Interspecific fusions
suspension cultures
L. conimbricensis
L. corniculatus cv. Leo
Protoplast isolation
Root hairs
Rasheed et al., 1990
L. corniculatus cv. Leo;
Protoplast fusion
Green cotyledons; cell
Aziz et al., 1990
suspension
L. tenuis
L. corniculatus cv.
Intergeneric fusions
Calli
Nakajo et al., 1994
Intergeneric fusions
Calli
Niizeki et al., 1994
Protoplast isolation
Cotyledons
Vessabutr & Grant,
Viking; Oryza sativa
L. corniculatus cv.
Viking; Glycine max
L. corniculatus cv. Leo;
and regeneration
L. corniculatus cv.
1995
Somatic hybridisation
Calli
Kaimori et al., 1998
Protoplast isolation
Roots
Akashi et al., 2000
Viking
L. corniculatus
and regeneration
55
A
C
B
Figure 4.1 Different stages of Lotus corniculatus development
A: Flowering Lotus corniculatus plant
B: Mature pods of Lotus corniculatus
C: Seeds of Lotus corniculatus Scale: Bar=0.5 mm
56
4.2
Materials and methods
4.2.1
Plant Material
Seeds of Lotus corniculatus cv. Leo (Birdsfoot trefoil) Lot # 8-66292 (Fig 4.1 C) were
obtained from Newfield Seeds Company Ltd., Saskatchewan Canada. Seeds were
germinated in vitro after surface sterilisation with 30% Dynawhite (Jasol, New Zealand)
containing 4.8%+ 0.2 Na-hypochlorite for 20 min, followed by 3 rinses with sterile water.
The seeds were cultured in darkness at 25°C after plating on hormone-free LS medium
(Linsmaier & Skoog, 1965) (0.8% agar) in sterile plastic containers (80 mm diameter × 50
mm high; Vertex Plastics, Hamilton, NZ). After 5 days the germinated seeds were
transferred to light (16h:8h, light:dark) for seedling growth at 25°C. Cotyledons from 4
day old seedlings and the leaves at different stages of plant growth (8 and 12 days old,
post germination) were used during the isolation of the protoplasts to determine an
optimum source for protoplast yield.
4.2.2
Protoplast isolation
Protoplasts were isolated from in vitro grown cotyledons and leaves. Protoplast isolation
was conducted on a rotary shaker (IKA-VIBRAX-VXR, IKA Labortechnik, STAUFEN
Germany) at 40 rpm (20×40cm platform, 7 cm diameter) in the dark at 25°C. The
following cell wall degrading enzymes were evaluated at different concentrations:
Onozuka RS (Yakult Honsha Co., Ltd. Japan): Degradation of cellulose;
Macerozyme R-10 (Yakult Honsha Co., Ltd. Japan) and Pectolyase (SigmaAldrich, USA): Degradation of pectin; and
Driselase (Sigma-Aldrich, USA): Degradation of cellulose, pectin and hemicellulose.
Different enzyme buffers with varying osmolarity (0.4-0.8 M Mannitol) were evaluated for
their effect on protoplast isolation and viability. The enzymes were dissolved in their
respective buffer solutions and filter sterilised through 0.45 µm filter units (Sartorius
Minisart® Vivascience AG, Hannover, Germany). Protoplasts were isolated after
57
incubation at different time intervals (4, 6, 8 h) in order to investigate the effect of
incubation period on the release of protoplasts and their viability.
4.2.3
Protoplast purification
After incubation the protoplast-plant mixture was filtered through a 45 µm nylon mesh.
The protoplast containing solution was then centrifuged at 650 rpm (18 G) for 5 min.
The enzyme solution was discarded and the protoplast pellet was resuspended in isolation
buffer (0.6 M mannitol, 80 mM CaCl2.2H2O, 5 mM MES, pH 5.8). The centrifugationresuspension procedure was repeated three times to remove any traces of enzymes. The
density of the protoplasts was counted using a haemocytometer and the viability was
tested by staining the protoplasts using fluorescein diacetate (FDA) (Pfaltz & Bauer, Inc.,
USA). FDA
(0.2% in acetone) stock was used for staining the protoplasts.
The
protoplasts were then observed under UV. Viable protoplasts were spotted as bright
green whereas no fluorescence was observed with non-viable protoplasts.
4.2.4
Protoplast culture
Different methods and media were evaluated during the culture of L. corniculatus
protoplasts. These included culture of protoplasts in liquid media, culture of protoplasts
by embedding in agarose and culture of protoplasts on nitrocellulose membrane with a L.
perenne feeder layer. (Refer section 3.2.4 for detailed explanation of each method). During
embedding culture the protoplasts at a density of approximately 7-8×104/ml were spread
on already solidified LS medium and warm molten (34°C) LS medium with agarose was
carefully poured over the top for embedding the protoplasts. LS medium, ½ LS medium
and PEL (Pelletier et al., 1983) media were investigated for culture of the protoplasts. The
culture of protoplasts on PEL medium involves a sequential transfer to a series of PEL
media (PEL B, PEL C and PEL E) (Pelletier et al., 1983). The protoplasts were cultured in
darkness at 25°C.
4.2.5
Shoot regeneration
58
The protoplast-derived callus formed was cultured at 25°C and 80 µmolm-2s-1 using cool
white fluorescent tubes (16:8 h light:dark cycle) on LS medium with different
combinations and concentrations of
PGR (plant growth regulators) for shoot
regeneration. The callus was cultured in sterile plastic containers (80mm diameter × 50
mm high; Vertex Plastics, Hamilton, NZ). In each plastic container 5 calli were plated and
a total of 20 calli were plated for shoot regeneration. The experiments were repeated three
times. The number of calli regenerating shoots were counted to determine the percentage
shoot regeneration.
The data collected from the above experiments was subjected to statistical analysis using
the software GenStat-Ninth Edition Version 9.2.0.0. All the experiments were repeated
three times.
59
4.3
Results
4.3.1
Protoplast isolation
4.3.1.1 Protoplast isolaton with different enzyme combinations
Three different enzyme formulations were evaluated for the isolation of L. corniculatus
protoplasts from cotyledons (Table 4.2). Enzyme combination ‘A’ with different types of
cellulases and pectinases released the highest number of protoplasts whereas enzyme
combination ‘C’ consisting of only cellulases failed to produce any protoplasts. Enzyme
combination ‘B’ produced a low number of protoplasts (Table 4.2). After repeating the
experiments three times, ANOVA established that the yield of protoplast varied
significantly between the enzyme combinations (Fs=29.12; df=2, 6; P<0.001). The yield
of protoplasts from enzyme combination ‘A’ was higher then enzyme combination ‘B’
(based on l.s.d.= 2.4 × 106 at the 5% level). The viability of the protoplasts was not
affected by the enzyme combination as high viability was observed with both
combination of enzymes ‘A’ and ‘B’ (based on l.s.d.=7% at the 5% level).
Table 4.2 Yield and viability of Lotus corniculatus cv Leo
protoplasts isolated from cotyledons at different enzyme
combinations
Enzyme
combination
A
Yield × 106 (+ S.E.) g-1
FW
7.3 + 0.6
73 + 4
B
2.3 + 1.7
68 + 3
C
0
0
Viability (%+ S.E.)
S.E. represents standard error of 3 replications
A: Cellulase Onozuka RS 2%, Macerozyme R-10 1%, Driselase 0.5%, Pectolyase 0.2%
B: Cellulase Onozuka RS 2%, Driselase 0.5%, Pectolyase 0.2%
C: Cellulase Onozuka RS 2%, Macerozyme R-10 1%
The tissue was incubated for 6 h in 0.6 M mannitol
60
4.3.1.2
Effect of different tissue types on the isolation of protoplasts
Protoplasts from L. corniculatus were isolated from two different tissue types, viz.
cotyledons and leaves. The two different tissues greatly affected the protoplast yield
(Table 4.3). ANOVA established that there was a highly significant difference in the yield
(Fs=1349.67; df=2, 6; P<0.001) and viability (Fs=59.49; df=2, 6; P<0.001) of the
protoplasts isolated from the different tissue types. Protoplast yield from cotyledons 2-3
days after seed germination were substantially higher when leaves were used as a tissue for
isolation (based on l.s.d.= 0.3 × 106 at the 5% level). Furthermore, the age of the leaf
tissue greatly affected the protoplast releasing ability with 8 day old leaf tissue producing
higher protoplast yield than 12 day old leaf tissue. The majority of the protoplasts isolated
from 12 day old leaf tissue burst upon release. The protoplasts isolated from cotyledons
maintained a spherical shape, 20-50 µm diameter and no damage to internal cell
organelles, such as disintegration of chloroplasts, was observed (Fig 4.2). Also there was
significant difference in the viability of the protoplasts isolated from the cotyledons and
the leaves (8 and 12 days respectively) (based on l.s.d.=10% at the 5% level).
Table 4.3 Protoplast yield and viability from different tissues of
Lotus corniculatus cv Leo
Tissue type
Yield × 106 (+ S.E.) g-1 FW
Viability (%+ S.E.)
Cotyledon
7.1 + 0.2
78 + 6
Leaves (8 days)
2.8 + 0.2
44 + 4
Leaves (12 days) 0.1 + 0.0
41 + 6
S.E. represents standard error of 3 replications,
Enzyme combination ‘A’ (Cellulase Onozuka RS 2%, Macerozyme R-10 1%,
Driselase 0.5%, Pectolyase 0.2%) was used for 6 h in 0.6 M mannitol
61
A
B
Figure 4.2 A and B, Freshly isolated Lotus corniculatus cv Leo protoplasts with
intact green chloroplasts
Scale bar = 20µm.
62
4.3.1.3 Effect of incubation time on protoplast yield and viability
The incubation time showed a highly significant effect on the protoplast yield (Fs=374.07;
df=2, 6; P<0.001) and viability (Fs=33.32; df=2, 6; P<0.001) as was determined by
ANOVA. An incubation time of 4 h resulted in insufficient digestion of the tissue and
cell wall material surrounding the protoplasts resulting in reduced yield but with a high
percentage of viable protoplasts. The optimal incubation period for high protoplast yield
with high viability was 6 h (Table 4.4). With the 8 h incubation period there was a high
yield but with a decrease in the viability of the protoplasts. Protoplast yields obtained after
6 and 8 h of incubation periods were significantly higher (based on l.s.d.=0.7 × 106 at the
5% level). There was no significant difference in the viability of the protoplasts between 4
h and 6 h (based on l.s.d.=9% at the 5% level).
Table 4.4 Yield and viability of Lotus corniculatus cv Leo
protoplasts following different incubation periods
Incubation time (h)
Yield × 106 (+ S.E.) g-1
FW
Viability (%+ S.E.)
4
0.3 + 0.2
81 + 4
6
7.3 + 0.3
76 + 5
8
7.5 + 0.5
52 + 5
S.E. represents standard error of 3 replications
Enzyme combination ‘A’ (Cellulase Onozuka RS 2%, Macerozyme R-10 1%,
Driselase 0.5%, Pectolyase 0.2%) in 0.6 M mannitol was used.
4.3.1.4
Effect of osmolarity on protoplast yield and viability
The results from the osmolarity experiments showed that the L. corniculatus protoplasts
were prone to damage even with a slight variation in the osmolarity level of the enzyme
solution. The protoplast yield and viability were both affected (Table 4.5). ANOVA
results showed that there was highly significant differences in protoplast yield (Fs=32.61;
df=2, 6; P<0.001) and viability (Fs=8.38; df=2, 6; P=0.018) between the osmolarity levels.
The best results were achieved when the osmolarity was maintained at 0.6 M. Isolation of
protoplasts at higher osmolarity (0.8 M) resulted in the bursting of the released
protoplasts (Fig 4.3).
63
Figure 4.3 Lotus corniculatus cv
Leo protoplasts isolated in 0.8 M
osmolarity
When the protoplasts were isolated at 0.4 M osmolarity the released protoplasts were
shrunken with reduced yield. These protoplasts failed to produce cellular divisions and
subsequent formation of micro-colonies. Osmolarity of 0.6 M produced the highest yield
of protoplasts (based on l.s.d.=2.2 × 106 at the 5% level). Furthermore, viability at 0.8 M
osmolarity level was lower than the other two osmolarity levels (based on l.s.d.=13% at
the 5% level).
Table 4.5 Protoplast yield and viability of Lotus corniculatus cv
Leo at different osmolarities
Osmolarity (M)
Yield × 106 (+ S.E.) g-1
FW
Viability (%+ S.E.)
0.4
2.9 + 1.9
62 + 6
0.6
7.4 + 0.2
66 + 5
0.8
0.3 + 0.2
45 + 8
S.E. represents standard error of 3 replications
Enzyme combination ‘A’ (Cellulase Onozuka RS 2%, Macerozyme R-10 1%,
Driselase 0.5%, Pectolyase 0.2%) for 6 h incubation period was used.
64
4.3.2
Protoplast culture and regeneration
The plating efficiency of L. corniculatus protoplasts was greatly affected by the method
used for protoplast culture. The methods used for L. corniculatus protoplast culture were
the same as for L. perenne. The highest percentage of plating efficiency (1.6%) (Table 4.6)
was achieved when protoplasts were cultured using a nitrocellulose membrane with a L.
perenne cell suspension feeder layer on a series of PEL media (Fig 4.4). Protoplasts were
also able to form microcolonies in liquid cultures with LS medium although these
microcolonies failed to grow further into callus. The embedding and bead-type methods
failed to produce any mircocolonies, though first and second divisions were occasionally
observed in these culture methods.
Table 4.6 Plating efficiencies (%+S.E.) of Lotus corniculatus cv Leo protoplasts
with different culture systems and media
Culture type
Liquid
Embedding
Bead-type
Culture
Nitrocellulose
membrane
media
LS
0.1 + 0.0
0.00
0.00
½ LS
0.00
0.00
0.00
PEL
0.00
0.00
0.00
S.E. represents standard error of 3 replications
65
0.2 + 0.1
0.00
1.6 + 0.2
Figure 4.4 Lotus corniculatus cv
Leo microcolonies developing from
protoplasts using the nitrocellulose
membrane-feeder layer technique.
Bar = 0.5mm
The presence of plant growth regulators (PGR) in the culture medium benefited the
shoot regeneration process from callus colonies. Colonies were plated on LS medium
with different combinations of PGR at different concentrations. Low levels of either
auxins and cytokinins initiated shoot formation from the callus colonies (Table 4.7).
Figure 4.5 shows the appearance of buds on callus colonies after 3 months in culture and
shoot regeneration after 4 months in culture. ANOVA established highly significant
interaction between type of growth hormones and their concentrations (Fs=12.40; df=5,
16; P<0.001). Analysis of variance showed that the shoot regeneration from the colonies
was significantly higher at lower concentrations of PGRs (Fs=5.46; df=2, 16; P=0.01).
The highest frequency of shoot regeneration (46%) was observed when auxin and
cytokinin (NAA/BA) in low concentration (0.1/0.1 mg/L) were present (based on
l.s.d.=3% at the 5% level).
66
Table 4.7 Shoot regeneration from protoplast-derived
callus colonies on LS medium with various growth
hormones
Growth
Concentration
Shoot
hormones
(mg/L)
(%)+ S.E
2,4-D
0.1
1.0
BA
regeneration
11 + 1
0
0.1
31 + 3
1.0
11 + 2
Kinetin
0.1
10 + 1
NAA
0.1
26 + 3
2,4-D/BA
0.1/0.1
33 + 2
NAA/BA
0.1/0.1
46 + 2
Control
0
0
S.E. represents standard error of 3 replications of 20 calli
67
A
C
B
D
Figure 4.5 Shoot regeneration of Lotus corniculatus cv
Leo after culture of protoplast-derived callus on shoot
regeneration medium
A. Callus developing shoot buds, 3 months after
protoplast culture. Bar = 1 mm
B. Development of a shoot from 4 months old callus.
Bar = 1 mm
C. Plant regenerating from protoplast derived callus.
D. Roots developing from regenerated plants.
68
4.4
Discussion
The isolation of protoplasts and their regeneration into plantlets can be controlled by
various experimental factors. The results from the present study indicate that the isolation
of L. corniculatus protoplasts was influenced by enzyme combination (Table 4.2), tissue
selection (Table 4.3) and isolation factors such as length of incubation of tissue in the
enzyme (Table 4.4), and the osmolarity of the isolating medium (Table 4.5). The type of
tissue used proved vital in obtaining a high protoplast yield. Cotyledon tissue yielded the
highest number of protoplasts, 7.14×106 g-1 FW, with a viability of 78%. The optimisation
of these variables has lead to an improved yield compared to previous results on L.
corniculatus (Rasheed et al., 1990; Vessabutr & Grant 1995; Akashi et al., 2000). The
protoplast yield achieved here was two times higher than the previous best result (Akashi
et al., 2000). The results from this experimental work suggest that the age of tissue plays a
critical role for high yield and high viability of protoplasts (Table 4.3). The sharp drop in
the protoplast yield isolated from 12 day old leaf tissue (Table 4.3) might be due to the
cessation of cell growth and initiation of secondary cell walls. Further studies on the cell
wall composition at different stages of growth could provide information which might
give a cue to the observed results and indicate what enzymes are required.
Viability of the protoplasts observed in the current study is similar to or slightly lower
than 70-85% viability observed from other L. corniculatus studies (Rasheed et al., 1990;
Vessabutr & Grant 1995; Akashi et al., 2000). This might have been due to the presence
of different enzymes such as Onozuka RS, Macerozyme R-10, Driselase and Pectolyase
which are known to have an harmful effect on the general physiology of the protoplasts.
The enzyme pectolyase has been shown to cause acidification of the cytoplasm in tobacco
cells (Mathieu et al., 1996). Results have also shown that pectolyase leads to responses
such as membrane depolarization, oxidative burst and K+ leakage (Bürdern & Thiel,
1999). Bürdern and Thiel (1999) concluded that enzymatic isolation of protoplasts
irreversibly modifies some of the properties of maize coleoptile cells.
Osmolarity of 0.6 M proved to be optimum for the isolation, survival and further growth
of the cotyledon-derived protoplasts of L. corniculatus. When the protoplasts were isolated
69
at higher or lower osmolarity it might have resulted in physiological imbalance within the
protoplast influencing the regenerating ability of the cells. Niizeki and Saito (1986) were
able to isolate protoplasts at 0.7 M mannitol from callus tissue whereas Rasheed et al.
(1990) were able to isolate stable protoplasts at 0.2 M mannitol from root hairs. In
contrast, in the present study the isolation of stable protoplasts in 0.6 M mannitol from
cotyledons highlights the requirements of different osmotic potentials of cells from
various types of tissues.
The development of micro-colonies from protoplasts was affected by the media chosen
and the method used for protoplast culture (Table 4.6). Culture of protoplasts on
nitrocellulose membrane with a L. perenne feeder layer on a sequential series of PEL
medium was the most successful in this study. In earlier studies KM8P, B5, MS Kao
media with embedding, gellan gum liquid and extra thin alginate film methodologies were
used for the culture L. corniculatus protoplasts (Pati et al., 2005; Akashi et al., 2000,
Vessabutr & Grant, 1995). This is the first report of
L. corniculatus protoplasts
successfully cultured using nitrocellulose membranes with a L. perenne feeder layer on PEL
medium and presents an alternative to the existing methods. The plating efficiencies of L.
corniculatus recorded from this method have exceeded those recorded previously (Aziz et
al., 1990; Pati et al., 2005; Akashi et al., 2000). In the present study only L. perenne cells
were used as the feeder-layer. The use of other cell suspensions especially of L. corniculatus
might have a beneficial effect on the plating efficiency of L. corniculatus protoplasts.
Lotus species have been observed to differ in their requirements of PGRs to induce plant
regeneration from callus (Nenz et al., 1996; Handberg & Stougaard, 1992; Pupilli et al.,
1990; Piccirilli et al., 1988; Nizeki & Grant, 1971). In this research it was observed that
low levels of auxins and cytokinins considerably boosted the chances of obtaining shoots
from the protoplast-derived callus. Also auxins and cytokinins in combination at low
concentration resulted in a high shoot regeneration frequency. This is in line with the
observation made by Handberg and Stougaard (1992) in L. corniculatus. In the research
reported here low levels of 2,4-D (0.1 mg/L) were able to induce shoots from callus at a
low percentage (11%). The response of Lotus to 2,4-D could be species specific as it has
been observed that addition of 2,4-D lead to callus proliferation in L. angustissimus (Nenz
et al., 1996). Further detailed studies of the role of PGRs on regeneration of Lotus species
is needed to develop a more efficient regeneration medium. In conclusion this chapter
70
has provided an efficient protoplast isolation method and a protocol for the regeneration
of plants from the recovered microcolonies of L. corniculatus.
71
CHAPTER 5
ASYMMETRIC
SOMATIC
MONOCOTYLEDONOUS
HYBRIDISATION
LOLIUM
PERENNE
BETWEEN
AND
DICOTYLEDONOUS LOTUS CORNICULATUS
5.1
Introduction
Somatic hybridisation is a tool which has been used in crop improvement programmes
of various crop species such as citrus, potato, rice, brassicas, cereals and also forage
crops (reviewed in Liu et al., 2005). It involves the fusion of protoplasts from the two
species of interest to enable unique combinations of nuclear and cytoplasmic genomes.
In many cases fertile and functional hybrids have been produced, and also cybrids with
unique combinations of chloroplast and mitochondrial genomes with traits such as
herbicide resistance, and cytoplasmic male sterility. Such cybrids have been developed
in earlier studies in citrus (Xu et al., 2004; Vardi et al., 1987) brassicas (Vedel et al., 1986;
Christey et al., 1991), tobacco (Kushnir et al.,1987) and potato (Sidorov et al., 1994).
Intergeneric somatic hybridisation has been conducted using techniques such as
symmetric fusions, asymmetric fusions and microfusion which lead to the formation
of symmetric hybrids, asymmetric hybrids, and cybrids respectively. Protoplast fusion
was first observed by Power et al. (1970) while working with protoplasts of mature
tomato fruit, leaf tissue of tobacco and radish storage root. The first interspecific
somatic hybrids were produced in tobacco (Carlson et al., 1972) employing the
symmetric fusion technique and since then a large number somatic hybrids have been
produced in a number of species. The draw backs of symmetric hybrids has been the
incorporation of total genomes of both parents leading to incorporation of too much
genetic material which can result in genetic imbalance and incompatability. These
could result in possible abnormal growth and development, and low fertility of the
resulting hybrids (Sherraf et al., 1994; Spangenberg et al., 1994; Begum et al., 1995;
Kisaka et al., 1998; Hu et al., 2002; Wang et al., 2003).
In contrast asymmetric fusion allows transfer of partial genomes from one species to
another. Asymmetric fusion between protoplasts is achieved by introduction of the
genomes on a minimised scale. This can be achieved by breaking or fragmenting the
chromosomes of one parent (the donor) using agents such as X-rays or Gamma rays
prior to fusion (Dudits et al., 1980; Lui & Deng 1999; Zubko et al., 2002). UV light has
72
been used more recently because of its easy access and reliable efficiency in causing
chromosomal breakage (Jain et al., 1988; Xia et al., 1996, 1998, 1999, 2003; Zhou et al.,
2001 2002; Cheng & Xia, 2004) and less cost compared to other treatments. In
addition to irradiation, restriction endonucleases, spindle toxin or chromosome
condensation agents have also been used for chromosomal fragmentation (Ramulu et
al., 1994; Forsberg et al., 1998a). The first intergeneric asymmetric hybrids were
reported by Dudits et al. (1980) between X-ray irradiated parsley (Petroselium hortense)
and tobacco protoplasts and since then there have been many reports on asymmetric
somatic hybridisation between many species (Liu et al., 2005).
The somatic hybridisation technique (protoplast fusion) has been used earlier in the
crop improvement programmes of both Lolium species and Lotus species (Table 5.1).
However no previous studies have reported fusion between these species. The fusion
between these two species could lead to the transfer of important traits from Lotus to
Lolium such as increased condensed tannin, lower ratio of cell wall material to cell
content or the drought resistance character which might help in improving Lolium
species. This chapter will focus on the protoplast fusion of Lolium perenne cv Bronsyn
with Lotus corniculatus cv Leo using asymmetric somatic hybridisation technique. The
emphasis is on elucidating the various factors which influence the frequency of
protoplast fusion events between unrelated plant species from very wide taxonomic
origin.
73
Table 5.1 Somatic hybridisation involving Lolium and Lotus species
Parents
Type of fusion
Reference
Lolium, Festuca
Symmetric
Takamizo et al., 1991
Lolium, Triticum
Symmetric
Chen et al., 1992
Lolium, Triticum
Asymmetric
Ge et al., 1997
Lolium, Triticum
Asymmetric
Cheng & Xia, 2004
Lolium Triticum
Asymmetric
Ge et al., 2006
Lolium, Festuca
Asymmetric
Spangenberg et al., 1994, 1995
Lotus, Medicago
Asymmetric
Niizeki, 2001
Lotus, Oryza
Symmetric
Niizeki et al., 1992
Lotus, Oryza
Symmetric
Nakajo et al., 1994
L. Symmetric
Wright et al., 1987
L.
corniculatus,
conimbricensis
Lotus, Glycine
Asymmetric
Kihara et al., 1992
Lotus, Glycine
Symmetric
Niizeki et al., 1994
L. corniculatus, L. tenuis
Symmetric
Aziz et al., 1990
Lotus, Medicago
Asymmetric
Kaimori et al., 1998
74
5.2
Materials and methods
5.2.1
Protoplast isolation of L. perenne cv Bronsyn
Embryogenic cell suspensions, 5-6 days after subculture, were used for isolation of
protoplasts. Protoplast isolation and purification was carried out according to methods
described in sections 3.2.2 and 3.2.3 respectively. The protoplasts were stained with 1
µl of Rhodamine B isothiocyanate (RITC) (Sigma-Aldrich, USA) (5 mg/ml stock
solution prepared in ethanol) during the isolation process (2 h after incubation of
tissue in the enzyme mixture).
5.2.2
Protoplast isolation of L. corniculatus cv Leo
Green cotyledons, 2-3 days after germination, were used for the isolation of Lotus
protoplasts. Protoplast isolation and purification was carried out according to methods
described in sections 4.2.2 and 4.2.3 respectively. The protoplasts were stained with
fluorescein isothiocyanate (FITC) (Sigma-Aldrich, USA) by adding 1 µl from 5 mg/ml
stock solution (prepared in ethanol) during the isolation process.
5.2.3
Inactivation of L. perenne protoplasts
Iodoacetamide (IOA) (Sigma-Aldrich, USA) was used to inactivate L. perenne
protoplasts. The critical IOA concentration was determined by evaluating the response
of various concentrations (0.05-5 mM) at different time intervals (5, 10, 15 min). The
IOA stock solution (20 mM) was made in distilled water and stored at -20°C. The
solution was filter sterilised using 0.45 µm sterile filter units (Sartorius Minisart®
Vivascience AG, Hannover, Germany).
5.2.4
Genome fragmentation of L. corniculatus protoplasts
The effect of UV on L. corniculatus was assayed by visualising DNA of treated and
untreated leaves on agarose gel using gel electrophoresis. DNA was extracted from 1 g
leaf tissue using the CTAB method (Aljanabi et al., 1999). L. corniculatus protoplasts
were treated with different levels of UV to achieve genome fragmentation. A critical
level of UV dosage was identified by treating the protoplasts and leaf tissue with
different levels of UV-B (0.05-0.15 J/cm2) using the BLX-254 UV chamber (Vilber
75
Lourmat, France) at a constant time interval of 15 min. The chamber was illuminated
by 5×8 W 254 nm UV tubes at 80 W power.
5.2.5
Protoplast fusion method
The density of each protoplast type (L perenne and L. corniculatus) was adjusted to
4×104/ml and the two types of protoplasts were mixed together in equal proportions.
A single droplet (100-200 µl) was placed on a flat surface and left to settle for 20 min.
Then 50 µl of PEG solution was added as several droplets along the periphery of the
settled protoplast mixture. After a further 25 and 45 min 2×200 µl CaCl2 solution was
added as several droplets around the periphery of the protoplast and PEG containing
droplet. The excess liquid was removed after a further 10 min and the plate was
flooded with 5 ml LS medium containing 2,4-D/BA (0.1/0.1 mg/L). After 5 days the
developing fusion cells were scrapped off the plate and transferred to nitrocellulose
membrane on a L. perenne feeder layer on PEL and LS media as described in section
3.2.4.
5.2.5.1 Effect of polyethylene glycol
Polyethylene Glycol 6000 (BDH Laboratories, England) and Polyethylene Glycol 3350
(Sigma-Aldrich, USA) was used as the fusion agent (Fusogen) at 3 different
concentrations (30, 35, 40 %) and at 3 different time intervals (20, 25, 30 min). The
PEG solutions were made in Mannitol (0.6 M), CaCl2.2H2O (0.13M), MES (5 mM), at
pH 6.
5.2.5.2 Effect of surface type and calcium chloride concentration
To study the effect of different surfaces - plastic, glass and nitrocellulose membrane the fusions were conducted on either plastic Petri dishes (60 mm, BioLab, USA), glass
Petri dishes (50×15 mm, Kimax, USA) and on nitrocellulose membrane (0.8 µm
gridded, Millipore, USA) placed in a plastic Petri dish. To study the effect of Ca+ ion
concentration on the fusion frequency, addition of calcium chloride (in 0.6 M
mannitol, 5 mM MES at pH 7.0) at 3 different concentration (60, 80, 100 mM) for 3
durations (30, 40, 50 min) was investigated.
76
5.2.6
Observation of fusion products
The protoplast fusion events were observed and confirmed under the UV microscope.
Lolium perenne protoplasts which were stained with RITC fluoresced red while L.
corniculatus protoplasts, stained with FITC stained yellow. The fused protoplasts
resulting from the fusion of L. perenne and L. corniculatus protoplasts fluoresced
yellowish orange. The fusion percentage was calculated as:Fusion (%)= Mean # of fusions/no of protoplasts × 100
Analysis of variance was performed on the data obtained using the software GenStatNinth Edition Version 9.2.0.0.
5.2.7
Culture of fused protoplasts and formation of protoplast fusion colonies
The fused protoplasts were cultured using the combination of liquid and nitrocellulose
membrane feeder layer technique used for L. perenne protoplasts. Following the fusion
of the protoplasts the fusion plates were flooded with 5 ml liquid LS medium
containing 1 mg/L 2,4-D, 0.4 M mannitol. The Petri dishes with protoplast fusions
were cultured in darkness at 25°C. After 5 days the protoplast fusion mass was
transferred to nitrocellulose membrane feeder layer technique on PEL and LS medium
(section 3.2.4).
5.2.8
Shoot regeneration from protoplast fusion colonies
The putative protoplast fusion colonies were plated on L. perenne shoot regeneration
medium with 2,4-D/BA at 0.1/0.1 mg/L concentrations. For rooting the regenerated
shoots were plated on LS medium supplemented with NAA/BA at 0.1/0.1 mg/L
concentrations. The regenerated plants were transferred to green house in plastic pots
after a transition phase of 1 week covered with plastic bags.
77
5.2
Results
5.3.1
Inactivation of Lolium perenne protoplasts with iodoacetamide (IOA)
The protoplasts isolated from L. perenne were subjected to treatment with IOA for
metabolic inactivation. A range of concentrations (0.05-5 mM) at different time
intervals (5-15 min) were investigated to determine the lethal concentration for the
protoplasts (Table 5.2). It was observed that 1 mM IOA resulted in 0% viability of the
protoplasts at all time intervals (Table 5.2). The IOA treatment at 0.1 mM for 15 min
was considered to be the critical treatment for metabolic inactivation of the L. perenne
protoplasts as 45% viability was retained with no regeneration of protoplasts observed,
even after 4 weeks in culture.
Table 5.2 Viability of Lolium perenne cv Bronsyn protoplasts treated with IOA
(mean%+ S.E.)
Time
IOA Concentration (mM)
0
0.05
0.1
1
5
82 + 8
76 + 3
55 + 4
0
10
NT
78 + 5
45 + 2
0
15
NT
58 + 4
45 + 4
0
(min)
S.E.= Standard error for 3 replications; NT: Not tested; Viability was tested by staining the protoplasts
with FDA
5.3.2
UV
treatment
of
Lotus corniculatus
protoplasts
for
genome
fragmentation
Figure 5.1 demonstrates the fragmentation of the L. corniculatus leaf DNA after UV
treatment. The DNA treated with 0.15 J/cm2 UV failed to appear as a band in Lane G
even though the same amount of DNA was loaded in all lanes. The appearance of the
DNA band in lanes E and F demonstrates the failure of DNA degradation following
UV treatment at 0.05 and 0.1 J/cm2. Lane D represents untreated DNA.
L. corniculatus protoplasts when treated with UV showed decreasing viability with
increasing UV level. The critical level of UV for L. corniculatus protoplasts at which the
78
highest efficiency in genome fragmentation was observed as shown by protoplast
viability was 0.15 J/cm2 with the viability of the protoplasts reduced to 22% compared
to 71% with no UV treatment (Table 5.3). A further increase in the UV level to 0.2 J/
cm2 resulted in death of all protoplasts (Table 5.3).
79
Figure 5.1 Gel image of UV treated
Lotus corniculatus cv Leo
cotyledons DNA.
Lanes A-C λHinDIII ladder at 1000, 500 and
250 ng; lane D Untreated DNA; lane E DNA
treated at 0.05 J/cm2; lane F DNA treated at
0.1 J/cm2, lane G DNA treated at 0.15
J/cm2. All treatments were for 15 min.
Table 5.3 Viability of Lotus corniculatus cv
Leo protoplasts treated with UV for 10 min
UV level (J/ cm2)
Viability (%)+ S.E.
0
71.3 + 6.03
0.05
59.6 + 2.52
0.1
45.6 + 5.13
0.15
22.3 + 5.13
0.20
0
S.E. represents standard error of 3 replications; viability
was tested by staining the protoplasts with FDA.
80
5.3.3
Protoplast fusion
5.3.3.1 Protoplast fusion at different levels of PEG concentration
The fusion protoplasts could be clearly distinguished from the unfused protoplasts due
to the use of the fluorescent markers RITC and FITC that were used to stain L. perenne
and L. corniculatus protoplasts respectively (Fig 5.2). Protoplast fusions between L.
corniculatus and L. perenne were conducted at 3 different levels of PEG and with 2
different molecular weights. These results indicate that the lower molecular weight
PEG (3350) yielded higher fusion frequencies than higher molecular weight
PEG(6000) (Table 5.4). Analysis of variance established that there was no interaction
between concentration of PEG, molecular weight of PEG and treatment of the
protoplasts (Fs=0.60; df=2, 24; P=0.555). There was a significant difference in the
percentage fusion obtained between low molecular weight PEG and high molecular
weight PEG (Fs =4.84; df=1, 24; P=0.03). When the fusions performed with treated
protoplasts were compared with fusions performed with untreated protoplasts, no
significant difference was observed (Fs=1.97; df=1, 24; P=0.173). There was
significant difference in the fusion percentage observed at different concentrations of
PEG (Fs=20.25; df=2, 24; P<0.001). A PEG MW of 3350 at 35% resulted in the
highest fusion frequency (based on l.s.d.=0.02%, at the 5% level). During fusions with
lower PEG concentration it was observed that on addition of the calcium chloride
solution following PEG treatment the protoplasts separated from each other. At
higher percentage of PEG (40%) high coagulation between protoplasts was observed.
81
Figure 5.2 Protoplast fusion between Lolium perenne and Lotus corniculatus
A.
Red Lolium perenne and yellow Lotus corniculatus protoplasts stained
with RITC and FITC fluorescent stains respectively
B.
Protoplast fusions (heterokaryons) between Lolium perenne and Lotus
corniculatus. (Arrows)
Table 5.4 Fusion frequency between Lolium
perenne and Lotus corniculatus at different PEG
concentrations with different molecular weight
PEG
Concentration
(MW)
Untreated
(%)+ S.E.
Treated (%)+
S.E.
30% (3350)
0.06 + 0.02
0.03 + 0.01
35% (3350)
0.14 + 0.02
0.15 + 0.03
40% (3350)
0.18 + 0.05
0.13 + 0.01
30% (6000)
0.09 + 0.02
0.08 + 0.02
35% (6000)
0.07 + 0.01
0.07 + 0.03
40% (6000)
0.15 + 0.02
0.14 + 0.02
S.E. represents standard error of 3 replications.
Percentage fusion was calculated as
Fusion (%)= Mean # of fusions/no of protoplasts × 100
Fusions were counted using fluorescent markers FITC and RITC
Treated fusions: L. perenne protoplasts were treated with 0.1 mM
IOA, 10 min and L. corniculatus protoplasts were treated with 0.1
J/cm2 for 15 min. The protoplasts were treated with PEG for 30
min on a plastic surface.
82
5.3.3.2
Effect of duration of PEG treatment on fusion frequency
Increasing the duration of PEG treatment resulted in the shrinking of protoplasts on
addition of the calcium chloride solution. Decreased PEG treatment (20 min) resulted
in the separation of the protoplasts on addition of calcium chloride solution thereby
resulting in a decreased fusion percentage. When the data was subjected to statistical
analysis (ANOVA), no significant interaction was observed between the main effects
(Fs=0.00, df=2,12, P=0.996) and no significant difference was observed between
treated and untreated fusions (Fs=1.23; df=1, 12; P=0.29). In contrast, PEG treatment
resulted in highly significant differences on fusion frequency (Fs=14.85, df=2,12,
P<0.001). The experiment suggests that the duration of the PEG treatment of 25 min
or longer results in a higher number of protoplast fusion events (based on
l.s.d.=0.04% at the 5% level).
Table 5.5 Fusion frequency after PEG treatment at different time intervals
PEG treatment
(min)
20
Untreated fusions
(% + S.E.)
0.07 + 0.03
Treated fusions
(% + S.E.)
0.06 + 0.01
25
0.18 + 0.05
0.16 + 0.02
30
0.15 + 0.03
0.13 + 0.02
S.E. represents standard error of 3 replications
Percentage fusion was calculated as
Fusion (%)= Mean # of fusions/no. of protoplasts × 100
Fusions were conducted with 35% PEG(3350) and counted using fluorescent markers FITC and RITC
Treated fusions: L. perenne protoplasts were treated with 0.1 mM IOA for 10 min and L. corniculatus
protoplasts were treated with 0.1 J/cm2 for 15 min. Fusions were conducted on a plastic surface.
83
5.3.3.3 Effect of different surface types on the frequency of fusions
Three different surfaces were investigated in this study and it was shown that the
fusion percentage was greatly affected by the surface type used. It was determined that
the glass surface was the least amenable for performing fusions between L. perenne and
L. corniculatus. Analysis of variance proved that there was no significant interaction
between the surface type and treatment of the protoplasts (Fs=1.43; df=1, 8; P=0.266).
The fusion data obtained for glass and plastic surface type between treated and
untreated fusions confirmed that there was a significant difference in the number of
fusions between the two surface types (Fs=45.16; df=1, 8; P<0.001). There was a 3-4
fold increase in the fusion events when the fusions were performed on a plastic
surface. The highest percentage fusion (0.20% and 0.15%, untreated and treated
fusions respectively, Table 5.6) was observed on sterile plastic Petri dishes. Data could
not be obtained from fusions on the nitrocellulose membrane due to the opaque
nature of the membrane. It was observed during the experiments that on the glasssurface the protoplast droplet tends to spread over the area covered by the drop on
the addition of the PEG solution whereas on a plastic surface on addition of PEG the
droplet stayed more compact which might have enhanced the fusion percentage.
Table 5.6 Fusion frequency between Lolium perenne and Lotus corniculatus
with different surface types
Surface type
Glass
Untreated fusions
(% + S.E.)
0.05 + 0.01
Treated fusions
(% + S.E.)
0.05+ 0.03
Plastic
0.20 + 0.03
0.15+ 0.04
S.E. represents standard error of 3 replications
Percentage fusion was calculated as
Fusion (%)= Mean # of fusions/no. of protoplasts × 100
Fusions were conducted with 35% PEG(3350) for 25 min and counted using fluorescent markers FITC
and RITC;
Treated fusions: L. perenne protoplasts were treated with 0.1 mM IOA, 10 min and L. corniculatus
protoplasts were treated with 0.1 J/cm2 for 15 min.
84
5.3.3.4 Effect of calcium chloride treatment on the fusion frequency
Three different calcium chloride concentrations and 3 different treatment durations
were investigated for their effect on the fusion frequency. Analysis of variance showed
a significant interaction between calcium chloride concentration and the duration of
treatment (Fs=4.48; df=4, 18; P=0.01). It was observed that the calcium chloride
concentration (Fs=76.39; df=2, 18; P<0.001) and treatment duration (Fs=4.99; df=2,
18; P=0.01) had a significant effect on the fusion frequency. For all treatment
durations 100 mM calcium chloride gave the better results, with the highest fusion
frequency of 0.16% recorded at 40 min treatment (based on l.s.d.=0.02% at the 5%
level). It was also noted that the binding between the protoplasts was stronger at the
highest calcium chloride concentration (100 mM) (Fig 5.3) whereas at lower
concentrations and decreased time intervals disassociation of protoplasts took place.
Table 5.7 Fusion frequency (% + S.E.) between Lolium perenne and Lotus
corniculatus at different concentrations and durations of CaCl2 2H2O
CaCl2 2H2O
treatment (min)
CaCl2 2H2O Concentration (mM)
60
80
100
30
0.06 + 0.02
0.04 + 0.01
0.10 +0.01
40
0.04 + 0.01
0.06 + 0.02
0.16 + 0.02
50
0.06 + 0.01
0.05 + 0.01
0.14 + 0.02
S.E. represents standard error of 3 replications;
Percentage fusion was calculated as Fusion (%)= Mean # of fusions/no. of protoplasts × 100;
Fusions were conducted with 35% PEG(3350) for 25 min and counted using fluorescent markers FITC
and RITC
Treated fusions: L. perenne protoplasts were treated with 0.1 mM IOA, 10 min and L. corniculatus
protoplasts were treated with 0.1 J/cm2 for 15 min. Fusions were conducted on a plastic Petri dish
surface.
85
A
B
Figure 5.3 Effect of calcium chloride concentration on protoplast fusion
A: Protoplasts dissociating from each other at 60 mM CaCl2 concentration
B: Protoplasts held together at 100 mM CaCl2 concentration; Bar = 100 µm
86
5.3.4
Fusion colony formation and shoot regeneration
Protoplast fusion experiments using PEG were conducted at the optimum conditions
derived after evaluating the different factors vital for the asymmetric protoplast fusions
(Table 5.8). Fusion colonies were formed on nitrocellulose membrane with feeder
layer technique on PEL medium. A total of 14 fusion colonies were recovered from 99
fusion experiments. The unfused protoplasts of L. perenne failed to develop due to the
metabolic inactivation of the protoplasts. Fusion colonies failed to regenerate from
untreated fusion events. Preliminary morphological analysis of the fusion colonies
formed revealed that they resembled the regenerated L. corniculatus protocolonies (Fig
5.4). The controls [individual L. perenne and L. corniculatus protoplast treated with IOA
(0.1 mM, 10 min) and UV (0.1 J/cm2 15 min)] failed to develop any protocolonies on
PEL medium. A detailed flow cytometric and molecular analyses of the fusion
colonies follows in Chapter 6.
Table 5.8 Optimum levels of different factors for the asymmetric protoplast
fusion between Lolium perenne and Lotus corniculatus
Factors
Optimum level
IOA for L. perenne
0.1 mM for 15 min
UV for L. corniculatus
0.15 J/cm2 for 10 min
PEG Molecular weight
3350
PEG Concentration
35%
PEG Duration
25 min
Calcium chloride concentration
100 mM
Calcium chloride duration
40 min
Surface type
Plastic
87
Figure 5.4 Protoplast-fusion colonies between Lolium perenne and Lotus
corniculatus 6 weeks after fusion.
All the 14 putative fusion colonies were plated on shoot regeneration medium
optimised for L. perenne. Shoot regeneration occurred in 8 out of the total 14 putative
fusion colonies. Shoot regeneration was seen after 6-7 weeks culture on shoot
regeneration medium. Surprisingly, the shoots regenerated in all of the 8 putative
fusion colonies resembled L. corniculatus plants (Fig 5.5).
Figure 5.5 Shoot regenerated from putative fusion colony
Roots developed when the shoots were plated on LS medium with NAA/BA 0.1/.01
mg/L concentration (Fig 5.6) for 4 weeks. The shoots and roots were allowed to grow
to a size of 5cm before being transferred to the green house. Figure 5.7 shows the
88
putative hybrid plants developed alongside the L. corniculatus parent. The putative
hybrid plants had the same morphology as L. corniculatus plants developed both from
callus and seeds with regard to its branching pattern, leaf shape and size and the root
system.
Figure 5.6 Root formation from shoots of the putative hybrid colonies
89
FC4
FC5
I
Putative fusion hybrid plants
II
Lotus corniculatus plants
Figure 5.7 Transfer and growth of in vitro putative hybrid and Lotus
corniculatus plantlets
FC4 & FC5 Putative fusion hybrid plants
I
Lotus corniculatus plant regenerated from callus
Lotus corniculatus plant regenerated from seeds
II
90
5.4
Discussion
The technique of asymmetric protoplast fusion has been utilised in many crop species
for introgression of beneficial traits from one parent to the other (Table 5.1)
presenting an option to integrate genes not possible using the conventional method of
breeding. The first asymmetric protoplasts fusions were produced between X-ray
irradiated parsley (Petroselium hortense) protoplasts and tobacco protoplasts (Dudits et al.,
1980).
The rationale behind the metabolic inactivation of L. perenne protoplasts is that, only
those protoplasts which have been fused and complimented for the metabolic activity
by L. corniculatus protoplasts would regenerate, thus effectively eliminating the
regenerating possibility of individual L. perenne protoplasts. This underlying principle
has been proved by several authors for asymmetric somatic hybridisation in other
crops using IOA as the metabolic inactivator (Spangenberg et al., 1994; Kisaka et al.,
1994; Kaimori et al., 1998; Tian & Rose, 1999; Yan et al., 2004). It has been observed
that the IOA concentration for metabolic inactivation varies for different grasses
(Table 5.9).
Table 5.9 IOA concentration used previously for different grasses
Species
IOA(mM)
Time(min)
Reference
Lolium perenne
0-7
Not stated
Creemers-Molenaar et al., 1992
Festuca arundinacea
10
15
Spangenberg et al., 1994
Oryza sativa
10
15
Kisaka et al., 1994
Oryza sativa
2.5
Not stated
Yan et al., 2004
Triticum aestivum
2-4
15
Ge et al., 2006
Factors which influence fusion between two protoplasts differ for different plants. The
results from this chapter show that many factors play a pivotal role in the outcome of
the protoplast fusions between L. perenne and L. corniculatus. These include: UV
treatment for genome fragmentation and IOA concentration for inactivation of parent
protoplasts, PEG molecular weight, PEG concentration, type of the surface used
91
during fusion experiments and calcium chloride concentration and duration. In the
current study the results from the metabolic inactivation using IOA suggests that 1
mM concentration of IOA was lethal for L. perenne protoplasts. The failure of the
protoplast to regenerate when treated with 0.1 mM IOA for 10 min while retaining
45% viability provides a stringent treatment for the metabolic inactivation of L. perenne
protoplasts. The IOA concentration and treatment duration observed in the current
study for metabolic inactivation of L. perenne protoplasts is well below the range
observed by other authors in other grasses (Table 5.9).
UV has been frequently used successfully as the genome fragmenting agent because of
convenience and easy access in most laboratories (Jain et al., 1988; Xia et al., 1996;
Zhou et al., 2002; Xiang et al., 2003; Cheng & Xia, 2004). Hall et al. (1992) working with
sugarbeet (Beta vulgaris L.) protoplasts observed more chromosome breakage in the
UV-treated cells than gamma-irradiated cells at the same biological dosage. It has also
been shown that UV radiation at doses which does not have an immediate effect on
the cell viability, brings about extensive structural modifications to the plant DNA
(Hall et al., 1992). This suggests that UV is a potential agent for use in asymmetric
somatic hybridisation. In the current study to test the UV dosage for genome
fragmentation, the leaf tissue of L. corniculatus was treated at different levels of UV.
When gel electrophoresis of treated and untreated DNA was performed, a high
molecular weight DNA band could not be detected at UV treatment of 0.15 J/cm2 in
the treated leaf tissue samples(Fig 5.1). Such DNA bands were observed at treatments
lower than 0.15 J/cm2. This is due to the disintegration of DNA at 0.15 J/cm2 and
establishes a UV dose to effectively fragment the L. corniculatus DNA for the purpose
of asymmetric somatic hybridisation.
From previous published work on plant protoplast fusion in various crop species, it is
evident that optimum protoplast fusion is controlled by various factors such as PEG
molecular weight, PEG percentage, duration of PEG treatment, concentration and
duration of calcium chloride treatment. The use of PEG in the fusion of plant
protoplasts was first demonstrated by Kao & Michayluk (1974) for fusion between
Vicia hajastana and Pisum sativum protoplasts. Since then, numerous successful studies
using PEG to enhance fusion in various crop species have been published. Results in
this study show that molecular weight, and concentration of PEG treatment
significantly influenced the fusion between L. perenne and L. corniculatus protoplasts (Fig
92
5.3). The highest fusion percentage was achieved when L. perenne and L. corniculatus
protoplast fusions were performed with 35% PEG (3350 Mol. Weight) for a duration
of 25 min. The results are in contrast to the observations made by Durieu & Ochatt
(2000) wherein no significant differences were noted between the high and low
molecular weight PEG during the protoplast fusion of pea (Pisum sativum L.) and grass
pea (Lathyrus sativus L.). It thus indicates that different cell types from different crops
might be responding differently to PEG type and treatment.
The involvement of calcium in the fusion of bilayer membranes is a universal
phenomenon (Duzgunes et al., 1981; Papahadjopoulos, 1978). The presence of calcium
ions generally enhances the process of protoplast fusion (Kao et al., 1974; Kao &
Michaylak, 1974). In this study calcium chloride had a profound effect on the outcome
of the fusions between L. perenne and L. corniculatus. The number of fusions
(heterokaryons) formed increased substantially when protoplast fusion were carried
out at 100 mM calcium chloride (Table 5.7). The results strongly support the findings
of Boss & Mott (1980) which reveal that high calcium concentrations could lead to
dramatic alteration of membrane structure due to the calcium binding to
phospholipids (Nagata & Melchers, 1978) or to glycolipids (Leonards & Haug, 1979)
on the membrane surface which is necessary for membrane fusions. The low
percentage of fusions observed in all the fusion experiments could also be attributed
to the fusion permissive-state of the protoplasts wherein intracellular calcium plays a
decisive role which is governed by the role of the calcium binding protein calmodulin
in the cellular biochemistry (Grimes & Boss, 1985).
This study has established for the first time that the surface on which protoplast fusion
are carried out can greatly influences the formation of heterokaryons. The frequency
of the recovery of heterokaryons between L. perenne and L. corniculatus
was
substantially higher on plastic surface compared with glass surface (Table 5.6).This
could be true for other species as well. More studies on the effect of surface type could
result in increasing the protoplast fusion efficiency and lead to better protocols for
fusion and regeneration of micro colonies.
The outcome of the fusion experiments between L. perenne and L. corniculatus has been
the development of putative somatic hybrid colonies (Fig 5.6) with subsequent
regeneration of putative somatic hybrid plants from some of the putative hybrid
93
colonies. The anticipated result was the recovery of asymmetric hybrids with L. perenne
recipient genome and minor DNA introgressions from the L. corniculatus donor parent.
The hybrid colonies were able to proliferate on PEL medium which was the optimal
medium for the proliferation of L. perenne protoplasts (Refer Chapter 3, Table 3.6).
Despite this, the plants regenerated from these colonies resemble L. corniculatus. This
could be due to the fact that the L. corniculatus plants were able to produce shoots on
wide variety of PGRs (Table 4.7 Webb & Watson, 1991; Vessabutr & Grant, 1995;
Rasheed et al., 1990; Aziz et al., 1990).
Earlier studies have established a high rate of success in asymmetric somatic
hybridisation wherein traits from the donor plants have been incorporated into
recipient plants using different genome fragmenting agents such as UV, X-rays and Ύrays. The results in the present study that the putative hybrid plants resemble the
donor parent is therefore unexpected.
The possible explanation for such an event to occur results in the formulation of 2
hypothesis.
I.
The regenerated putative hybrid plants are the donor (Lotus
corniculatus) parent that have escaped the UV treatment, and therefore not
putative hybrid plants.
II.
The regenerated putative hybrid plants are cybrid plants regenerated
from the fusion of escaped donor (L. corniculatus) and recipient (L. perenne)
with some incorporation of cytoplasmic organelles from the recipient parent.
Sidorov et al. (1981) observed that after PEG fusion of gamma-irradiated protoplasts
of N. tabacum with iodoacetate treated protoplasts of N. plumbaginifolia, 60% of the
regenerated plants had nuclear genetic material from the irradiated cells. Also
Creemers-Molenaar et al. (1992) found that high concentrations of iodoacetamide (5-7
mM) was essential to prevent the division of auto-fused iodoacetamide treated
protoplasts in the presence of autofused irradiated protoplasts. In the current study
0.1 mM of iodoacetamide used for inactivation of L. perenne. In earlier works it has
been observed that no chromosome elimination occurred when the donor was treated
with 10Gy X-rays, while 85-100% chromosomes were lost when the dose was
increased to 500Gy (Spangenberg et al., 1994). Forsberg et al. (1998a) also observed
that the outsourcing of DNA in asymmetric somatic hybridisation is dose-dependent
94
using UV- or X-irradiation. This suggests that the UV dosage used in this study might
have been insufficient for the total genome fragmentation in some of the protoplasts
resulting in the “possible” escapes from the UV treated L. corniculatus. The effectivity
of the UV dosage might be cell type specific which in this case might have resulted in
“escapes”.
The results from this chapter thus highlight the complexities involved in establishing
the optimal conditions for performing protoplast fusions. Such optimisation may be
more complicated when two wide divergent species such as Lotus corniculatus and
Lolium perenne are used. Chapter 6 describes the flow cytometric and molecular analysis
to help elucidate the nature of the plants regenerated.
95
Chapter 6
MOLECULAR
ANALYSIS
OF
ASYMMETRIC
FUSION
PRODUCTS
BETWEEN LOLIUM PERENNE AND LOTUS CORNICULATUS
6.1
Introduction
As much as visual confirmation of the fusion products is a need for identification of the
fusion events, molecular analysis of the fusion products using molecular markers truly
gives an in depth knowledge of the fine details of events that might have occurred
during the fusion process. Molecular analysis techniques such as Amplified Fragment
Length Polymorphism (AFLP) (Holme et al., 2004), Restriction Fragment Length
Polymorphism (RFLP) (Spangenberg et al., 1994), Random Amplified Polymorphic
DNA (RAPD) (Hansen & Earle, 1994), Cleaved Amplified Polymorphic Sequence
(CAPS) (Lotfy et al., 2003) hold a key in the genetic analysis of the somatic hybrids.
These techniques have been routinely applied in the confirmation of hybrid status.
Detection of the ploidy level using flow cytometry also gives an indication of the status
of the regenerated fusion plants (Hu et al., 2002). However, detection of the ploidy level
using flow cytometry alone is insufficient to identify somatic hybrids in a reliable
manner (Liu et al., 2005). This chapter focuses on the molecular marker analysis of the
putative hybrid colonies using SD-AFLP.
Amplified Fragment Length Polymorphisms (AFLPs) are Polymerase Chain
Reaction(PCR) -based markers for rapid screening of genetic diversity which rapidly
generate hundreds of highly replicable markers from DNA of any organism. The time
and cost efficiency, replicability and resolution of AFLPs are superior or equal to those
of other markers (RAPD, RFLP, microsatellites) (Mueller & Wolfenbarger, 1999).
Genetic analysis of the somatic hybrids generated from protoplast fusions using AFLP
technique has been reported in earlier studies (Barone et al., 2002; Holme et al., 2004; Ge
et al., 2006). In this study Secondary Digest-Amplified Fragment Length Polymorphism
(SD-AFLP, Knox & Ellis, 2001) was used to screen the regenerated fusion products to
aid in detecting their hybridity status. SD-AFLP is methylation insensitive thus
eliminating the possibility of variable amplification of bands due to variable DNA
methylation which may occur using conventional AFLP (Knox & Ellis, 2001).
This chapter also investigates high fidelity whole genome amplification (WGA) using a
novel technique Strand Displacement Amplification (SDA) for plants. SDA is a new
96
approach which has been used for WGA of DNA from humans (Lasken & Egholn,
2003) and arbuscular mycorrhizal fungi (Gadkar & Rillig, 2005). It permits whole
genome amplification from pg to µg level, and does not suffer from the drawbacks of
the traditional PCR based WGA. SDA employs the ø29 DNA polymerase instead of
Taq polymerase, which generates double-stranded products, allowing subsequent DNA
sequencing of either strand (Fig 6.1), restriction endonuclease digestion and other
methods used in cloning, labeling and detection (Dean et al., 2001). Furthermore, ø29
polymerase possesses 3′-5′ exonuclease proofreading activity which produces higher
fidelity amplified DNA as compared to Taq DNA polymerase, the standard enzyme
used in most PCR reactions (Blanco et al., 1989). The SDA technique for amplification
of DNA using Genomiphi® (Amersham Biosciences USA) has been recently used for
cattle semen samples (Hawken et al., 2006) and in the cDNA amplification of hexaploid
wheat (Bottley et al., 2006). In this study a GenomiPhiTM V2 DNA Amplification Kit
(GE Healthcare UK) was used for the amplification of DNA from very small fusion
colonies for molecular analysis.
In this chapter the application of molecular techniques such as SD-AFLP, chloroplast
microsatellite markers, SCAR (Sequence Characterised Amplified Regions) markers and
ploidy analysis are used to resolve the hybrid status of the fusion colonies regenerated in
Chapter 5.
97
Figure 6.1 Strand Displacement amplification using
phi29 DNA polymerase. (Refer GE Healthcare;
http://www4.gelifesciences.com/APTRIX/upp01077.nsf/Con
tent/genome_illustra_redirect~genomiphi_work).
98
6.2
Materials and methods
6.2.1
Ploidy analysis
The ploidy analysis was carried out using a Partec flow cytometer (Partec Ploidy
Analyser PA-II, Partec Münster, Germany) using a halogen lamp (HBO-100).
Approximately 1 cm2 of tissue was chopped in a plastic Petri dish containing 0.4 ml of
Extraction buffer (100 ml deionised water, 2.1 g citric acid., 0.5 g Tween 20) followed by
addition of staining solution (100ml deionised water, 7.1g Na2HPO2.2H2O, 0.5ml DAPI
stock). The samples were then filtered through a 30 µm filter (Partec, Celltrics) before
loading into the flow cytometer. Trifolium pratense and Hieracium leaf tissue were used as
internal standards when analysing all samples.
6.2.2
Genomic DNA extraction
The total genomic DNA from the fusion-derived colonies, the protocalli of the parental
lines and the regenerated plants was extracted using the CTAB (Cetyl Trimethyl
Ammonium Bromide) method (Aljanabi et al., 1999). Tissue samples (7-10 mg) from 3
month old protocalli developed from the fusion colonies was used for the extraction of
DNA. L. perenne genomic DNA was extracted from leaf tissue and from the cell
suspension used as a source for protoplast isolation. L. corniculatus genomic DNA was
extracted from regenerated protocalli as well as from leaf tissue. Genomic DNA was
also extracted from regenerated putative hybrid plants and regenerated L. corniculatus
plants from protocalli.
6.2.3
Amplification of genomic DNA
Whole genome amplification of the genomic DNA extracted from fusion-derived
protocolonies and the parents, L. perenne and L. corniculatus, was conducted using the
strand displacement amplification technique. GenomiPhiTM V2 DNA Amplification Kit
(GE Healthcare UK) was used for the amplification as per the manufacturer’s
instructions. An aliquot of 0.5 µl template containing 1-4 ng DNA was used for
amplification in a 5 µl reaction mixture at 30°C for 1.5 h. The amplification was
conducted using an Eppendorf Master Cycler (Eppendorf, Hinz GmbH, Hamburg,
Germany). The amplified products were visualised following electrophoresis on a 1%
agarose gel.
99
6.2.4
SD-AFLP analysis
Secondary Digest Amplified Fragment Length Polymorphism (SD-AFLP) (Knox &
Ellis, 2001) analysis was conducted on the amplified genomic DNA of fusion derived
protocolonies and the parents L. perenne and L. corniculatus.
6.2.4.1 SD-AFLP template preparation
Preparation of SD-AFLP template was based on the method previously described by
Knox & Ellis (2001). Adaptors and primers used for template preparation are listed in
Table 6.1. Genomic DNA (0.5 µg) was digested with 5 U of MseI (New England
Biolabs) in 50 µl reactions containing 1X restriction/ligation (RL) buffer (10 mM Trisacetate pH 7.5, 10 mM magnesium acetate, 50 mM potassium acetate, 5 mM DTT) and
1X bovine serum albumen (New England Biolabs) at 37oC for 16 hours. The digested
genomic DNA was diluted with 10 µl of ligation mixture containing 1X RL buffer, 50
pmol of annealed MseI adaptor 1 and MseI adaptor 2, 12 nmol of ATP and 1 U T4
DNA ligase (Roche) and incubated at 37°C for 4 hours, followed by incubation at 4°C
for 16 h. The resulting template was diluted with 440 µl of T0.1E (10 mM Tris, 0.1 mM
EDTA) at pH 8.0 and 2 µl were used in 20 µl PCR reactions containing 1X supplied
reaction buffer (Roche), dNTPs at 200 µM, 7.5 pmoles of MseI adaptor 1 as nonselective MseI primer, and 1 U of Taq polymerase (Roche). PCR conditions (hereby
referred to as AFLPPRE) were as previously described (Vos et al., 1995) for primers
with no or one selective base, using an Eppendorf Master Cycler (Eppendorf, Hinz
GmbH, Hamburg, Germany). Following amplification of product, 5 µl were digested
with 20 U of PstI (New England Biolabs) in 50 µl as described above for MseI digestion,
followed by dilution with 10 µl of ligation mixture containing 5 pmol of annealed PstI
adaptor 1 and PstI adaptor 2, as described above for MseI adaptor ligation. Template was
diluted with 440 µl of T0.1E pH 8.0 and 4 µl was amplified by PCR was used in 25 µl
reactions containing 1X supplied reaction buffer (Roche), each dNTP at 200 µM, and
primers PstI+N and MseI+N (where N represents A and G as selective bases) at 2.5
ng/µl, using the cycling regime AFLPPRE. The resulting template was diluted to 100 µl
which was further used for selective amplification.
100
Table 6.1 The oligonucleotide adaptors and primers used for SD-AFLP template
preparation
Oligonucleotide name
Oligonucleotide Sequence (5´-3´)
MseI adaptor 1
GACGATGAGTCCTGAG
MseI adaptor 2
TACTCAGGACTCAT
PstI adaptor 1
CTCGTAGACTGCGTACATGCA
PstI adaptor 2
TGTACGCAGTCTAC
MseI+R1
GACGATGAGTCCTGAGTAAR1
PstI+R1
GACTGCGTACATGCAGR1
MseI+NNN2
GACTGCGTACATGCAGNNN2
R1 represents A or G
NNN2 represents selective primer with either GGG, GGA, AGG, AGA, AGT, AAA, AAT, AAG, ATA,
ATG, ATT.
6.2.4.2
Selective amplification and analysis using genetic analyser
The DNA template generated from AFLPPRE PCR regime using selective bases A and
G was used for selective amplification. The 1.2 µl DNA template was diluted with 10.8
µl of buffer mixture consisting of 1.2 µl 10X supplied reaction buffer (Roche), 0.24 µl
200µM dNTPs, 0.12 µl of 0.6 U of Taq polymerase (Roche), selective primers, 0.3 µl of
fluorescently labelled PstI+G+FAM (15 ng) and 0.36 µl MseI+NNN (18 ng) (Refer
Table 6.1 for selective primer sequence). The reaction mixture was preheated to 94 oC
for 3 min, cycled for 9 cycles at 94°C for 30 s, 65°C for 30 s and 72 °C for 1 min
followed by 9 cycles where the annealing temperature was decreased by 1°C per cycle
and then 25 cycles at 94°C for 30 s, 56°C for 30 s and 72°C for 1 min (PCR cycling
regime AFLP-SELE). Profiles generated were visualised by adding 1 µl of labelled
reaction to 10 µl of HiDi formamide (Applied Biosystems), denaturing for 5 min 95°C,
and running on an ABI PRISM®3100 Genetic Analyser (Hitachi Corp., Japan) fitted
with a 36 cm array filled with POP4 polymer. Data was analysed by the software
package GeneMarker™ (Ver 1.4) and scorable markers were identified visually.
101
6.2.4.3 SD-AFLP band isolation
Selective amplification of the markers identified by the selective primers was conducted
using the method described above (section 6.2.4.2) with the exception that the Primer
PstI+G was devoid of fluorescent label FAM. The PCR product generated from AFLPSELE after heat denaturation was loaded on to a Polyacrylamide Gel for gel
electrophoresis (PAGE) followed by silver staining of the gel (see Appendix 6 for
PAGE and silver staining prodecure). The bands were cut and isolated using a sterile
blade and were dissolved in T0.1E buffer. The selected marker bands were amplified
using selective amplification (Section 6.2.4.2) with respective selective primers. The
bands were purified using MinElute Gel Extraction Kit (Qiagen) according to
manufacturer’s instructions and used for cloning.
6.2.5
Cloning and sequencing
TOPO TA cloning kit (Invitrogen) was used for cloning the chosen marker bands. A 6
µl cloning reaction was set up according to the manufacturers instructions by using 2 µl
of the PCR template generated from the selective amplification of chosen marker bands
with respective selective primers. One Shot®Chemically Competent E. coli supplied
along with the cloning kit was used for transformation. The transformed E. coli cells
were plated on LB (Luria-Bertani) medium containing 50 µg/L ampicillin and 40µL Xgal stock solution
(20 mg/ml dimethylformamide). White colonies were picked for
PCR analysis using M13 Forward and Reverse primers supplied along with the kit. The
results were visualised using gel electrophoresis. The amplified products were purified
using a HiPure (Roche) purification kit according to the manufacturers instructions. The
purified products were sequenced through Macrogen DNA Sequencing Service
(Department of Biochemistry and Molecular Biology, Seoul National University College
of Medicine, Seoul, Korea).
6.2.6
Application of SCAR (Sequence Characterised Amplified Region)
The sequences obtained from Macrogen DNA Sequencing Service were screened for
SCAR markers. The online Primer3 (ver. 0.4.0) software (http://frodo.wi.mit.edu/) was
used for designing the primers. A total of 3 SCAR markers were designed (Table 6.2).
102
The amplifications were conducted using an Eppendorf Master Cycler (Eppendorf,
Hinz GmbH, Hamburg, Germany) with an initial 5 min denaturation at 95°C followed
by 35 cycles each with a 1 min denaturation at 95°C, 1 min at a primer specific annealing
temperature (Table 6.2) and a 1 min extension at 72°C followed by a final extension at
72°C for 10 min. The 10 µL reaction mixture consisted of 10× reaction buffer (Roche),
2 mM MgCl2, 0.625 mM dNTPs, 0.25 µM of each primer, 0.75 U Taq DNA polymerase
(Roche) and 10 ng template DNA.
Table 6.2 SCAR markers designed using Primer3 software
Primer sequences Forward(5´-3´) and
SCAR marker
Tm (°C)
Reverse(5´-3´)
FC4AAT(200)
FC11AGA(100)
FC11AAG(100)
6.2.7
Size
(bp)
Forward
AAGTGTTCGATACAAGTTAGAAGCAA
59.81
Reverse
TTACAATGGGTGCGTGTGTC
60.44
Forward
TCCTGAGTAAAGAAAGAAAAA
51.36
Reverse
GTACATGCAGGACCGATGG
59.93
Forward
GGTGCACTAGACGAGAAAAGC
59.14
Reverse
CCTGAGTAAAAGATGATCGTG
54.98
152
102
100
Chloroplast microsatellite marker analysis (Simple Sequence RepeatsSSR) of the fusion colonies and the parents
Analysis using 5 chloroplast microsatellite markers (cpSSR) (Table 6.3), developed for L.
perenne (McGrath et al., 2006), was conducted with the genomic DNA from the
regenerated fusion colonies and the parents. The amplifications were performed using
an Eppendorf Master Cycler (Eppendorf, Hinz GmbH, Hamburg, Germany) with an
initial 5 min denaturation at 95°C followed by 35 cycles each with a 1 min denaturation
at 95°C, 1 min at a primer specific annealing temperature (Table 6.3) and a 1 min
extension at 72°C followed by a final extension at 72°C for 10 min. The 10 µL reaction
mixture consisted of 10× reaction buffer (Roche) 2 mM MgCl2, 0.625 mM dNTPs, 0.25
µM of each primer, 0.75 U Taq DNA polymerase (Roche) and 10 ng template DNA.
103
Table 6.3 cpSSR primer sequences as per McGrath et al. (2006)
cpSSR
marker
GenBank Accession
no.
Primer sequences Forward(5´-3´) and
Reverse(5´-3´)
Ta
(°C)
TeaSSR1
DQ123586
60
TeaSSR3
DQ123585
TeaSSR4
L41587
TeaSSR5
AF363674
TeaSSR7
X53066
ATTGATTTGGGTTGCGCTAT
TCATTAAAGAAAATTGAGGGCATA
AGGGACTTGAACCCTCACAA
GCAAACGATTAATCATGGAACC
ACGAACGAACGATTTGAACC
TGAAGCCCCAATTCTTGACT
GCTATGCATGGTTCCTTGGT
TTCCTACTACAGGCCAAGCAG
GGAATTTGCAATAATGCGATG
TCGATCGAGGTATGGAGGTC
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
104
60
60
60
60
Size
range
(bp)
217230
305318
193200
209212
172173
6.3
Results
6.3.1
Ploidy Analysis
The results generated from the ploidy analysis on the putative hybrid fusion colonies
and the parents indicate that the putative hybrid fusion colonies were representative of
the L. corniculatus genome. The profiles of the fusion colonies generated from the flow
cytometric analysis matched with profile generated by protocalli of L. corniculatus. (See
Appendix 2 for profiles generated from the ploidy analysis of further fusion colonies
and parents). The genome size of L. perenne and L. corniculatus was estimated to be 4.16
pg and 2.10 pg respectively. The genome size of all the fusion colonies was found to
fluctuate between 1.88 pg and 2.39 pg which is close to the diploid parental species of
L. corniculatus (Table 6.4). The results thus indicate that there has not been any significant
addition of genomic material from L. perenne.
Table 6.4 Genome size of fusion
colonies as detected from the flow
cytometric analysis
Plant
Genome size
(pg DNA/2C nucleus)
Lolium perenne
4.16
Lotus corniculatus
2.10
FC2
2.32
FC3
2.39
FC4
2.02
FC5
2.00
FC6
2.18
FC7
1.97
FC8
1.93
FC9
2.00
FC10
1.91
FC11
1.89
FC12
1.95
FC13
2.04
FC14
1.97
105
However, fusion colonies (FC2, FC3, FC4, FC5 and FC11) showed tetraploid peaks in
addition to diploid peaks. Ploidy peaks of the plants subsequently regenerated from the
fusion colonies FC3, FC5, and FC14 were similar to those of L. corniculatus, whereas
FC4 showed a prominent tetraploid peak (Fig 6.2).
Figure 6.2 Ploidy levels of Lotus corniculatus (Left) and fusion colony FC4
(right)
106
6.3.2
Whole Genome Amplification of fusion colonies
The use of the high fidelity Whole Genome Amplification method with the application
of Strand Displacement Amplification technique resulted in a 300-400 times
amplification of very small (1-4 ng) amounts of DNA isolated from the fusion-derived
colonies (Fig 6.3).
Figure 6.3 Whole Genome Amplification of small protoplast fusion colonies with
GenomiPhiTM V2 DNA Amplification Kit using the SDA technique. Lanes 1-3, λ
H3 ladder at 1000, 500 and 250 ng; lanes 4-11, non-amplified genomic DNA from
fusion micro-colonies; lanes 12-19, SDA amplified Genomic DNA from fusion
micro-colonies using templates from samples illustrated in lanes 4-11
respectively; lane 20, control DNA (Lambda) for Genomiphi V2 DNA
Amplification Kit.
To confirm the high consistency of amplification across the whole genome, SD-AFLP
analysis was then performed on non-amplified DNA samples from the parent plants
and amplified products of micro-colonies of both parents and from the fusion microcolonies. The image developed by the Genetic Analyzer from the SD-AFLP products
performed using amplified DNA (GenomiPhiTM V2) and non-amplified DNA on L.
corniculatus and L. perenne, showed identical SD-AFLP band profiles in both types of
samples which implies that the amplified genome is a representative of the entire
genome (Fig 6.4).
107
Figure 6.4 SD-AFLP profile of
amplified and non-amplified Lotus
corniculatus, Lolium perenne and
fusion colonies generated using
PstI+G and MstI+G/AC selective
primers. Lane 1 non-amplified Lolium
perenne; Lane 2 amplified Lolium
perenne; Lane 3 non-amplified Lotus
corniculatus; Lane 4 amplified Lotus
corniculatus; Lanes 5-7 amplified
putative fusion colonies. (Figures on
the left indicate fragment size in bp)
6.3.3
Chloroplast Microsatellite Marker analysis
Analysis from the 5 cpSSR markers developed for L. perenne and other grasses, did not
produce any bands with the fusion colonies. TeaSSR4 and TeaSSR5 were found to be
universal for L. perenne, L. corniculatus and the fusion products. TeasSSR1, TeaSSR3 and
TeaSSR7 failed to produce bands with fusion colonies and L. corniculatus and were
specific only for L. perenne (data not shown).
108
6.3.4
SD-AFLP analysis
Each of the 11 pairs of selective primers generated over 50 bands during the screening
of the genomic DNA of the samples. The bands generated by the genomic DNA of
fusion colonies were 99% identical to the bands generated from L. corniculatus genomic
DNA.
A total of 5 SD-AFLP specific polymorphic bands were identified from 8 individuals,
fusion colonies (FC1-FC5, FC11, FC13) that were not present in the parental L.
corniculatus (Table 6.5). Some of the bands were present in more than one fusion colony.
Interestingly, three of these bands were also present in L. perenne. The SD-AFLP bands
GGA(500) and GGA(400) were found present in fusion colonies FC1-FC5 and L.
perenne (Fig 6.5, Inset 1 and Inset 2). The appearance of the same band in five
independent fusion colonies is unexpected. Sequences obtained from directing
sequencing of GGA(500) and GGA(400) of L. perenne and FC1, when subjected to
BLAST
(Basic
Local
Alignment
Search
http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/information3.html)
Tool,
against
NCBI database were found to have homology with Lotus japonicus genomic DNA
sequence. This similarity with L. japonicus sequence from NCBI database suggests that
the band sequence of GGA(500) and GGA(400) from L. perenne had homology with
Lotus japonicus sequence.
The SD-AFLP polymorphic band AAT(200) was 200 bp in size and was found specific
to FC4 and L. perenne. Sequence data from AAT(200) of L. perenne when subjected to
BLAST search against NCBI database, an identity match of 81% of Lotus japonicus
genomic DNA, chromosome 4 (NCBI accession number: AP006140.1) and an identity
match of 88% with Oryza sativa mRNA (NCBI accession number: NM_001064308.1)
was observed. The BLAST search for the AAT(200) sequences between L. perenne and
FC4 had 100% identity, which suggests the integration of L. perenne fragment into FC4
hybrid plant as a consequence of asymmetric somatic hybridisation.
The SD-AFLP polymorphic band AGA(100) of FC11 and FC13 and the polymorphic
band AAG (100) of FC11 were novel bands which were absent in the SD-AFLP profile
of L. corniculatus and L. perenne and were 100 bp in size. Sequences obtained from bands
AGA(100) of FC11 and FC13 had 100% identity with each other after a BLAST search
against each other with 0 gaps. The sequence of FC11 when subjected to BLAST search
109
against NCBI database an identity match of 83% with Oryza sativa genomic DNA,
chromosome 7 (NCBI accession number: AP008213.1) was observed and an identity
match of 86% of L. japonicus genomic DNA, chromosome 6 (NCBI accession number:
AP004511.1). Sequences obtained from marker AAG (100) of FC11 when subjected to
BLAST search against NCBI database an identity match of 77% with Lotus japonicus
genomic DNA chromosome 4 (accession number: AP006369.1) was observed. No
homology was observed to any sequence from monocotyledonous plants.
Figure 6.6 shows gel electrophoresis of the different SD-AFLP bands reamplified using
the respective SD-AFLP selective primers prior to purification and cloning.
Table 6.5 SD-AFLP markers identified from different selective SD-AFLP primers
AFLP Primers
Plants
AGA
L.
corniculatu
s
FC1
FC2
FC3
FC4
FC5
FC6
FC7
FC8
FC9
FC10
FC11
FC12
FC13
FC14
AG
T
×
AG
G
×
×
×
×
×
×
×
×
×
GG
G
×
×
×
×
×
×
×
×
×
√(500)*
√(400)*
×
×
×
×
×
×
×
×
×
×
√(500)*
√(400)*
×
×
×
×
×
×
×
×
×
×
√(500)*
√(400)*
×
×
×
×
×
√(200)*
×
×
×
×
√(500)*
√(400)*
×
×
×
×
×
×
×
×
×
×
√(500)*
√(400)*
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
√(100)
×
×
×
×
√(100)
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
√(100)
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
×
AAA
AAT
AAG
ATA
ATG
ATT
GGA
GGA
×= no polymorphic bands observed; √= band not present in lotus. *= Bands present in L. perenne; figures
in parenthesis indicate size (bp) of the bands
110
A
Inset 1
In
set 2
Figure 6.5 SD-AFLP analysis of fusion products PstI+G/ MseI+NNN selective
primers. Inset 1 and Inset 2 highlight the bands generated from selective primer
MseI+GAA and MseI+GGA respectively.
Lane 1, Lolium perenne; Lane 7, Lotus corniculatus; Lanes 2-6 Fusion colonies
FC1-FC5
111
650
500
400
300
200
100
Figure 6.6 SD-AFLP polymorphic bands reamplified
using selective primers AAT, AGA and AAG. Lane 1:
1kb plus ladder; Lane 2: FC13; Lane3: FC4; Lane4: Lotus
corniculatus; Lane5: Lolium perenne; Lane6: FC13;
Lane7: FC11; Lane8: Lotus corniculatus; Lane9: Lolium
perenne; Lane10: FC13; Lane11: FC11; Lane12: Lotus
corniculatus (figures on left indicate band size)
112
6.3.5 Analysis using Sequence
Amplified Regions (SCARs)
Characterised
The SCAR marker FC4AAT(200) which was developed from the SD-AFLP band
AAT(200) of FC4 and which showed complete homology with AAT(200) from L.
perenne, failed to recognise the band in the genomic DNA fromFC4 callus, FC4
regenerated plant as well as L. perenne suspension cells and L. perenne plant. However, it
was able to detect a band from genomic DNA of L. corniculatus seed derived plant (Fig
6.7). The other SCAR markers FC11AGA(100) and FC11AAG(100) were able to detect
bands from their respective clones only.
1
2
3
4
5
6
7
8
9
Figure 6.7 Amplification of SCAR markers.
Lane 1 Lolium perenne AAT(200) cloned
sequence; Lane 2, FC4 AAT(200) cloned
sequence; Lane3, FC4 callus DNA; Lane4,
FC4 plant DNA; Lane5, Lolium perenne
suspension DNA; Lane6, Lolium perenne
Leaf DNA; Lane7, Lotus corniculatus leaf
DNA; Lane8, Control without template;
Lane9, 1Kb plus ladder.
113
6.4
Discussion
The plants regenerated from the fusion events between L. perenne and L. corniculatus were
morphologically the same as those of L. corniculatus (Fig 5.7 Chapter 5). Cell fusion
followed by regeneration does not always guarantee transfer of nuclear or cytoplasmic
genomes (Rose et al., 1990) which could influence the morphology of the regenerated
plants. Cai et al. (2007) while working with Festuca arundinacea and Triticum aestivum
observed active methylation alterations between hybrids and the recipient F. arundinacea.
The choice of methylation insensitive AFLP approach using SD-AFLP (Knox & Ellis,
2001) would eliminate variable amplification of bands due to methylation.
The ploidy analysis results with all the putative hybrid colonies proved that all the
putative hybrid colonies and plants regenerated thereafter were diploids except for FC4
which showed tetraploid peak during analysis with callus colonies and regenerated
plants. In the current study, wherein the resultant fusion products (eg. fusion colony
FC4) represents the donor plant (L. corniculatus) might have been due to the instability of
the DNA damage caused by UV treatments. Xu et al. (2007) observed that UV
irradiation was not able to fragment the DNA in all protoplasts which resulted in
escapes within the population. Chromosome elimination due to irradiation can also be
influenced by several other internal and external factors such as genotypes, phylogenetic
relativity between fusion parents, and physiological status of the explants used for
protoplast isolation (Liu et al., 2005; Oberwalder et al., 1997, 1998; Xiang et al., 2003).
Furthermore, DNA repair after UV irradiation might have been responsible for
restoration of cells without chromosome loss in L. corniculatus. It has been observed that
plant cells have evolved certain strategies such as NER (Nucleotide Excision Repair)
and photo reactivation for DNA repair caused due to UV damage in order to maintain
normal cell functioning (Ishibashi et al., 2006).
The application of the novel technique of Whole Genome Amplification using strand
displacement amplification have truly solved the problem of analysing the status of the
hybrid colonies while they were still in the nascent stage. When the SD-AFLPs were
performed using amplified DNA (GenomiPhiTM V2) and non-amplified DNA on L.
corniculatus and L. perenne, identical AFLP band profiles were generated with both types
of samples which implies that the amplified genome is a representative of the entire
genome. The band intensity was greater in the SD-AFLP profile generated using SDA114
amplified samples than the non-amplified samples (Fig 6.4). No addition or deletion of
bands was observed between the amplified and non-amplified samples. Some of the
corresponding bands are not completely visible in Figure 6.4 due to the low intensity of
the bands. We demonstrate here that SDA for WGA using ø29 polymerase is an
excellent method for amplifying minute quantities of DNA in a very short time (<2 h).
It allows highly accurate and comprehensive whole genome amplification from microsamples of plant tissue. SDA therefore provides template for rapid and early
determination of the hybrid status of the fusion micro-colonies between plant species
using various molecular analysis such as AFLPs and other molecular techniques where
high quality genomic DNA is needed. In this manner SDA will be greatly useful to
overcome the paucity of sample tissue and help save valuable
DNA for further
molecular and genetic analysis (Raikar et al., 2007).
Analysis of the fusion colonies using the L. perenne specific chloroplast microsatellite
markers did not yield bands with fusion colonies. However, markers TeaSSR4 and
TeaSSR5 were found to be universal with bands seen in fusion colonies as well as both
the parents. The absence of bands in the fusion colonies with some of the L. perenne
specific chloroplast microsatellite markers suggests no chloroplast transfer had occurred.
Parental chloroplasts segregate during callus development and in most cases the
regenerated hybrid plants have only one chloroplast type (Akada & Hirai, 1986). It was
earlier assumed that chloroplast segregated randomly or rarely recombined in somatic
hybridizations (Derks et al., 1992, Donaldson et al., 1994; Skarzhinskaya et al., 1996).
Kanno et al. (1997) observed evidence for the recombination of chloroplast DNA in
higher plants is limited. Furthermore, nuclear background can also influence chloroplast
or mitochondrial segregation (Sundberg & Glimelius, 1991). Liu et al. (2005) noted that
the effect of nuclear background on cytoplasmic segregation depends on the species or
combinations.
The molecular analysis performed in this chapter on the putative somatic hybrids was
undertaken to try and resolve the origin of the regenerants. The occurrence of 5 SDAFLP specific polymorphic bands between the parents and the fusion colonies suggests
that introgression of genetic material from L. perenne to L. corniculatus had occurred. The
SD-AFLP band profile of fusion colony FC4 revealed L. perenne specific band AAT(200)
which was found to be absent in the SD-AFLP band profile of L. corniculatus.
115
The appearance of the SD-AFLP bands GGA(500) and GGA(400) in all the fusion
colonies FC1-FC5 suggests that both these bands are Lotus bands. Moreover, when a
BLAST search was conducted on the sequences obtained from these bands they showed
homology with L. japonicus sequence.
The SD-AFLP bands AGA(100) and AAG(100) observed in FC11 and FC13 were
absent in either of the parents. The presence of these additional SD-AFLP polymorphic
bands in FC11 and FC13 could be due to the somaclonal variation which occurs very
prominently in tissue culture (Jain, 2001). The somaclonal origin of these new bands
could be due to mutational events such as gene conversion, unequal crossing-over, etc.,
which could be responsible for any gain or loss of restriction sites and consequently for
the lack of parental bands and the appearance of new ones (Arcioni et al., 2000). Such
occurrence of additional bands has been observed in other studies such as during
somatic hybridisation between common wheat and Italian ryegrass (Cheng & Xia, 2004),
asymmetric somatic hybridisation between the annual legumes Medicago truncatula and
Medicago scutellata (Tian & Rose, 1999), and is somatic hybrids between tetraploid
Medicago sativa and Medicago falcata (Crea et al., 1997).
The SCAR analysis has revealed interesting results. Presence of the FC4AAT(200)
marker band in L. corniculatus plant genomic DNA and its absence FC4 callus and FC4
plant when the SCAR marker itself was designed from a unique cloned FC4 SD-AFLP
sequence is puzzling. The absence of the band in FC4 callus and plant could be due to
the prolonged culture.
To summarise, protoplast fusions between the monocotyledonous L. perenne and
dicotyledonous L. corniculatus were able to successfully regenerate plants which were
morphologically L. corniculatus like. The success of the fusion could be limited by the
compatibility of the nuclear and cytoplasmic genomes. Protoplast fusions in the current
study points towards wide number of possibilities of genome interactions
(rearrangements and/or recombinations) between both cytoplasmic and nuclear
genomes. More molecular analysis such as screening of more mitochondrial and
chloroplast markers, and application of additional techniques such as Genomic In Situ
Hybridization (GISH) in order to locate the miniscule introgression would be required.
The theory number 1 formulated in chapter 5 that ‘The regenerated Putative Hybrid
116
Plants are the donor (Lotus corniculatus) parent that have escaped the UV
treatment, and therefore not putative hybrid plants’ attains significance.
117
CHAPTER 7
CONCLUDING DISCUSSION
7.1
Background
Plant breeding for improvements in cultivated plants has been aided in recent years with
more result oriented techniques such as Marker Assisted Selection (MAS) (Collard &
Mackill 2008) and plant transformation using techniques such as Agrobacterium-mediated
gene transfer (Gelvin, 2003) or direct DNA uptake methods such as electroporation or
biolistics (Petolino, 2002). However, the plants produced using these transformation
approaches are classified as transgenic crops, which means they fall under strict
regulations controlling their release for use in agriculture (Nap et al., 2003). The general
public throughout the world have also voiced their opposition towards using transgenic
plants in agriculture (Conner et al., 2003; Nap et al., 2003). This has prompted
researchers to investigate other methods for gene transfer which are not restricted by
regulations.
An alternative approach to the transfer of novel genes for plant improvement involves
the use of somatic hybridisation technique (Spangenberg et al., 1995a; Takamizo et al.,
1991). In most countries applications of somatic hybridisation are not covered by
regulations. Somatic hybridisation involves the fusion of protoplasts (naked cells) from
two plants of interest. Somatic hybridisation allows DNA introgression from very
diverse species with the merger of the cytoplasmic and the nuclear contents resulting in
hybrid plants (Davey, 2005). In some cases it facilitates the breeding process over the
conventional technique and has been able to produce hybrid plants successfully on
numerous previous occasions (Creemers-Molenaar et al., 1992a; Spangenberg et al., 1995;
Yan et al., 2004).
The breeding of Lolium perenne using traits from Lotus corniculatus with the application of
somatic hybridisation technique would help in understanding the reliability of this
method for gene introgression between very wide species.
Somatic hybridisation
technique was previously used to demonstrate fusion of protoplast between rice (Oryza
sativa) and carrot (Daucus carota) and between barley (Hordeum vulgare) and carrot (D.
carota) (Kisaka et al., 1994, 1997).
118
7.2
Thesis overview
The current project was focused on somatic hybridisation between monocotyledonous
L. perenne and dicotyledonous L. corniculatus for gene introgression. L. corniculatus is a N2
fixing crop, has a lower ratio of cell wall material to cell content and therefore fragments
easily across the leaf blade upon grazing increasing its digestibility and palatability value.
It has been successfully demonstrated that it can be grown in drought prone areas
(Duke, 1981; Scott et al., 1995). Gene introgression from L. corniculatus to L. perenne using
somatic hybridisation could lead to the transfer of useful traits such as resistance to
drought, increased digestibility, and for increased nitrogen fixing ability. Somatic
hybridisation is a well established biotechnological tool which has been used in the
breeding of various crop plants to integrate useful traits (Davey et al., 2005). In this
thesis the application of asymmetric somatic hybridisation technique was successfully
implemented between two widely related plant species L. perenne and L. corniculatus. To
achieve the goal of asymmetric somatic hybridisation between L. perenne and L.
corniculatus for gene introgression, a systematic planning and implementation pathway
was necessary. Chapter 2, Chapter 3, Chapter 4, Chapter 5 and Chapter 6 of this thesis
detail the implementation of the various steps towards the final outcome.
Establishment of a culture system such as callus or cell suspension cultures which would
provide a regular supply of tissue material is one of the most important steps for
protoplast isolation. Lolium perenne is a well established forage crop with a number of
cultivars. Chapter 2 in this thesis details the methods involved in setting up an in vitro
culture system and the response of the different L. perenne cultivars towards the in vitro
culture systems. This was important to select appropriate genotypes among the elite
commercial cultivars. Tissue culture response in 10 different commercial cultivars of L.
perenne with respect to callus induction and plant regeneration was investigated. Cultivar
‘Bronsyn’ proved to be superior amongst all the screened cultivars. Cultivar Bronsyn
along with cv Canon had the highest callus induction frequency of 36% whereas cv
Aberdart had the lowest callus induction frequency of 2% (Chapter 2, Fig 2.2). The
response of the different cultivars towards PGRs during plant regeneration, the
variation between cultivars in the frequency of shoot regeneration (Table 2.2) and the
frequency of albino shoot formation from callus further reflects the genetic variation for
these traits in L. perenne. The changes leading to albino plant formation in somatic in vitro
culture are not known, but studies with perennial ryegrass reveal a large genotypic
119
influence on albino plant frequencies (Olesen et al., 1995). The screening of some of the
elite commercial cultivars for their tissue culture responses in this study have brought to
the fore the genetic differences and has been helpful in selecting the highly responsive
cultivar cv Bronsyn as an elite L. perenne genotype with excellent tissue culture attributes.
The aim of this thesis has been somatic hybridisation between monocotyledonous L.
perenne and dicotyledonous L. corniculatus. Isolation of totipotent protoplasts from
established cell cultures and shoot regeneration was one of the important steps in
achieving this goal. Chapter 3 details the methods used and the results obtained during
the isolation of L. perenne protoplasts and shoot regeneration from protoplast-derived
calli. Screening of different source of tissues during protoplast isolation revealed that the
cell suspensions were the most appropriate source of tissue for protoplast isolation
(Chapter 3 Table 3.1). The formulation of enzyme mix significantly influenced the
outcome of protoplast isolation from L. perenne. Enyzme combination ‘A’ (Cellulase
Onozuka RS 2%, Macerozyme R-10 1%, Driselase 0.5%, Pectolyase 0.2%) yielded the
highest number of protoplasts (Chapter 3 Table 3.2) without compromising the viability.
The need for the presence of different enzymes such as Cellulase Onozuka RS,
Macerozyme R-10, Driselase, and Pectolyase for the release of a high number of
protoplasts suggests complexities involved within the cell wall components of L. perenne.
Other parameters such as duration of incubation in the enzyme mix and osmolarity
(Chapter 3 Table 3.3, Table 3.4) had a significant effect on the yield and viability of the
protoplasts. The influence of cultivars on protoplast isolation was also determined.
Cultivar Bronsyn and cv Impact had the highest protoplast yields whereas cv Arrow had
the lowest protoplast yield (Chapter 3, Table 3.5). During colony formation from the
protoplasts certain biological processes might have an influence on the totipotency of
the protoplasts. For example, the exposure to chemical factors during the culture of the
protoplasts on a feeder-layer using a nitro-cellulose membrane. Shoot regeneration from
protoplast-derived calli indicates that PGRs at low levels are necessary for initiation of
somatic embryogenesis (Chapter 3 Table 3.6). These low levels of PGRs may have
induced a stimulatory response from endogenous IAA as has been observed in earlier
works (Michalczuk et al., 1992a, 1992b). The failure of the protoplast-derived calli to
regenerate into green plants could be due to the somaclonal variation which might have
resulted in deletions or rearrangements within the nuclear and/or plastid genomes.
Hadwiger &
Heberle-Bors (1986) observed similar responses while working with
Triticum durum wherein 100% albino plants were obtained.
120
Lotus corniculatus protoplast isolation was an important step in achieving the goal of this
thesis. Chapter 4 deals with the isolation and regeneration of L. corniculatus protoplasts.
Different parameters which influence the isolation and regeneration of L. corniculatus
protoplasts were investigated viz., enzyme combination, tissue types, incubation periods,
osmolarity levels, different regeneration methods and effect of different PGRs. In the
current study, out of the 3 enzyme combinations tested, enzyme combination ‘A’
(Cellulase Onozuka RS 2%, Macerozyme R-10 1%, Driselase 0.5%, Pectolyase 0.2%)
produced the highest number of protoplasts although the viability noted was either
similar or slightly lower than those observed in earlier studies (Chapter 4 Table 4.2). The
experiment with different types of tissues as a source for protoplasts proved vital in
obtaining high protoplast yield. Cotyledon tissue yielded the highest number of
protoplasts (Chapter 4 Table 4.3), which was 2 times higher than previous studies
recorded (Akashi et al., 2000). A sharp drop in the yield was observed when protoplasts
were isolated from 12 day old leaf tissue. Isolation of protoplasts at different osmolarity
levels and at different incubation times were helpful in setting the optimum osmolarity
levels and incubation time intervals. The development of micro-colonies from L.
corniculatus protoplasts was affected by the media chosen and the type of protoplast
culture method employed. Culture of the protoplasts on a nitrocellulose membrane with
a L. perenne feeder-layer on the sequential series of PEL medium was highly successful in
the formation of micro-colonies (Chapter 4 Table 4.6) with the plating efficiencies
exceeding those recorded in previous studies (Aziz et al., 1990; Pati et al., 2005; Akashi et
al., 2000). This is the first report of a L. corniculatus being successfully cultured on
nitrocellulose membrane using L. perenne feeder-layer on PEL medium and presents an
efficient alternative to the existing methods. The response of the protoplast-derived calli
towards the different auxin and cytokinins at different concentrations reveals that shoot
regeneration was observed more frequently at low levels of both auxins and cytokinins
and is in line with observations made by other authors (e.g. Handberg & Stougaard,
1992). A more detailed study on the role of PGRs towards regeneration of Lotus species
is needed to further develop an efficient regeneration medium.
Chapter 5 of this thesis deals with asymmetric protoplast fusion between L. corniculatus
and L. perenne. Asymmetric protoplast fusion is achieved by breaking or fragmenting the
chromosomes of the donor plant (L. corniculatus) using agents such as UV, which enables
the introduction of the genome on a minimised scale, and metabolically inactivating the
recipient plant (L. perenne) using IOA. The results from Chapter 5 show that the factors,
121
UV for genome fragmentation and IOA concentration for inactivation of parent
protoplasts, PEG molecular weight, PEG concentration, type of the surface used during
fusion experiments and calcium chloride concentration and duration, all play a pivotal
role in the outcome of the protoplast fusions between L. perenne and L. corniculatus.
Probable genome fragmentation of L. corniculatus protoplasts was achieved at 0.15 J/cm2
for 10 min (Chapter 5 Fig 5.1) while the inactivation of L. perenne protoplasts was
achieved at 0.1 mM IOA for 10 min. The results indicate that there is a significant
influence of PEG molecular weight and concentration on the fusion efficiency with the
highest percentage fusion achieved with 35% PEG (MW 3350). Experimental evidence
from this study establishes that the surface on which protoplast fusion between L.
perenne and L. corniculatus
was carried out greatly influences the formation of
heterokaryons. Calcium chloride had a profound effect on the outcome of the fusions
between L. perenne and L. corniculatus, with substantially increased protoplast fusion at
100 mM calcium chloride (Chapter 5 Table 5.7). The outcome of the fusion experiments
between L. perenne and L. corniculatus has been the development of putative hybrid
colonies with subsequent regeneration of putative hybrid plants. However, the putative
hybrid colonies as well as putative hybrid plants morphologically resembled the L.
corniculatus (donor) plants. To explain this unexpected result of asymmetric somatic
hybridisation two hypothesis were formulated:
I.
The regenerated putative hybrid plants are donor (L corniculatus ) plants that
have escaped the UV treatments.
II.
The regenerated putative hybrid plants are cybrid plants regenerated from
the fusion of escaped donor (L corniculatus) and recipient (L. perenne) with
some incorporation of cytoplasmic organelles from the recipient.
Flow cytometric and molecular analysis of the regenerated putative hybrid colonies and
plants using SD-AFLP molecular markers was necessary in order to confirm if one of
the hypothesis formulated was true. Chapter 6 deals with the flow cytometric analysis
and the different molecular markers used in assessing the hybrid status of the
regenerated colonies and plants. The profiles of the fusion colonies generated from the
flow cytometric analysis matched the profile generated by protocalli of L. corniculatus.
The absence of any extra peaks in any of the fusion colony profiles suggests that there
has been no major incorporation of nuclear material from L. perenne. Out of the 5 SDAFLP polymorphic bands observed band AAT(200) observed in FC4 and L. perenne
122
had complete similarity with 0 gaps providing hints that there might have been
incorporation of genome material from L. perenne to L. corniculatus. However, SCAR
markers based on this sequence failed to confirm any transfer of L. perenne DNA to L.
corniculatus. Recently discovered phenomenons such as NER and photo reactivation
(Ishibashi et al., 2006) might have lead to the uncharacteristic results of putative fusion
plants resembling the donor parent (L. corniculatus) observed in the current study. In this
chapter a novel technique of Whole Genome Amplification using Strand Displacement
Amplification was applied for the first time in plant cells (Raikar et al., 2007). This
technique helped to over come paucity of the tissue material during the initial stages of
molecular analysis.
123
7.3
Future Directions
The current study of protoplast fusion between Lolium perenne and Lotus corniculatus has
made it possible to make an assessment of the tissue culture responses of both L. perenne
and L. corniculatus as individual species. The findings during the establishment of the L.
perenne culture system and protoplast isolation indicate that cultivar differences could
play an important role in selecting the candidate cultivar for tissue culture studies.
Probing the hormonal metabolism within the different cultivars would help in finding
the reason for the varied response of the various cultivars. Investigative studies on the
cell wall composition of the different cultivars could provide a better explanation of the
varied protoplast yield (Chapter 3 Table 3.5) obtained from the different cultivars.
The success of L. perenne protoplast culture on the nitrocellulose membrane with a L.
perenne feeder layer results in speculations that a key component is missing from the
culture medium. Such responses have been shown in other plants such as Brassica
species (Christey, 2004) however no chemical factor has been identified previously.
However, Pasternak et al. (2002) observed that the pH of the medium might interfere in
the division of the protoplasts. Culture of the protoplasts on the nitrocellulose
membrane protects the protoplasts from the pH changes in the liquid medium, and
hence could support the observation made by Pasternak et al. (2002). An in depth study
on the pH changes in the liquid medium with different plant protoplasts would be able
to establish the sensitivity of the protoplasts to pH changes. Studies focusing on the
identification of the chemical factor involved in cell division could result in more
efficient and simplified regeneration process from protoplasts. The use of cell
suspensions from different cultivars of L. perenne and different species as feeder layer
would help in better understanding of the specificity of the cell division inducing
chemical factor towards the different cultivars and species.
The discrepancies observed among the somatic hybrid regenerants i.e. formation of
donor like plants even though the genome was fragmented, leads to the speculation
about the stability of the genome fragments resulting from the UV treatment. It has
been observed that plant cells have evolved strategies such NER and DNA repair from
photo-reactivation, due to damage caused by UV (Ishibashi et al., 2006). Thorough
investigative studies in this field could yield more ideal results from asymmetric
protoplast fusions. Even though the current project has not been able to yield the
124
desired results, the study indicates high possibilities of successful protoplast fusions for
gene introgressions between distant plants as wide as monocotyledonous
and
dicotyledonous species.
7.4
Perspectives
Protoplast fusion was carried out between L. perenne and L. corniculatus for gene
introgression. Somatic hybridisation was chosen since it has been shown to have been
used as a successful breeding technique between widely related species. The two species
chosen were taxonomically very wide, L. perenne a monocotyledonous plant and L.
corniculatus a dicotyledonous plant.
The experimental results obtained have demonstrated that the somatic hybridisation
between L. perenne and L. corniculatus have been successful resulting in the formation of
heterokaryons. The resulting putative hybrid plants might have introgressed genes from
L. perenne, however no molecular proof could be established. Further molecular
investigation with mitochondrial and chloroplast markers and the use of GISH could
help in locating introgressed segments. The study proves that the technique of somatic
hybridisation is a highly valuable technique for gene introgression crossing the species
barriers. More studies involving such wide species would help in increasing the
efficiency of protoplast fusions.
This thesis details a novel concept of Whole Genome Amplification of plants using the
Strand Displacement Amplification technique. This technique would be useful to
overcome the paucity of sample tissue and help save valuable DNA.
125
References
Akada S. & Hirai A. (1986). Studies on the mode of separation of chloroplast genomes in
parasexual hybrid calli. III. Random separation of two types of chloroplast genomes
in a hybrid callus. Japanese Journal of Genetics, 61, 437-445.
Akashi R., Hashimoto A. & Adachi T. (1993). Plant regeneration from seed-derived
embryogenic callus and cell suspension cultures of bahiagrass (Paspalum notatum).
Plant Science, 90, 30-80.
Akashi R., Harris S., Tsay-Hoffmann S.S. & Hoffmann F. (2000). Plants from protoplasts
isolated from long-term root culture (Super Root) of Lotus corniculatus. Journal of Plant
Physiology, 157, 215-221.
Ahuja P.S., Hadiuzzaman S., Davey M.R. & Cocking E.C. (1983). Prolific plant
regeneration from protoplast-derived
tissues of Lotus corniculatus L. (birdsfoot
trefoil). Plant Cell Reports, 2, 101-104.
Aljanabi S.M., Forget L. & Dookun A. (1999). An improved and rapid protocol for the
isolation of polysaccharide and polyphenol-free sugarcane DNA. Plant Molecular
Biology Reporter 17, 281.
Altpeter F. & Posselt U.K. (2000). Improved plant regeneration from cell suspensions of
commercial cultivars, breeding and inbred lines of perennial ryegrass (Lolium perenne
L.). Journal of Plant Physiology, 156, 790-796.
Ankele E., Heberle-Bors E., Pfosser M.F. & Hofinger B.J. (2005). Searching for
mechanisms leading to albino plant formation in cereals. Acta Physiologiae Plantarum,
27, 651-664.
Arcioni S., Bellucci M., Damiani F., Pupilli F. ((2000). Gene transfer for alfalfa
improvement.
Retrieved
on
August
22
2007
from
http://www.naaic.org/TAG/TAGpapers/arcioni/arcioni.html
Arumuganathan K, Earle ED. (1991). Estimation of Nuclear DNA content of plants by
flow cytometry. Plant Molecular & Biology Reports, 9, 229-233.
126
Asano Y. & Sugiura K. (1990). Plant regeneration from suspension culture-derived
protoplasts of Agrostis alba L. (redtop). Plant Science, 72, 267-273.
Asano Y., Ito Y., Sugiura K. & Fujiie A. (1994). Improved protoplast culture of bentgrass
(Agrostis L.) using a medium with increased agarose concentration. Journal of Plant
Physiology, 143, 122-124.
Assani A., Haicour R., Wenzel G., Foroughi-Wehr B., Bakry F. & Cote F.X. (2002).
Influence of donor material and genotype on protoplast regeneration in banana and
plantain cultivars (Musa spp.) Plant Science, 162, 355-362.
Aziz M.A., Chand P.K., Power J.B. & Davey M.R. (1990). Somatic hybrids between the
forage legumes Lotus corniculatus L. and L. tenuis Waldst et kit. Journal of Experimental
Botany, 41, 471-479.
Balasko J.A., Evers G.W., Duell R.W. (1995). Bluegrasses, ryegrasses, and bentgrasses. p.
357-372. In: R.F. Barnes, DA Miller, and CJ Nelson. (eds.), Forages. Vol. 1. An
Introduction to Grassland Agriculture, 5th ed. Iowa State Univ. Press. Ames, IA.
Barone A., Li J., Sebastiano A., Cardi T. & Frusciante L. (2002). Evidence for tetrasomic
inheritance in a tetraploid Solanum commersonii (+) S. tuberosum somatic hybrid
through the use of molecular markers. Theoretical andApplied Genetics, 104, 539-546.
Barry T.N. (1989). Condensed tannins: their role in ruminant protein and carbohydrate
digestion and possible effects upon the rumen ecosystem. In: Nolan JV, Leng RA
and Demeyer DI (eds.), The roles of protozoa and fungi in ruminant digestion, Perumbal
Books Armidale Australia. Pp. 153-169.
Bates G.W. (1985). Electrical fusion for optimal formation of protoplast heterokaryons in
Nicotiana. Planta, 165, 217-224.
Bates G.W., Hasenkampf C.A., Contolini C.L., & Piastuch W.C. (1987). Asymmetric
hybridization in Nicotiana by fusion of irradiated protoplasts. Theoretical and Applied
Genetics, 74, 718–726.
127
Bauer-Weston B., Keller W., Webb J. & Gleddie S. (1993). Production and
characterisation of asymmetric somatic hybrids between Arabidopsis thaliana and
Brassica napus. Theoretical and Applied Genetics, 86, 150-158.
Begum F., Paul S., Bag N., Sikdar S.R. & Sen S.K. (1995). Somatic hybrids between
Brassica juncea (L.) Czern. and Diplotaxis harra (Forsk.). Boiss and the generation of
backcross progenies. Theoretical and Applied Genetics, 91, 1167-1172.
Belgrave B.R., Watt P.C., Brock J.L., Wewala S., & Sedcole J.R. (1990). A survey of
farmer knowledge and use of pasture cultivars in New Zealand. New Zealand Journal
of Agricultural Research, 33, 199-211.
Bhaskaran S. & Smith R.H. (1990). Regeneration in cereal tissue culture: A Review. Crop
Science, 30, 1328-1336.
Bidlack J. E. (1990). Cell wall components and lignin Biosynthesis in Forages. Ph.D.
Dissertation, Iowa State Univ., Ames, IA
Blanco L., Bernad A., Lazaro J.M., Martin G., Garmendia C., Salas M. (1989). Highly
efficient DNA synthesis by the phage phi 29 DNA polymerase. Symmetrical mode
of DNA replication. Journal of Biological Chemistry, 264, 8935-8940.
Boss W.F. & Mott R.L. (1980). Effects of divalent cations and polyethylene glycol on the
membrane fluidity of protoplasts. Plant Physiology, 66, 835-837.
Bottley A., Xia G.M. & Koebner R.M.D. (2006). Homoeologous gene silencing in
hexaploid wheat. The Plant Journal, 47, 897-906.
Bradley D.E., Bruneau A.H. & Qu R. (2001). Effects of cultivar, explant treatment, and
medium supplements on callus induction and plantlet regeneration in perennial
ryegrass. International Turfgrass Society Research Journal, 9, 152-156.
Brière C., Harthou H., Jauneau A., Alibert G. &
Petitprez M. (2004). The actin
cytoskeleton is involved in signalling protoplast embryogenesis induced by agarose
embedding. Physiologia Plantarum, 122, 115-122.
128
Broadhurst R.B., & Jones T.J. (1978). Analysis of condensed tannins using acidified
vanillin. Journal of Science Food & Agriculture, 29, 788-794.
Brüdern A. & Thiel G. (1999). Effect of cell-wall digesting enzymes on physiological state
and competence of maize coleoptile cells. Protoplasma, 209, 24-255.
Buiteveld J., van de Valk J., Creemers-Molenaar J. & Colijn-Hooymans C.M. (1993).
Callus induction and plant regeneration from explants of commercial cultivars of
leek (Allium ampeloprasum L.). Plant Cell Reports, 12, 431-434.
Burgon A., Bondesen O.B., Verburgt W.H., Hall A.G., Bark N.S., Robinson M., Tim G.
(1997). The forage seed trade. In: D T Farey & G J Hampton (Eds.), Forage seed
production. 1. Temperate species, pp. 271-286 Wallingford, UK: CAB International.
Cai Y., Xiang F., Zhi D., Liu H. & Xia G. (2007). Genotyping of somatic hybrids between
Festuca arundinacea Schreb. And Triticum aestivum L. Plant Cell Reports, DOI
10.1007/s00299-007-0397-5
Carlson P.S., Smith H.H. & Dearing R.D. (1972). Parasexual plant hybridisation.
Proceedings of National Academy of Sciences USA, 69, 2292-2294.
Chen W.P., Wu Q.S., Liu D.J. & Jones M.G.K. (1992). Callus formation from somatic
hybridisation of Wheat (Triticum Aestivum L.) and Ryegrass (Lolium perenne L.) by
electrofusion. Acta Botanica Sinica, 34(4), 284-290.
Cheng A.X. & Xia G.M. (2004). Somatic hybridisation between common wheat and
Italian ryegrass. Plant Science, 166, 1219-1226.
Chevrier N., Qureshi J.A. Huel P. & Kartha K.K. (1990). Heritability of in vitro
regeneration in wheat. Canadian Journal of Plant Science, 70, 547-550.
Christey M. (2004). Protoplast culture and Somatic Hybridization.. In E.C. Pua and C.J.
Douglas (Eds.), Biotechnology in Agriculture and Forestry, 54, (pp. 119-148) SpringerVerlag, Berlin, Heidelburg.
Christey M.C. Makaroff C.A. & Earle E.D. (1991). Atrazine-resistant cytoplasmic malesterile-nigra broccoli obtained by protoplast fusion between cytoplasmic male-sterile
129
Brassica oleracea and atrazine-resistant Brassica campestris. Theoretical and Applied Genetics,
83, 201-208.
Cocking E.C. (1960). A method for isolation of plant protoplasts and vacuoles. Nature,
187, 962-963.
Cocking E.C. (2000). Turning point article plant protoplasts. In Vitro Cell Developmental
Biology-Plant, 36, 77-82.
Collard B.C.Y. & Mackill D.J. (2008). Marker-assisted selection: An approach for
precision plant breeding in the twenty-first century. Philosophical Transactions of The
Royal Society B, 363, 557-572.
Colomba E.L., Grunberg K., Griffa S., Ribotta A., Mroginski L. & Biderbost E. (2006).
Effect of genotype and culture medium on somatic embryogenesis and plant
regeneration from mature embryos of fourteen apomictic cultivars of buffel grass
(Cenchrus ciliaris L.). Grass and Forage Science, 61, 2-8.
Commun K., Mauro M.C, Chupeau Y., Boulay M., Burrus M., & Jeandet P. (2003).
Phytoalexin production in grapevine protoplasts during isolation and culture. Plant
Physiology and Biochemistry, 41, 317-323.
Conner, A.J., Glare, T.R., & Nap, J.P. (2003). The release of genetically modified crops
into the environment: II. Overview of ecological risk assessment. The Plant Journal,
33, 19-46.
Crea F., Calderini O., Nenz E., Cluster P.D., Damiani F. & Arcioni S. (1997).
Chromosomal and molecular rearrangements in somatic hybrids between tetraploid
Medicago sativa and diploid Medicago falcata. Theoretical and Applied Genetics, 95, 11121118.
Creemers-Molenaar J., Loeffen J.P.M. & Van der Valk P. (1988). The effect of 2,4Dichlorophenoxyacetic acid and donor plant environment on plant regeneration
from immature inflorescence-derived callus of Lolium perenne L. and Lolium
multiflorum L. Plant Science, 57, 165-172.
130
Creemers-Molenaar J., Van der Valk P., Loeffen P.M. & Zaal M.A.C.M. (1989). Plant
regeneration from suspension cultures and protoplasts of Lolium perenne L. Plant
Science, 63, 167-176.
Creemers-Molenaar J., Hall R.D. & Krens F.A. (1992a). Asymmetric protoplast fusion
aimed at intraspecific transfer of cytoplasmic male sterility (CMS) in Lolium perenne
L. Theoretical and Applied Genetics, 84, 763-770.
Creemers-Molenaar J., van Eeuwijk F.A. & Krens F.A. (1992b). Culture optimization for
perennial ryegrass protoplasts. Journal of Plant Physiology, 139, 303-308.
Cutler A.J., Saleem M., Coffey M.A. & Loewen M.K. (1989). Role of oxidative stress in
cereal protoplast recalcitrance. Plant Cell Tissue and Organ Culture, 18, 113-127.
Dalton S.J. (1988a). Plant regeneration from cell suspension protoplasts of Festuca
arundinacea Schreb., Lolium perenne L. and L. multiflorum Lam. Plant Cell Tissue and
Organ Culture, 12, 137-140.
Dalton S.J. (1988b). Plant regeneration from cell suspension protoplasts of Festuca
arundinacea Schreb. (tall fescue) and Lolium perenne L. (perennial ryegrass). Journal of
Plant Physiology, 132, 170-175.
Dalton S.J., Bettany A.J.E., Timms E. & Morris P. (1998). Transgenic plants of Lolium
multiflorum, Lolium perenne, Festuca arundinacea and Agrostis stolonifera by silicon carbide
fibre mediated transformation of cell suspension cultures. Plant Science, 312, 31-43.
Dalton S.J., Bettany A.J.E., Timms E. & Morris P. (1999). Co-transformed diploid Lolium
perenne (perennial ryegrass), Lolium multiflorum (Italian ryegrass) plants produced by
microprojectile bombardment. Plant Cell Reports, 18, 721-726.
Davey M.R., Blackhall N.W., Lowe K.C. & Power B.J. (1996). Stimulation of plant cell
division and organogenesis by short-term, high-voltage electrical pulses. In:
Electrical Manipulation of Cells, Lynch P.T., Davey M.R. (Eds.) Chapman and Hall,
New York pp 273-286.
Davey M.R., Anthony P., Power B.J. & Lowe K.C. (2005). Plant protoplasts: Status and
biotechnological perspectives. Biotechnological Advances, 23, 131-171.
131
Day A., & Ellis T.H.N. (1984). Chloroplast DNA deletions associated with wheat plants
regenerated from pollen: Possible basis for maternal inheritance of chloroplasts.
Cell, 39, 359-368.
Day A., & Ellis T.H.N. (1985). Deleted forms of plastid DNA in albino plants from
cereal anther culture. Current Genetics, 9, 671-678.
Dean F.B., Nelson J.R., Giesler T.L., Lasken R.S. (2001) Rapid Amplification of Plasmid
and Phage DNA Using Phi29 DNA Polymerase and Multiply-Primed Rolling Circle
Amplification. Genome Research, 11, 1095-1099.
Derks F.H.M., Hakkert J.C. & Derbeek W.H.J. (1992). Genome composition of
asymmetric hybrids in relation to the phylogenetic distance between the parents
nucleus-chloroplast interaction. Theoretical and Applied Genetics, 84, 930-940.
Dijak M., Smith D.L., Wilson T.J. & Brown D.C.W. (1986). Stimulation of direct
embryogenesis from mesophyll protoplasts of Medicago sativa. Plant Cell Reports, 5,
468-470.
Donaldson P.A., Bevis E.E., Pandeya R.S. (1994). Random chloroplast segregation and
frequent mtDNA rearrangements in fertile somatic hybrids between Nicotiana
tabacum L. and N. glutinosa L. Theoretical and Applied Genetics, 87, 900-908.
Dudits D., Fejér O., Hadlaczky G., Koncz C., Lázár G.B. & Horváth G. (1980).
Intergeneric gene transfer mediated by plant protoplast fusion. Molecular & General
Genetics, 179, 283–288.
Duke J.A. (1981). Handbook of legumes of world economic importance, London: Plenum Press.
Dunford R. & Walden R.M. (1991). Plastid genome structure and plastid related transcript
levels in albino barley plants derived from anther culture. Current Genetics, 20, 339347.
Durieu P. & Ochatt S.J. (2000). Efficient intergeneric fusion of pea (Pisum sativum L.) and
grass pea (Lathyrus sativus L.) protoplasts. Journal of Experimental Botany, 51(348),
1237-1242.
132
Duzgunes N., Wilschut J., Fraley R. & Papahadjopoulos D. (1981). Studies on the
mechanism of membrane fusion. Role of head-group composition in calcium and
magnesium-induced fusion of mixed phospholipids vesicles. Biochimica et Biophysica
Acta, 642, 182-195.
Esau K. (1977). Cell Wall. In: Plant Anatomy, John Wiley & Sons, New York 43-60.
Fahleson J., Eriksson I., Landgren M., Stymne S. & Glimelius K. (1994). Intertribal
somatic hybrids between Brassica napus and Thlaspi perfoliatum with high content of
the T. perfoliatum-specific nervonic acid. Theoretical and Applied Genetics, 87, 795–804.
Forsberg J., Lagercrantz U. & Glimelius K. (1998a). Comparison of UV light, X-ray and
restriction enzyme treatment as tools in production of asymmetric somatic hybrids
between Brassica napus and Arabidopsis thaliana. Theoretical & Applied Genetics, 96,
1178–1185.
Forsberg J., Dixelius C., Lagercrantz U. & Glimelius K. (1998b). UV dose-dependent
DNA elimination in asymmetric somatic hybrids between Brassica napus and
Arabidopsis thaliana. Plant Science, 131, 65-76.
Gadkar V., Rillig M.C. (2005). Application of Phi29 DNA polymerase mediated whole
genome amplification on single spores of arbuscular mycorrhizal (AM) fungi.
FEMS Microbiology Letters, 242, 65-7.
Gamborg O.L. (2002). Plant tissue culture biotechnology, milestones. In Vitro Cellular and
Developmental Biology-Plant, 38, 81-92.
Ge T.M., Yu Y.J., Xie Y.F., Zhang D.P., Zhang R.D. & Qin F.L. (1997). Asymmetric
somatic hybridisation and plant regeneration between wheat and Italian ryegrass (in
Chinese). Journal of Huazhong Agricultural University, 16, 105-111.
Ge T.M., Lin X.H. Qin F.L., Yu S.W. & Yu Y.J. (2006) Protoplast electrofusion between
Common Wheat (Triticum Aestivum L.) and Italian ryegrass (Lolium multiflorum Lam.)
and regeneration of mature cybrids. In Vitro Cellular and Developmental Biology-Plant,
42, 179-187.
133
Gelvin S.B. (2003). Agrobacterium-mediated plant transformation: the biology behind the
“gene-jockeying” tool. Microbiology and Molecular Biology Reviews, 67, 16-37.
Gilliland T.J., Camlin M.S. & Wright C.E. (1982). Evaluation of phosphoglucoisomerase
allozyme electrophoresis for the identification and registration of cultivars of
perennial ryegrass (Lolium perenne). Seed Science Technology, 10, 415-430.
Glen A.E., Bacon C.W., Price R. & Hanlin R.T. (1996). Molecular phylogeny of
Acremonium and its taxonomic implications. Mycologia, 88, 369-383.
Goodacre R., Roberts L., Ellis D., Thorogood D., Reader S.M., Ougham H., et al. (2007).
From phenotype to genotype: Whole tissue profiling for plant breeding.
Metabolomics, DOI: 10.1007/s11306-007-0062-6
Gordon A.H., Lomax J.A., Dalgarno K. & Chesson A. (1985).
Preparation and
composition of mesophyll, epidermis, and fibre cell walls from leaves of perennial
ryegrass (Lolium perenne) and Italian ryegrass (Lolium multiflorum). Journal of Food Science
and Agriculture, 36, 509-519.
Gram T., Mattsson O. & Joersbo M. (1996). Division frequency of pea protoplasts in
relation to starch accumulation. Plant Cell Tissue and Organ Culture, 45, 179-183.
Grimes H.D. & Boss W.F. (1985). Intracellular calcium and calmodulin involvement in
protoplast fusion. Plant Physiology, 79, 253-258.
Gülly C. (1996). Mutationen im chloroplastengenom als auslöser für den Albinismus in
Pollenpflanzen von Weizen? Diploma Thesis, University of Vienna, Vienna.
Guo W.W., Prasad D., Serrano P., Gmitter Jr. F.G. & Grossier J.W. (2004). Citrus
somatic hybridisation with potential for direct tetraploid scion cultivar
development. Journal of Horticultural Science and Biotechnology, 79, 400-405.
Gupta H.S. & Pattanayak A. (1993). Plant regeneration from mesophyll protoplasts of
rice (Oryza sativa L.) Bio/Technology, 11, 90-94.
134
Guthridge K.M., Dupal M.P., Jones E.S., Kolliker R., Smith K.F. & Forster J.W. (2001).
AFLP analysis of genetic diversity within and between populations of perennial
ryegrass (Lolium perenne L.). Euphytica, 122, 191-201.
Hadwiger M.A. & Heberle-Bors E. (1986). Pollen plant production in Triticum turgidum
ssp. durum. In: Proceedings of International Symposium of Nuclear Techniques and in-vitro
culture for plant improvement, FAO/IAEA, Vienna, pp 213-220.
Hall R.D., Rouwendal G.J.A. & Krens F.A. (1992). Asymmetric somatic cell hybridisation
in plants. I. The early effects of (sub)lethal doses of UV and gamma irradiation on
the cell physiology and DNA integrity of cultured sugarbeet (Beta vulgaris L.)
protoplasts. Molecular General and Genetics, 234, 306-314.
Handberg K. & Stougaard J. (1992). Lotus japonicus an autogamous, diploid legume species
for classical and molecular genetics. Plant Journal, 2, 487-496.
Hansen L.N. & Earle E.D. (1994). Novel flowering and fatty acid characters in rapid
cycling Brassica napus L. resynthesised by protoplast fusion. Plant Cell Reports, 14,
151-156.
Hansen L.N. & Earle E.D. (1997). Somatic hybrids between Brassica oleracea L. and Sinapis
alba L. with resistance to Alternaria brassicae (Berk) Sacc. Theoretical and Applied
Genetics, 94, 1078-1085.
Hanzel J.J., Miller J.P., Brinkman M.A. & Fendos E. (1985). Genotype and media effects
on callus formation and regeneration in barley. Crop Science, 25, 27-31.
Harada T., Sato T., Asaka T. & Matsukawa I. (1991). Large-scale deletions of plastid
DNA in rice anther culture. Theoretical and Applied Genetics, 81, 157-161.
Harada T., Ishikawa R., Niizeki M. & Saito K (1992). Pollen-derived rice calli that have
large deletions in the plastid DNA do not require protein synthesis in plastid for
growth Molecular and General Genetics, 233, 145-150.
Hatfield R.D., Wilson J.R. & Mertens D.R. (1999). Composition of cell walls isolated
from cell types of grain sorghum stems. Journal of the Science of Food and Agriculture, 79,
891-899.
135
Hawken R.J., Cavanagh J.A.L., Meadows J.R.S., Khatkar M.S., Husaini Y., Zenger K.R., et
al. (2006). Whole-Genome Amplification of DNA Extracted from Cattle Semen
Samples. Journal of Dairy Science, 89, 2217-2221.
Hayward M.D. & McAdam N.J. (1977). Isozyme as a measure of distinctiveness and
stability in cultivars of Lolium perenne. Z. Pflanzenz, chtg, 79, 59-68.
Hensgens L.A.M., de Bakker E.P.H.M., van Os-Ruygrok E.P., Rueb S., van de Mark F.,
van der Maas H.M., et al. (1993). Transient and stable expression of gusA fusions
with rice genes in rice, barley and perennial ryegrass. Plant Molecular Biology, 22, 11011127.
Heseman C. U. & Schröder G. (1982). Loss of nuclear DNA in leaves of rye. Theoretical
and Applied Genetics, 62, 128-131.
Hofinger B. (1999). Molecular genetic analysis of plastid deficiencies in anther culturederived albino plants of wheat (Triticum aestivum). Diploma Thesis, University of
Vienna, Vienna.
Holme, I.B., Torp A.M., Hansen L.N. & Andersen S.B. (2004). Quantitative trait loci
affecting plant regeneration from protoplasts of Brassica oleracea. Theoretical and
Applied Genetics, 108, 1513-1520.
Horn M.E., Shillito R.D., Conger B.V. & Harms C.T. (1988). Transgenic plants of
orchardgrass (Dactylis glomerata L.) from protoplasts. Plant Cell Reports, 7, 469-472.
Hu Q., Hansen L, Laursen J., Dixelius C. & Andersen S. (2002). Intergeneric hybrids
between Brassica napus and Orychophragmus violaceus containing traits of agronomic
importance for oilseed rape breeding. Theoretical and Applied Genetics, 105, 834-840.
Ishibashi T., Kimura S., Furukawa T. & Sakaguchi K. (2006). DNA repair mechanisms in
UV-B tolerant plants. Japan Agricultural Research Quaterly, 40(2), 107-113.
Jain S.M. (2001). Tissue culture-derived variation in crop improvement. Euphytica, 118,
153-166.
136
Jain S.M., Shahin E. A. & Sun S. (1988). Interspecific protoplast fusion for the transfer of
atrazine resistance from Solanum nigrum to tomato (Lycoperscicon esculentum L.) Plant
Cell Tissue and Organ Culture, 12, 189-192.
Jain R.K., Khehra G.S., Lee S.H., Blackhall N.W., Marchant R., Davey M.R., et al. (1995).
An Improved procedure for plant regeneration from Indica and japonica rice
protoplasts. Plant Cell Reports, 14, 515-519.
Kaimori N., Senda M., Ishikawa R., Akada S., Harada T., & Niizeki M. (1998).
Asymmetric somatic cell hybrids between Alfaalfa and Birdsfoot Trefoil. Breeding
Science, 48, 29-34.
Kanno A., Kanzaki H. & Kameya T. (1997). Detailed analyses of chloroplast and
mitochondrial DNAs from the hybrid plant generated by asymmetric protoplast
fusion between radish and cabbage. Plant Cell Reports, 16, 479-484.
Kao K.N. (1977). Chromosomal behaviour in somatic hybrids of soybean and Nicotiana
glauca. Molecular & General Genetics, 150, 225-230.
Kao, K. N. & Michayluk M. R.. (1974). A method for high-frequency intergeneric fusion
of plant protoplasts. Planta, 115, 355-367.
Kao, K. N., Constabel F., Michayluk M.R. & Gamborg O.L. (1974). Plant protoplast
fusion and growth of intergeneric hybrid cells. Planta, 120, 215-227.
Kaul K. (1990). Potential biotechnological approaches. In: Kasperbauer MJ (ed)
Biotechnology in tall fescue improvement, CRC Press, Boca/ Raton, pp 59-77.
Kihara M., Cai K-N., Ishikawa R., Harada T., Niizeki M. & Saito K. (1992). Asymmetric
somatic hybrid calli between leguminous species of Lotus corniculatus and Glycine max
and regenerated plants from the calli. Japanese Journal of Breeding, 42, 55-64.
Kisaka H., Lee H., Kisaka M., Kanno A., Kang K. & Kameya T. (1994). Production and
analysis of asymmetric hybrid plants between monocotyledon (Oryza sativa L.) and
dicotyledon (Daucus carota L.). Theoretical Applied Genetics, 89, 365-371.
137
Kisaka H., Kisaka M., Kanno A. & Kameya T. (1997). Production and analysis of plants
that are somatic hybrids of barley (Hordeum vulgare L.) and carrot (Daucus carota L.).
Theoretical Applied Genetics, 94, 221-226.
Kisaka H., Kisaka M., Kanno A. & Kameya T. (1998). Intergeneric somatic hybridisation
of rice (Oryza sativa L.) and Barley (Hordeum vulgare. L) by protoplast fusion. Plant
Cell Reports, 17, 362-367.
Klercker J.A.F. (1892). Eine methode zur isolierung lebender protoplasten. Ofvers VetenskAkad Förh Stokh, 9, 463-475.
Knox M.R. & Ellis T.H.N. (2001). Stability and inheritance methylation states at PstI sites
in Pisum. Molecular Genetics and Genomics, 265, 497-507.
Kushnir S. G, Shlumukov L. R., Pogrebnyak N.J., Berger S. & Gleba Y. (1987).
Functional cybrid plants possessing a Nicotiana genome and an Atropa plastome.
Molecular and General Genetics, 209, 159-163.
Kyozuka J., Hayashi Y. & Shimamoto K. (1987). High frequency plant regeneration from
rice protoplasts by novel nurse culture methods. Molecular and General Genetics, 206,
408-413.
Lallemand J., Michaud O. & Greneche M. (1991). Electrophoretical description of rye
grass varieties: a catalogue. Plant Variety Seeds, 4, 11-16.
Lasken R.S., Egholm M. (2003). Whole genome amplification: abundant supplies of DNA
from precious samples or clinical specimens. Trends in Biotechnology, 21, 531-535.
Lee L, Schroll R.E., Grimes H.D. & Hodges T.K. (1989). Plant regeneration from indica
rice (Oryza sativa L.) protoplasts. Planta, 178, 325-333.
Leonards K.S. & Haug A. (1979). Regulation of zoospore development: electron spin
resonance studies of the isolated lipid components from Blastocladiella emersonii
zoospores. Plant Physiology, 63, S-145.
138
Li Z.Y., Tanner G.J. & Larkin P.J. (1990). Callus regeneration from Trifolium subterraneum
protoplasts and enhanced protoplast division by low-voltage treatment and nurse
cells. Plant Cell Tissue and Organ Culture, 21, 67-73.
Linsmaier E.M. & Skoog F. (1965). Organic growth factor requirements of tobacco tissue
cultures. Physiology Plantarum, 8, 100-127.
Liu J.H. & Deng X.X. (1999). Regeneration of hybrid calluses via donor-recipient fusion
between Microcitrus papuana and Citrus sinensis. Plant Cell Tissue and Organ culture, 59,
81-87.
Liu J., Xu X. & Deng X. (2005). Intergeneric somatic hybridization and its application to
crop genetic improvement. Plant Cell Tissue and Organ Culture, 82, 19-44.
Lotfy S., Luro F., Carreel F., Froeloicher Y., Rist D. & Ollitrault P. (2003). Application of
cleaved amplified polymorphic sequence method for analysis of cytoplasmic
genome among Aurantioideae intergeneric somatic hybrids. Journal of American
Society of Horticultural Science, 128, 225-230.
Löschen-berger F. & Heberle-Bors E. (1992). Anther culture responsiveness of Austrian
winter wheat (Triticum aestivum L.) cultivars. Die Bodenkultur, 43, 115-122.
Lowe K.C., Anthony P., Power J.B. & Davey M.R. (2003). Novel approaches for
regulating gas supply to plant systems in vitro: application and benefits of artificial
gas carriers. In Vitro Cellular and Developmental Biology-Plant, 39, 557-566.
Lührs, R. & Lörz H. (1987). Plant regeneration in vitro from embryogenic cultures of
spring and winter type barley (Hordeum vulgare L.) varieties. Theoretical and Applied
Genetics, 75, 16-25.
Ma R., Guo Y.D. & Pulli S. (2003). Somatic embryogenesis and fertile green plant
regeneration from suspension cell –derived protoplast of rye (Secale cereale L.). Plant
Cell Reports, 22, 320-327.
Mathieu Y., Lapous D., Thomine S., Lauriére C., & Guern J. (1996). Cytoplasmic
acidification as an early phosphorylation-dependent response of tobacco cells to
elicitors. Planta, 199, 416-424.
139
McMillin D.E. (1983). Plant isozymes: a historical perspective. In: Tanksley SD and
Orton TJ (Eds.), Isozymes in Plant Genetics and Breeding, part A. (pp. 3-13). Elsevier,
Amsterdam.
Mian M.A.R., Zwonitzer J.C. & Hopkins A.A. (2000). Genetic diversity assessment in
Festuca arundinacea Schreb. Using AFLP markers. Abstr. In: Molecular Breeding of Forage
Crops, Second International Symposium (p. 146). Nov. 19-24, 2000 Victoria Australia.
Min B.R., McNabb W.C., Barry T.N. & Kemp P.D. (1998). The effect of condensed
tannins on the production of wool and on its processing characteristics in sheep
grazing Lotus corniculatus. Australian Journal of Agricultural Research, 49, 597-605.
Min B.R., Fernandez J.M., Barry T.N., McNabb W.C. & Kemp P.D. (2001). The effect of
condensed tannins in Lotus corniculatus upon reproductive efficiency and wool
production in ewes during autumn. Animal Feed Science and Technology, 92, 185-202.
Michalczuk L., Cooke T.J. & Cohen J.D. (1992a). Auxin levels at different stages of carrot
somatic embryogenesis. Phytochemistry, 31, 1097-1103.
Michalczuk L., Ribnicky D.M., Cooke T.J. & Cohen J.D. (1992b). Regulation of indole-3acetic acid biosynthetic pathways in carrot cell cultures. Plant Physiology, 100, 13461353.
Mohmand A.S. & Nabors M.W. (1990). Somaclonal variant plants of wheat derived from
mature embryo explants of three genotypes. Plant Cell Reports, 8, 558-560.
Moieni A. & Sarrafi A. (1995). Genetic analysis for haploid-regeneration responses of
hexaploid-wheat anther cultures. Plant Breeding, 114, 247-249.
Moshelion M., Moran N. & Chaumont F. (2004). Dynamic changes in the osmotic water
permeability of protoplast plasma membrane. Plant Physiology 135, 2301-2317.
Mouritzen P. & Bach-Holm P. (1994) Chloroplast genome breakdown in microspore
culture of barley (Hordeum vulgare L.) occurs primarily during regeneration. Journal of
Plant Physiology, 144, 586-593.
140
Mueller U.G. & Wolfenbarger L.L. (1999). AFLP genotyping and fingerprinting. Tree, 10,
389-394.
Murashige T. & Skoog F. (1962). A revised medium for rapid growth and bioassays with
tobacco tissue culture. Physiology Plantarum, 15, 473-497.
Nagata T.G. & Melchers G. (1978). Surface charge of protoplasts and their significance in
cell-cell interaction. Planta, 142, 235-238.
Nakajo S., Niizeki M., Harada T., Ishikawa R. & Saito K. (1994). Somatic cell
hybridisation in rice (Oryza sativa L.) and birsfoot trefoil (Lotus corniculatus L.).
Breeding Science, 44, 79-81.
Nap J.P., Metz P.L.J., Escaler M. & Conner A.J. (2003). The release of genetically
modified crops into the environment: I. Overview of current status and regulations.
The Plant Journal, 33, 1-18.
Nenz E., Pupilli F., Paolocci F., Damiani F., Cenci C.A., & Arcioni S. (1996) Plant
regeneration and genetic transformation of Lotus angustissimus. Plant Cell Tissue and
Organ Culture, 45, 145-152.
Nielsen G. (1980). Identification of all genotypes in tetraploid ryegrass (Lolium spp.)
segregating for four alleles in a Pgi-enzyme locus. Hereditas, 92, 49-52.
Nielsen K.A., Larsen E. & Knudsen E. (1993). Regeneration of protoplast-derived green
plants of Kentucky blue grass (Poa pratensis L.). Plant Cell Reports, 12, 537-540.
Niizeki M. & Grant W.F. (1971). Callus, plantlet formation, and polyploidy from cultured
anthers of Lotus and Nicotiana. Canadian Journal of Botany, 49, 2041-2051.
Niizeki M., & Saito K. (1986). Plant regeneration from protoplasts of bridsfoot trefoil,
Lotus corniculatus L. Japanese Journal of Breeding, 36, 177-180.
Niizeki M., Nakajo S. & Harada T. (1992). Somatic cell hybridisation in rice and birdsfoot
trefoil. Lotus Newsletter, 23, 18-22.
Niizeki M., Kihara M. & Cai K-N. (1994). Somatic hybridisation between Birdsfoot
Trefoil (Lotus corniculatus L.) and Soybean (Glycine max L.). In: Bajaj Y.P.S. (Ed.),
141
Biotechnology in Agriculture and Forestry, 27, (pp. 132-144) Springer-Verlag, Berlin
Germany.
Niizeki M. (2001). Somatic hybridisation between Medicago sativa L. (Alfalfa) and Lotus
corniculatus L. (Birdsfoot trefoil). In: Nagata and Bajaj (Eds.), Biotechnology in
Agriculture and Forestry, 49, (pp. 341-355) Springer-Verlag, Berlin Germany.
Oberwalder B., Rouß B., Schilde-Rentschler L., Hemleben V. & Ninnemann H. (1997).
Asymmetric fusion between wild and cultivated species of potato (Solanum spp.)
detection of asymmetric hybrids and genome elimination. Theoretical and Applied
Genetics, 94, 1104-1112.
Olesen A., Storgaard M. Madsen S. & Andersen S.B. (1995). Somatic in vitro culture
response of Lolium perenne L.: genetic effects and correlations with anther culture
Euphytica, 86, 199-209.
Olesen A., Storgaard M. & Madsen S. (1996). Suspension culture performance in
commercial varieties of perennial ryegrass (Lolium perenne L.). Euphytica, 88, 151-157.
Ozais-Akins P., Ferl R.J. & Vasil I.K. (1986). Somatic hybridization in the gramineae:
Pennisetum americanum (L.) K. Schum. (pearl millet)+ Panicum maximum Jacq. (Guinea
grass). Molecular & General Genetics, 203, 365-370.
Papadakis A.K. & Roubelakis-Angelakis K.A. (2002). Oxidative stress could be
responsible for the recalcitrance of plant protoplasts. Plant Physiology and Biochemistry,
40, 549-559.
Papadakis A.K., Paschalidis K.A. & Roubelakis-Angelakis K.A. (2005). Biosynthesis
profile and endogenous titers of polyamines differ in totipotent and recalcitrant
plant protoplasts. Physiologia Plantarum 125, 10-20.
Papahadjopoulos D. (1978). Calcium-induced phase changes and fusion in natural and
model membranes. In: Poste G., Nicolson G.L. (Eds.), Membrane Fusion, (Pp 765790). Elsevier, New York .
142
Pasternak T.P., Prinsen E., Ayaydin F., Miskolczi P., Potters G., Asard H., et al. (2002).
The role of auxin, pH, and stress in the activation of embryogenic cell division in
leaf protoplast-derived cells of alfalfa. Plant Physiology, 129, 1807-1819.
Pati P.K. Sharma M. & Ahuja P.S. (2005). Extra thin alginate film: An efficient technique
for protoplast culture. Protoplasma, 226, 217-221.
Pelletier G., Primard C., Vedel F., Chetrit P., Remy R., Rouselle P. & Renard M. (1983).
Intergeneric cytoplasmic hybridization in cruciferae by protoplast fusion. Molecular
and General Genetics, 191, 244-250.
Petolino J. (2002). Direct DNA delivery into intact cells and tissues. In: Khachatourians
G.G., McHughen A., Scorza R., Nip W.K. & Hui Y.H. (Eds), Transgenic Plants and
Crops, pp. 137-143. Marcel Dekker, Inc, New York.
Piccirilli M., Pupilli P. & Arcioni S. (1988). Lotus tenuis Wald. & Kit.: in vitro conditions for
plant regeneration from protoplasts and callus of various explants. Plant Science, 55,
77-82.
Potrykus I. (1990). Gene transfer to cereals. An assessment. Biotechnology, 8, 535-542.
Potrykus I. & Shillito R.D. (1986). Protoplasts: isolation, culture, plant regeneration.
Methods in Enzymology, 118, 549-578.
Power J.B., Cummins S.E. & Cocking E.C. (1970). Fusion of isolated plant protoplasts.
Nature, 225, 1016-1018.
Puolimatka M. & Karp A. (1993). Effect of genotype on chromosome variation in tissue
culture of inbred and outbred rye. Heredity, 71, 138-144.
Pupilli F., Arcioni S., Damiani F. & Pezzotti M. (1990). Plant regeneration from callus and
protoplast cutures of Lotus pedunculatus. Plant Cell Tissue and Organ Culture, 23, 193199.
Raikar S.V., Bryant C., Braun R., Conner A.J. & Christey M.C. (2007). Whole genome
amplification from plant cell colonies of somatic hybrids using strand displacement
amplification. Plant Biotechnology Reports,1, 175-177.
143
Ramulu K.S., Dijkhuis P., Famelaer I., Cardi T. & Verhoeven H.A. (1994). Cremart: A
new chemical for efficient induction of micronuclei in cells and protoplasts for
partial genome transfer. Plant Cell Reports, 13, 687-691.
Rasheed J.H., Al-Mallah M.K., Cocking E.C. & Davey M.R. (1990). Root hair protoplasts
of Lotus corniculatus L. (birdsfoot trefoil) express their totipotency. Plant Cell Reports,
8, 265-269.
Roldan Ruiz I., Van Laecke K., De Riek J., Dendauw J., Depicker A., Van Bockstaele E.,
et al. (1997). The use of AFLP markers for the identification of ryegrass (Lolium
spp.). In: Van Lacke K, De Riek J, Van Bockstaele E, De Loose M, Krajewski P,
Kaczmarek Z. (Eds.), Advances in Biometrical genetics. Proc. Tenth meeting of the
EUCARPIA Section Biometrics in Plant Breeding, (Pp 231-237.). Institute of Plant
Genetics Poznan Poland. 14-16 May.
Roldan Ruiz I., Dendauw J., Van Bockstaele E., Depicker A. & De Loose M. (2000).
AFLP markers reveal high polymorphic rates in ryegrasses (Lolium spp.) Molecular
Breeding, 6, 125-134.
Rose R.J., Thomas M.R. & Fitter J.T. (1990). The transfer of cytoplasmic and nuclear
genomes by somatic hybridisation. Australian Journal of Plant Physiology, 17, 303-321.
Sakamoto K. & Takeguchi T. (1991). Regeneration of intergeneric somatic hybrid plants
between Lycopersicon esculentum and Solanum muricatum. Theoretical and Applied Genetics,
81, 509-513.
Salisbury F. B. & Ross, C. W (1992). Plant Physiology and Plant Cells. In: Plant Physiology,
Wadsworth, Inc., Belmont, CA 3-26.
Scott D., Maunsell L.A., Keoghan J.M., Allan B.E., Lowther W.L. & Cossens G.G.
(1995). A Guide to Pastures and Pasture Species for the New Zealand High
Country: In: Round-Turner Nick & David Ryde (Eds.) Grassland Research & Practice
Series No. 4, New Zealand Grassland Association Incorporated, Palmerston North,
New Zealand.
144
Sharma H.C., Crouch J.H., Sharma K.K., Seetharama N. & Hash C.T. (2002).
Applications of biotechnology for crop improvement: prospects and constraints.
Plant Science, 163, 381-395.
Sherraf I., Tizroutine S., Chaput M.H., Allot M., Mussio I., Sihachakr D., Rossignol L. &
Ducreux G. (1994). Production and characterisation of intergeneric somatic hybrids
through protoplast electrofusion between potato (Solanum tuberosum) and Lycopersicon
pennellii. Plant Cell Tissue and Organ Culture, 37, 137-144.
Shiba T. & Sugawara K. (2005). Resistance to the rice leaf bug, Trigonotylus caelestialium, is
conferred by Neotyphodium endophyte infection of perennial ryegrass, Lolium perenne.
Entomologia Experimentalis et Applicata, 115, 387–392.
Shillito R.D., Paszkowski J. & Potrykus I. (1983). Agarose plating and a bead type culture
technique enable and stimulate development of protoplast derived colonies in a
number of plant species. Plant Cell Reports, 2, 244-247.
Sidorov V.A., Menczel L., Nagy F. & Maliga P. (1981). Chloroplast transfer in Nicotiana
based on metabolic complementation between irradiated and iodoacetate treated
protoplasts. Planta, 152, 342-345.
Sidorov V. A., . Yevtushenko D. P, Shakhovskyand A. M., & Gleba Y. Y (1994). Cybrid
production based on mutagenic inactivation of protoplasts and rescuing of mutant
plastids in fusion products: Potato with a plastome from S. bulbocastanum and S.
Pinnatisectum. Theoretical and Applied Genetics, 88, 525-529.
Siegel M.R., Latch G.C.M. & Johnson M.C. (1985). Acremonium fungal endophytes of
tall fescue and perennial ryegrass: significance and control. Plant Disease, 69, 179183.
Sinha A., Wetten A.C. & Caligari P.D.S. (2003). Effect of biotic factors on the isolation of
Lupinus albus protoplasts. Australian Journal of Botany, 51,103-109.
Skarzhinskaya M., Landgren M. & Glimelius K. (1996). Production of intertribal somatic
hybrids between Brassica napus L. and Lesquerella fendleri (Gray) Wats. Theoretical and
Applied Genetics, 93, 1242–1250.
145
Skerman P.J., Cameron D.G. & Riveros F. (1988). Tropical Forage Legumes FAO
publication.
Skoog F. & Miller C.O. (1957). Chemical regulation of growth and organ formation in
plant tissues cultured in vitro. Symposium of Society of Experimental Biology, 11, 118-131.
Spangenberg G., Vallés M.P., Wang Z.Y., Montavon P., Nagel J. & Potrykus I. (1994).
Asymmetric somatic hybridization between tall fescue (Festuca arundinacea Schreb.)
and irradiated Italian ryegrass (Lolium multiflorum Lam.) protoplasts. Theoretical and
Applied Genetics, 88, 509-519.
Spangenberg G., Wang Z.Y., Wu X.L., Nagel J., Iglesias V. & Potrykus I. (1995a).
Transgenic tall fescue (Festuca arundinacea ) and red fescue (F. rubra) plants from
microprojectile bombardment of embryogenic suspension cells. Journal of Plant
Physiology, 145, 693-701.
Spangenberg G. Wang Z.Y., Wu X.L., Nagel J. & Potrykus I. (1995b). Transgenic
perennial ryegrass (Lolium perenne) plants from microprojectile bombardment of
embryogenic suspension cells. Plant Science, 108, 209-217.
Spangenberg G., Wang Z.Y., Legris G., Montavon P., Takamizo T., Pérez-Vicente R., et
al. (1995c). Intergeneric symmetric and asymmetric somatic hybridisation in Festuca
and Lolium. Euphytica, 85, 235-245.
Spedding C.R.W. & Diekmahns E.D. (1972). Grasses and Legumes in British Agriculture. Bull.
49, Commonwealth Bureau of Pastures and Field Crops. Farnham Royal, Bucks,
England: Commonwealth Agriculture Bureaux.
Sundberg E. & Glimelius K. (1991). Effects of parental ploidy level and genetic
divergence on chromosome elimination and chloroplast segregation in somatic
hybrids within Brassicaceae. Theoretical and Applied Genetics, 83, 81-88.
Sundberg E., Landgren M. & Glimelius K. (1987). Fertility and chromosome stability in
Brassica napus resynthesised by protoplast fusion. Theoretical and Applied Genetics, 75,
96-104.
146
Tabaeizadeh Z., Ferl R.J. & Vasil I.K. (1986). Somatic hybridization in the Gramineae:
Saccharum officinarum L. (Sugarcane)+ Pennisetum americanum (L.) K. Schumm. (Pearl
millet). Proceedings of National Academy of Sciences, USA, 83, 5616-5619.
Takami K., Matsumara A., Yahata M., Imayama T., Kunitake H. & Komatsu H. (2004).
Production of intergeneric somatic hybrids between round Kumquat (Fortunella
japonica Swingle) and ‘Morita navel’ orange (Citrus sinensis Osbeck). Plant Cell Reports,
23, 39-45.
Takamizo T., Spangenberg G., Suginobu K. & Potrykus I. (1991). Intergeneric somatic
hybridization in Gramineae: somatic hybrid plants between tall fescue (Festuca
arundinacea Schreb.) and Italian ryegrass (Lolium multiflorum Lam.). Molecular &
General Genetics, 231, 1-6.
Taylor P.W.J., Ko H.L. & Adkins W.S. (1992). Factors affecting protoplast isolation and
the regeneration of shoot-like structures from protoplast-derived callus of
Sugarcane (Saccharum spp. Hybrids). Australian Journal of Botany, 40, 863-876.
Terakawa T., Sato T. & Koike M. (1992). Plant regeneration from protoplasts isolated
from embryogenic suspension cultures of creeping bentgrass (Agrostis palustris
Huds). Plant Cell Reports, 11, 457-461.
Thom E.R., Burggraaf V.T., Watts R.J. & Hooper R.J. (2003). Relationship of tillering and
morphological characteristics of two perennial ryegrass lines to pulling when grazed
by diary cows. New Zealand Journal of Agricultural Research, 46, 15-25.
Tian D. & Rose R.J. (1999). Asymmetric somatic hybridisation between the annual
legumes Medicago truncatula and Medicago scutellata. Plant Cell Reports, 18, 989-996.
Torello W.A. & Symington A.G. (1984). Regeneration from perennial ryegrass callus
tissue. HortScience, 19(1), 56-57.
van der Maas H.M., de Jong E.R., Rueb S., Hensgens L.A.M. & Krens F.A. (1994). Stable
transformation and long term expression of the gusA reporter gene I callus lines of
perennial ryegrass (Lolium perenne L.) Plant Molecular Biology, 24, 401-405.
147
van Overbeck, J. (1935). Auxin production in the seedlings of dwarf
maize. Plant
Physiology, 13, 587-598.
Vardi A., Breiman A. & Galun E. (1987). Citrus cybrids: production by donor-recipient
protoplast fusion and verification by mitochondrial-DNA restriction profiles.
Theoretical and Applied Genetics, 75, 51-58.
Vasil I.K. (1988). Progress in the regeneration and genetic manipulation of cereal crops
Biotechnology, 6, 397-402.
Vedel F., Chetrit P., Mathieu C., Pelletier G. & Primard C. (1986). Several different
mitochondrial DNA regions are involved in intergenomic recombination in Brassica
napus cybrid plants. Current Genetics, 11, 17-24.
Vessabutr S. & Grant W.F. (1995). Isolation culture and regeneration of protoplasts from
birdsfoot trefoil (Lotus corniculatus). Plant Cell Tissue and Organ Culture, 41: 9-15.
Vos P., Hogers R., Bleeker M., Reijans M., van de Lee T., Hornes M., Frijters A., et al.
(1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research, 23,
4407-4414.
Waghorn G.C., Ulyatt M.J., John A. & Fisher M.T. (1987). The effect of condensed
tannins on the site of digestion of amino acids and other nutrients in sheep fed on
Lotus corniuculatus L. British Journal of Nutrition, 57, 115-126.
Wang Z.Y., Nagel J., Potrykus I. & Spangenberg G. (1993). Plants from cell suspensionderived protoplasts in Lolium species. Plant Science, 94, 179-193.
Wang Y., Waghorn G.C., Barry T.N. & Shelton I.D. (1994). The effect of condensed
tannins in Lotus corniculatus upon plasma metabolism of methionine, cysteine and
inorganic sulphate by sheep. British Journal of Nutrition, 72, 923-935.
Wang Z.Y., Legris G., Vallés M.P., Potrykus I. & Spangenberg G. (1995). Plant
regeneration from suspension and protoplast cultures in the temperate grasses
Festuca and Lolium. In: Terzi M. et al. (eds.), Current Issues in Plant Molecular and Cellular
Biology, (pp. 81-86). Netherlands: Kluwer Academic.
148
Wang Y., Douglas G.B., Waghorn G.C., Barry T.N. & Foote A.G. (1996a). Effect of
condensed tannins in Lotus corniculatus upon lactation performance in ewes. Journal of
Agricultural Science Cambridge, 126, 353-362.
Wang Y., Douglas G.B., Waghorn G.C., Barry T.N., Foote A.G. & Purchas R.W. (1996b).
Effect of condensed tannins upon the performance of lambs grazing Lotus
corniculatus and lucerne (Medicago sativa). Journal of Agricultural Science Cambridge, 126,
87-98.
Wang G.R., Binding H. & Posselt U.K. (1997). Fertile transgenic plants from direct gene
transfer to protoplasts of Lolium perenne L. and Lolium multiflorum Lam. Plant
Physiology, 151, 83-90.
Wang Z.Y., Scott M. & Hopkins A. (2002a). Plant regeneration from embryogenic cell
suspension cultures of Lolium temulentum. In Vitro Cellular & Developmental Biology, 38,
446-451.
Wang Z., Lehmann D., Bell J. & Hopkins A. (2002b). Development of an efficient plant
regeneration system for Russian wildrye (Psathyrostachys juncea). Plant Cell Reports, 20,
797-801.
Wang Y.P., Sonntag K. & Rudloff E. (2003). Development of rapeseed with high erucic
acid content by asymmetric somatic hybridisation between Brassica napus and Cranbe
abyssinica. Theoretical and Applied Genetics, 106, 1147-1155.
Wang Y.P., Sonntag K., Rudloff E. & Chen J.M. (2005). Intergeneric somatic
hybridisation between Brassica napus L. and Sinapis alba L. Journal of Integrative Plant
Biology, 47, 84-91.
Watanabe M., Suzuki K., Kawasaki H. & Watanabe Y. (2002). Differential responses of
Brassica napus and Petunia hybrida to leaf protoplast isolation stress. Physiologia
Plantarum, 114, 645-651.
Webb JK., & Watson EJ. (1991). Lotus corniculatus L.: Morphological and cytological
analysis of regenerants from three sources of tissue and selected progeny. Plant Cell
Tissue and Organ Culture, 25, 27-33.
149
Webb J.K., Woodcock S. & Chamberlain D.A. (1987). Plant regeneration from
protoplasts of Trifolium repens and Lotus corniculatus. Plant Breeding, 98, 111-118.
Widholm J.M. (1972). The use of fluorescein diacetate and phenosafranine for
determining viability of cultured plant cells. Stain Technology, 47, 189-194.
Wilkins P.W. & Humphreys M.O. (2003). Progress in breeding perennial forage grasses
for temperate agriculture. Journal of Agricultural Science, 140 (2), 129-150.
Wright R.L., Somers D.A. & McGraw R.L. (1987). Somatic hybridization between
birdsfoot trefoil (Lotus corniculatus L.) and L. conimbricensis Willd. Theoretical and
Applied Genetics, 75, 151-156.
Wu L., Ye X.D., Wang Z.Y., Potrykus I. & Spangenberg G. (1997). Gene transfer to
ryegrasses: down-regulation of major pollen allergens in transgenic plants. In,
Proceedings of XVIII International Grassland Congress, 1, 35-36. Winnipeg and
Saskatoon.
Xia G.M., Wang H. & Chen H.M. (1996). Plant regeneration from intergeneric
asymmetric hybridisation between wheat (Triticum aestivum L.) and Russian wildrye
(Psathyrostachys juncea (Fisch) nevski) and Couch grass (Agropyron elongatum (Host)
nevski). Chinese Science Bulletin, 41, 1382-1386.
Xia G.M., Li Z.Y., Wang S.L., Xiang F.N., Liu J.Y., Chen P.D. & Liu D.J. (1998).
Asymmetric somatic hybridisation between haploid common wheat and UVirradiated Haynaldia villosa. Plant Science, 137, 217-223.
Xia G.M., Xiang F.N., Zhou A.F., Wang H., He S.X. & Chen H.M. (1999). Fertile hybrid
plant regeneration from somatic hybridisation between Triticum aestivum and
Agropyron elongatum. Acta Botanica Sinica, 41, 349-352.
Xia G.M., Xiang F.N., Zhou A.F., Wang H. & Chen H.M. (2003). Asymmetric somatic
hybridisation between wheat (Triticum aestivum L.) and Agropyron elongatum (Host )
Nevishi. Theoretical and Applied Genetics, 107, 299-305.
150
Xiang F.N., Xia G.M., & Chen H.M. (2003) Effect of UV dosage on somatic
hybridisation between common wheat (Triticum aestivum L.) and Avena sativa L. Plant
Science, 164, 697-707.
Xiao Z., Wan L. & Han B. (2004). An interspecific somatic hybrid between Actinidia
chinensis and Actinidia kolomikta and its chilling tolereance. Plant Cell Tissue and Organ
Culture, 79, 299-306.
Xu X.Y., Liu J.H. & Deng X.X. (2004). Production and characterisation of intergeneric
diploid cybrids derived from symmetric fusion between Microcitrus papuana Swingle
and sour orange (Citrus aurantium). Euphytica, 136, 115-123.
Xu X.Y., Hu Z.Y., Li J.F., Liu J.H. & Deng X.X. (2007) Asymmetric somatic
hybridization between UV-irradiated Citrus unshiu and C. sinensis: regeneration and
characterization of hybrid shoots. Plant Cell Reports, DOI 10/1007/s00299-0070350-7.
Yamada T. & Kishida T. (2003). Genetic analysis of forage grasses based on heterologous
RFLP markers detected by rice cDNAs. Plant Breeding, 122, 57-60.
Yamada Y., Yang Y.Q. & Tang D.T. (1986). Plant regeneration from protoplast derived
callus of rice (Oryza sativa L.). Plant cell reports, 5, 85-88.
Yan C.-Q., Qian K.-X., Yan Q.-S., Zhang X.-Q., Xue G.-P., Huangfu W.-G., et al. (2004)
Use of asymmetric somatic hybridization for transfer of the bacterial blight
resistance trait from Oryza meyeriana L.to O. sativa L. ssp. japonica. Plant cell Reports, 22,
569-575.
Zaghmout O.M.F. & Torello W.A. (1990). Isolation and culture of protoplasts from
embryogenic suspension cultures of red fescue (Festuca rubra L.). Plant Cell Reports, 9,
340-343.
Zaghmout O.M.F. & Torello W.A. (1992). Plant regeneration from callus and protoplast
of perennial ryegrass (Lolium perenne L.). Journal of Plant Physiology, 140, 101-105.
151
Zhou A., Xia G., Zhang X., Chen H. & Hu H. (2001). Analysis of chromosomal and
organellar DNA of somatic hybrids between Triticum aestivum and Haynaldia villosa
Schur. Molecular Genetics and Genomics, 265, 387-393.
Zhou A.F., Chen X.L., Xia G.M. & Chen H.M. (2002). UV-fusion between protoplasts of
common wheat and Haynaldia villosa. Journal of Plant Physiology and Molecular Biology,
28, 305-310.
Zubko M.K., Zubko E.I. & Gleba Y.Y. (2002). Self-fertile cybrids Nicotiana tabacum (+
Hyoscyamus aureus) with a nucleo-plastome incompatibility. Theoretical and Applied
Genetics, 105, 822-828.
152
Acknowledgments
My sincerest gratitude to my supervisors, Dr Mary Christey and Professor Tony Conner
whose guidance, constant encouragement, and support on all frontiers has made this project
a learning curve in my career. I am greatly priviledged to have worked under your guidance.
I thank my associate-supervisor Dr Hayley Ridgway for supporting and encouraging me at
crucial junctures during this project.
I would like to thank Pastoral Genomics, Auckland, New Zealand, and New Zealand
Institute for Crop & Food Research Ltd., New Zealand for financially supporting me. I am
thankful to Foundation for Research Science and Technology, New Zealand for awarding
me the Enterprise Scholarship. Special thanks to Pastoral Genomics, for extending the
financial support for an extra year, without which it would have been very difficult to
complete this project.
I would like to thank Robert H. Braun for his immense support in the laboratory, for having
long discussions and giving me tips which have contributed greatly to the completion of this
work. THANK YOU Robert.
Thanks to Ross Bicknell, Sylvia Erasmuson, and Andrew Catanach for helping me with the
AFLPs and flow cytometry. My grateful appreciation to Ruth Butler for helping me with the
statistical softwares. Thank you Ruth.
My sincere thanks to the Graphics team at Crop & Food, Robert Lamberts for taking
attractive pictures of my specimens, Astrid Erasmuson & Carolyn Barry for helping design
posters at various stages of this project. Thanks also to Sam Wakelin for designing the
graphic pictures and posters.
I would like to thank all members of the Plant Genetic Technologies Team at Crop & Food,
past and present. A big thanks to Annemarie Lokerse who has constantly supported me.
Thanks to Dianne Hall for watering my plants in the glass house.
My thanks to all my past teachers whose teachings have made me qualify for this project.
153
Many thanks to my wife, Deepa, who has stood alongside me in the ups and downs of this
project. I would also like to thank my family members who have encouraged me all
throughout my career.
Lastly but most importantly, I would like to thank my parents who have constantly
supported me and guided me in my endeavours.
154
Appendix 1
Species Description
a.
Lolium perenne L. (Perennial ryegrass)
Lolium perenne (see inset) is a grass belonging to the graminae family Poaceae. It has a diploid
chromosome number of 2n=2x=14.
Leaves of perennial ryegrass are folded in the bud (in contrast to annual ryegrass (Lolium
multiflorum L.) in which the leaves are rolled). Leaf blades are 2 to 6 mm wide, 5 to 15 cm
long, sharply tapered, and keeled. Blades are bright green, prominently ridged on the adaxial
(upper) surface, and smooth, glossy, and glabrous (hairless) on the abaxial (lower) surface.
Leaf margins are slightly scabrous (rough to the touch, covered with minute serrations).
Blades increase in size from the first to the seventh leaf on a tiller, although tillers rarely have
more than three live leaves at one time (Balasko et al., 1995). Leaf sheaths usually are not
keeled, compressed but sometimes almost cylindrical, glabrous, pale green, and reddish at
the base. Sheaths may be closed or split. The collar is narrow, distinct, glabrous, and
yellowish to whitish-green. Auricles are small, soft, and
claw-like. The ligule is a thin membrane, from 0.5 to 2.5
mm, obtuse (rounded at the apex), and may be toothed
near the apex.
The shallow root system is highly branched and
produces adventitious roots from the basal nodes of
tillers. Perennial ryegrass has no rhizomes or stolons. It
will, however, produce a dense and closely knit sward or
turf with high plant densities and proper management
(Spedding & Diekmahns, 1972).
155
b. Lotus corniculatus L. (Bird’s foot trefoil).
Lotus corniculatus (see inset) which belongs to the family Fabaceae, is a tetraploid with
2n=4x=24. It is a glabrous to sparsely pubescent perennial plant, though not a long-lived
perennial with a life span of 2-4 years. Growth form ranges from prostrate to erect with
numerous stems arising from a basal, well developed crown and branches arising from leaf
axils. Primary growth comes from the crown, but regrowth comes from buds formed at
nodes on the stubble left after defoliation. Leaves are pentafoliate, alternately on short stalks
with the two leaflets at the petiole base resembling stipules. The asymmetrical pointed
leaflets are mainly glabrous and are more slender and pale green.
Inflorescences with up to eight flowers are umbellike cymes at the end of long axillary branches.
The calyx is a dentate tube and the yellow fivepetalled corolla is often tinged red. The flowering
period is indeterminate and so seed is set over an
extended period in summer. The self-sterile plants
are cross-pollinated, mainly by honey bees. Seed
pods, 2-5 cm long, contain 15-20 seeds attached
to the ventral suture (Refer Fig 4.1); the seeds are
released by a sudden split of the pod along both
sutures after one to two weeks of ripening during
which the pods change from green to brown. The seeds vary from round to oval in
shape and from greenish yellow to dark brown in colour. The plant root system consists
of a deep taproot with numerous secondary roots that have a good lateral spread. Some
Moroccan genotypes produce rhizomes that arise from axillary buds on stem bases
(Skerman et al., 1988).
156
Appendix 2: Flow cytometric analysis
Profiles generated from the flow cytometric analysis of the fusion parents (L. perenne and L.
corniculatus) and the 14 putative fusion colonies obtained. The fusion colony profiles all
resembled the L. corniculatus profile.
Lotus corniculatus
Lolium perenne cv Bronsyn
cell suspensions
157
L. corniculatus callus
FC2 callus
158
FC3 callus
FC4 callus
159
FC5 callus
FC6 callus
160
FC7 callus
FC8 callus
161
FC9 callus
FC10 callus
162
FC11 callus
FC12 callus
163
FC13 callus
FC14 callus
164
Appendix 3
Polyacrylamlide Gel Preparation
1.1.
Thoroughly clean the small and the large glass plates with Jiff, followed by generous
acetone, then 95% ethanol and facial tissue.
1.2.
In a chemical fume hood, prepare fresh binding solution by adding 6ul of Bind
Silane (methacryloxypropyl-trimethoxy-silane, Sigma M-6514, store at 4oC) to 2 ml of
0.5% acetic acid in 95% ethanol in a 15 ml Falcon tube. Wipe large glass plate using
facial tissue saturated with the freshly prepared binding solution. Be certain to wipe
the entire plate surface with the saturated tissue.
1.3.
Wait 5 minutes for the binding solution to dry. Wipe the glass plate with 95%
ethanol and facial tissue to remove the excess binding solution.
Note: Failure to wipe excess binding solution from the glass plate will cause the gel to stick
to both plates, and the gel will be destroyed upon separation of the glass plates after
electrophoresis.
1.4.
Apply 3 cm splodge of Sigmacote® (Chlorinated organopolysiloxane SIGMA) onto
one side of the other glass plate. With a dry facial tissue tissue, spread the Sigmacote
over the entire surface of the plate.
1.5.
Wait 5 minutes for the Sigmacote to dry. Remove the excess Sigmacote with ethanol
and facial tissue.
1.6.
Place 0.4mm spacers on the large glass plate. Put the small glass plate on the large
one. Assemble the glass plates by using clamps to hold them in place (2 clamps on
each side). Place the gasket, bottom corner first, removing clamps when required.
Note: Take special care to prevent the treated surfaces from touching each other.
1.7.
Pour 6% acrylamide solution (60ml for one gel) into a beaker. For each 60 ml
solution, add, 60ul of TEMED (N,N,N’,N’-Tetraethyl-ethylenediamine) and 600ul of
10% APS (ammonium persulfate) to the acrylamide solution, and mix gently.
1.8.
Suck the acrylamide into a syringe. Take care to remove bubbles. Carefully inject the
acrylamide solution into the space in the gasket.
1.9.
Insert a multi-well sharks-tooth comb, straight side into the gel, between the glass
plates (approximately 6-8 mm of the comb should be between the two glass plates).
Secure the comb with four clamps.
1. 10. Allow polymerisation to proceed for at least 1 hour to overnight.
Note: The gel may be stored overnight at room temperature if a paper towel saturated with
dH20 and plastic wrap are placed around the well end of the gel to prevent the gel from
165
drying out. As an alternative, the gel can be stored overnight by keeping in the
electrophoresis apparatus with 1xTBE buffer in the bottom and top chamber of the
apparatus (see steps 2.1 and 2.5).
2.
Polyacrylamide Gel Electrophoresis
For more efficient use of gel space, one may load one gel multiple times using samples from
either the same or different loci. When loading samples from different loci, load the samples
in order of smallest to largest size ranges, or load the mixed solution of two samples with
equal quantity.
2.1.
Remove the clamps from the polymerised acrylamide gel assembly and clean the
outside of the glass plates with paper towel saturated with dH20.
2.2.
Shave any excess polyacrylamide away from the comb. Remove the comb, and shave
and wash any excess polyacrylamide from the top of the glass plates. Wash surfaces
of the gel setup.
2.3.
Gently lower the gel (glass plates) into the lower slot with the large plate facing out
and the well-side on top. Secure the glass plates, increasing the pressure a little at a
time.
2.4.
Ensure the tap between chambers of the electrophoresis apparatus is closed. Add
1xTBE (1 litre) to the top of the electrophoresis apparatus until the small plate is
well covered. Pour the rest of the TBE into the bottom tank.
2.5.
Using a disposable Pasteur pipette, remove the air bubbles and unpolymerized
acrylamide on the top of the gel. Be certain the well area is devoid of air bubbles,
small pieces of polyacrylamide and urea.
2.6.
Pre-run the gel to achieve a gel surface temperature of approximately 45-50°C. Set
the power constant at 70W and the voltage should be between 1400 and 1800V. Any
higher and the plates may be getting too hot. Pre-run for about half an hour to an
hour.
2.7.
Prepare PCR samples by mixing 8ul of each sample with 5ul of STR 3x-loading
solution, or add 10ul STR to the whole solution.
2.8.
Prepare 500ng molecular weight marker (Marker DNA + 3x STR) for each marker
lane.
2.9.
Denature the samples and markers by heating at 95°C for 1.5-2 minutes and
immediately chill on ice.
166
2.10.
After the pre-run, use a disposable Pasteur pipette to flush the urea from the well
area and carefully insert the sharks-tooth comb teeth into the gel approximately
1-2mm.
2.11.
Load 6ul of each sample and marker into the respective wells. To prevent the gel
from cooling, gel loading should not exceed 20 minutes.
2.12.
Run the gel using the same conditions as the pre-run step (2.6), until Xylene cyanol is
about half way (1.5 to 2 hours).
*In a 4% gel, Bromophenol blue migrates at approximately 40 bases, and Xylene Cyanol
migrates at approximately 170 bases.
3.
Silver Staining
3.1.
After electrophoresis, empty the buffer chamber and carefully loosen the gel clamps.
Remove the glass plates from the apparatus.
3.2.
Place the gel (glass plates) on a flat surface. Remove the comb and the side spacers.
Use a plastic wedge to carefully separate the two glass plates. The gel should be
strongly affixed to the large glass plate.
3.3.
Place the gel (attached to the small plate) in a shallow plastic tray.
3.4.
For silver staining, follow the steps listed below:
Step
a.
b.
c.
d.
e.
f.
g.
h.
Solution
Fix/stop solution
dH20
Repeat step b. twice
Staining solution
dH20
Developer solution (4-10°C)
Fix/stop solution
dH20
Time
30 minutes
2 minutes
2x2 minutes
30 minutes
10 seconds
2-5 minutes
5-6 minutes
2-3 minutes
Note: All steps should be conducted on a shaker and the plates should be well covered by
the solutions.
3.5.
Position the gel upright and allow it to dry overnight.
167
Composition of solutions
4% acrylamide solution (1000 ml)
420 g urea,
450 dH2O
100 ml 10x TBE
100 ml 40 % acrylamide/bis-acrylamide (19:1)
6% acrylamide solution (500mls)
75mls 40% acrylamide:bis
230g urea (=>7.67M)
50mls 10X TBE
Add acrylamide with some water and add half the urea, stir. Add rest of
urea. Incubate at 37 dgrees to aid disolving in a shaking water-bath. Add
the TBE and make up to volume.
0.5% acetic-acid in 95% ethanol
Add l ml of glacial acetic acid to 199 of 95% ethanol
10% APS (ammonium persulfate)
Add 1.0g of ammonium persulfate to 10 ml of dH2O
Developer solution
sodium carbonate
37% formaldehyde (H2CO)
10mg/ml sodium thiosulfate (Na2S20.5HO)
90g
4.5ml
600 µl
120gm
6ml
800µl
dH2O
To 3L
To 4l
Note: Prepare the solution and chill to 10'C before use. Prepare fresh before each use. The
sodium carbonate can be dissolved and chilled overnight in the cold room. Add the
formaldehyde and sodium thiosulfate before use.
Staining solution:
2 g silver nitrate (AgNO3)
3 ml 37% formaldehyde (H2CO)
2000 ml dH2O
Fix/stop solution (10% acetic acid)
200 ml glacial acetic acid
1800 ml dH20
168
3g
4.5
To 3L
300ml
2.7L
4g
6ml
To 4 L
400ml
3.6 L
Appendix 4
Publications and presentations
Publications
Raikar S. V., R. H. Braun, C. Bryant, T. Conner & M. C. Christey (2007). Efficient isolation,
culture and regeneration of Lotus corniculatus protoplasts. Plant Biotechnology Reports
(under review).
Raikar S.V., Bryant C., Braun R., Conner A.J. & Christey M.C. (2007). Whole genome
amplification from plant cell colonies of somatic hybrids using strand displacement
amplification. Plant Biotechnology Reports,1, 175-177.
Raikar S.V., M.C. Christey, A.J. Conner, R. Braun, & C. Bryant. (2006). Protoplast isolation,
colony formation and shoot regeneration from Lolium perenne, p. 41-44. In C.F. Mercer
(ed.), Advances in pasture plant breeding: Papers from the 13th Australasian Plant Breeding
Conference. Grassland Research and Practice Series No. 12. New Zealand Grassland
Association, Dunedin, New Zealand.
Oral Presentations
Raikar S. V., R. H. Braun, C. Bryant, T. Conner & M. C. Christey (2007). Asymmetric
somatic hybridisation between Lolium perenne (Monocot) and Lotus corniculatus (Dicot).
New Zealand Institute for Agricultural and Horticultural Science Convention, Lincoln,
New Zealand. 13-15th August 2007.
Raikar S. V., R. H. Braun, C. Bryant, T. Conner & M. C. Christey (2007). Asymmetric
somatic hybridization between Lolium perenne (Monocot) and Lotus corniculatus (Dicot)
17th Biennial meeting The New Zealand Branch IAPTC&B Rotorua, New
Zealand. February, 2007.
Raikar S. V., M. C Christey, T. Conner, & R. Braun (2005). Protoplast isolation and colony
formation from Lolium perenne 16th
Biennial meeting The New Zealand
Branch IAPTC&B Methven, New Zealand. February, 2005.
169
Poster Presentations
Raikar S. V., R. H. Braun, C. Bryant, T. Conner & M. C. Christey (2007). Whole genome
amplification of small protoplast fusion colonies using strand displacement
amplification.
17th Biennial meeting The New Zealand Branch IAPTC&B
Rotorua, New Zealand. February, 2007.
Raikar S. V., M. C Christey, C. Bryant, T. Conner, & R. Braun (2006). Genetic Variation in
Lolium perenne for callus induction and protoplast isolation. 11th International Congress
for Plant Tissue Culture and Biotechnology Beijing, China.
Raikar S. V., M. C Christey, C. Bryant, T. Conner, & R. Braun (2006). Protoplast isolation,
colony formation and shoot regeneration from Lolium perenne L. 13th Australasian Plant
Breeding Conference, Christchurch New Zealand.
170