Current Research Journal of Biological Sciences 4(3): 315-322, 2012
ISSN: 2041-0778
© Maxwell Scientific Organization, 2012
Submitted: January 23, 2012
Accepted: March 08, 2012
Published: April 05, 2012
Evaluation of the Effects of Chlorophyllin on Apoptosis Induction, Inhibition of
Cellular Proliferation and mRNA Expression of CASP8, CASP9, APC and $-catenin
Diogo Campos Vesenick, Natália Aparecida de Paula, Andressa Megumi Niwa and
Mário Sérgio Mantovani
Laboratório de Genética Toxicológica, Departamento de Biologia Geral, Centro de Ciências
Biológicas, Universidade Estadual de Londrina-CCB/UEL, Londrina-PR, Brazil
Abstract: Chlorophyllin is a semi-synthetic derivative of chlorophyll with antioxidant and antimutagen
properties that controls the enzymes involved in the metabolism of xenobiotics and in the induction of
apoptosis. In this study, we evaluated the effects of chlorophyllin on apoptosis induction, inhibition of cell
proliferation, and gene expression in the human colorectal adenocarcinoma cell line HT29. Chlorophyllin
significantly reduced cell survival after 48 h at 100 :g/mL and after 24 h at 500 or 1,000 :g/mL, respectively
based on both MTT cytotoxicity and cell proliferation kinetics assays. These effects were dose dependent.
Chlorophyllin did not induce apoptosis after 24 h at any concentration. Chlorophyllin downregulated the cell
cycle genes APC and $-catenin (CTNNB1) but did not affect the expression of apoptotic induction genes in the
extrinsic pathway (CASP8) or the intrinsic pathway (CASP9). At the studied concentrations, the inhibitory
effect of chlorophyllin on cell growth was directly related to the regulation of $-catenin gene expression and
not to APC expression, because APC was mutated and inactive. The studied concentrations suggest no potential
for chlorophyllin as an apoptosis inducer based on cytomorphological changes or gene expression changes of
the studied caspases.
Key words: APC gene, $-catenin, chlorophyllin, CTNNB gene, HT29 cells, proliferation
effects, antioxidant effects, and regulating detoxification
and apoptosis induction (Ferruzzi and Blakeslee, 2007).
Its antimutagenic effects and the absence of
significant toxicity in humans and animals (Ong et al.,
1986) make chlorophyllin an ideal chemopreventive
compound. In vitro, this molecule can protect against the
mutagenic effects of direct and indirect dietary and
environmental mutagens, such as heterocyclic amines
(Dashwood et al., 1991), benzo(a) pyrene (Arimoto et al.,
1993; Ferruzzi et al., 2002), aflatoxin (Dashwood et al.,
1991), heavy metals (Olvera et al., 1993) and ionizing
radiation (Abraham et al., 1994; Madrigal-Bujaidar et al.,
1997; Santosh Kumar et al., 1999). Antimutagenic effects
of chlorophyllin and other vegetable extracts have been
demonstrated in several model systems: Salmonella
typhimurium (Bronzetti et al., 1990), Drosophila (Negishi
et al., 1989), and mammalian cell cultures (Bez et al.,
2001; Rampazo et al., 2002; Negraes et al., 2004).
Chlorophyllin inhibits carcinogenesis in trout, rats,
and mice by forming complexes with several mutagenic
agents in the diet (Dashwood, 1997). Egner et al. (2001)
reported that chlorophyllin consumption in Chinese
populations reduced the level of aflatoxin-DNA adducts
in urine, which may lead to a reduced risk of developing
liver cancer in humans.
INTRODUCTION
Recently, there has been a growing interest in the
identification of food components and their derivatives
that can prevent cancer. One of these components is
chlorophyllin, which has a long history of therapeutic use
in traditional medicine. Chlorophyllin is a semi-synthetic
derivative of chlorophyll in which the central magnesium
atom is replaced with copper and the phytol esters are
replaced with sodium, making it soluble in water (Sarkar
et al., 1994). As a result of these changes, chlorophyllin
is more stable than chlorophyll (Sarkar et al., 1995)
because it is more resistant to light and heat. Similarly, it
is used worldwide as a food dye.
Chlorophyllin has been widely studied due to its
beneficial biological effects, including wound healing
(Edwards, 1954) and anti-inflammatory properties (Larato
and Pfau, 1970), treatment of kidney stones by controlling
calcium oxalate crystals (Tawashi et al., 1980) and as an
internal deodorant (Young and Beregi, 1980). Although
these applications illustrate the potential for chlorophyllin
use in clinical settings, its role in cancer chemoprevention
has gained most of the attention. This pigment has shown
significant in vitro and in vivo biological effects
consistent with cancer prevention, such as antimutagenic
Corresponding Author: Mário Sérgio Mantovani, Laboratório de Genética Toxicológica, Departamento de Biologia Geral, Centro
de Ciências Biológicas, Universidade Estadual de Londrina-CCB/UEL, Londrina-PR, Brazil
315
Curr. Res. J. Biol. Sci., 4(3): 315-322, 2012
In addition to being an effective carcinogenesis
inhibitor, chlorophyllin is capable of inducing apoptosis
and inhibiting cell proliferation. In HCT116 human colon
cancer cells, chlorophyllin induces apoptosis by activating
caspase-8 (Diaz et al., 2003). Likewise, chlorophyllin
induces apoptosis and inhibits cell proliferation in MCF-7
cells(Chiu et al., 2005); however, the mechanisms have
not been completely elucidated.
Recently, the chemoprotective ability and the
mechanisms of action of chlorophyllin in apoptosis and
cell proliferation have been investigated to develop new
pharmacological agents for cancer prevention. For this
reason, this study evaluated the roles of chlorophyllin in
apoptosis induction and inhibition of cell proliferation as
well as the possible mechanisms involved in these cellular
processes by analyzing the expression of genes related to
apoptosis (CASP8 and CASP9) and cell proliferation
(APC and $-catenin (CTNNB1).
removed from the wells and dimethyl sulfoxide was
added to dilute the crystals that had formed. The samples
were read in a microplate reader at 550 nm. The
experiments were performed in triplicate. The following
equation was used to calculate the percentage of cell
survival:
survival (%) = TS!BS/CS!BS
Legend:
TS = Mean absorbance of the treated samples
BS = Mean absorbance of the blank samples
CS = Mean absorbance of the control samples
Cell proliferation kinetics assay: For the proliferation
kinetic analysis, 1.3×105 cells were seeded into each
culture tube (10 cm2) with one of the following
treatments: control (culture media), anti-proliferative
agent (cisplatin 1 :g/mL), and chlorophyllin at either 100
or 500 :g/mL. After each treatment period (24, 48, or 72
h, respectively), the culture media and the two 2.5 Ml
Phosphate-Buffered Saline (PBS) washes were saved.
Then, cells were trypsinized for approximately 5 min,
inactivated with the saved media, and centrifuged for 5
min at 1,080 rpm. The supernatant was discarded, leaving
only 1 mL. Cell counts after collection by trypsinization
were performed in a Neubauer chamber. A proliferation
kinetics curve was generated at the determined time
points. The experiment was performed in three
repetitions.
MATERIALS AND METHODS
Chemical agents: Chlorophyllin (Sigma-Aldrich) was
dissolved in D-MEM (Gibco) culture medium and filtersterilized (Millex® 0.22 µm, Millipore). The positive
controls agents were doxorubicin (CAS 25316-40-9,
Adriblastina®, Pharmacy) in the MTT cytotoxicity assay
(10 :g/mL) cisplatin (CAS 15663-27-1, Sigma-Aldrich)
in the cell proliferation kinetics and cell viability assays
(1 :g/mL) and camptothecin (CAS 7689-03-4, Acros
Organics) in the apoptosis induction assay (10 :g/mL).
Cell culture: The colorectal adenocarcinoma cell line
(HT29) used in this study was obtained from the Rio de
Janeiro Cell Bank. These cells were cultured in 25 cm2
culture flasks in D-MEM supplemented with 10% fetal
bovine serum (Gibco) and an antibiotic/antimycotic
(0.1%) at 37ºC and 5% CO2. This study was conducted in
Laboratory Toxicological Genetics 2011 in the State
University of Londrina, Londrina, Paraná, Brazil.
Cell viability assay-trypan blue: For the cell viability
analysis, 1.3x105 cells were seeded into each experimental
flask. Manual counting in a Neubauer chamber and
Trypan blue dye exclusion techniques were used. This
assay was performed concomitantly with the cell
proliferation kinetics assay. After obtaining 1 mL of cell
suspension in the cell proliferation kinetics assay, 20 :L
of this suspension was mixed with an equal volume of
Trypan blue. Therefore, the dilution factor was 2. Next,
20 :L of Trypan blue-containing suspension was placed
on the chamber surface. Then, cells were counted under
an optical microscope. The assay was performed in three
repetitions.
Cytotoxicity assay: The 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) assay was performed
following the protocol first described by Mossmann
(1983). The assays were performed in a 24-well cell
culture plate with 3×104 cells seeded in each well, except
for the control wells without cells. Cells were cultured for
24 h to allow attachment. The culture medium was then
discarded, and fresh medium with the following
treatments was added for 24, 48, or 72 h, respectively:
control (culture media), doxorubicin at a concentration of
10 :g/mL, and chlorophyllin at 100, 500, or 1,000 :g/mL,
respectively. After treatment, the culture medium was
discarded, and fresh media containing 0.167 mg/mL MTT
was added to each well. The plate was incubated for 4 h.
Following incubation, the MTT-containing medium was
Assay for evaluating apoptosis induction: A six-well
plate containing a coverslip (18 × 18 mm) in each well
was seeded with 1.6×105 cells. After 24 h of culture to
allow the cells to adhere to the coverslip, the following
treatments were tested: control (culture media), apoptosis
inducer (camptothecin 10 :g/mL) and two concentrations
of chlorophyllin (100 and 500 :g/mL). After treatment,
cells were collected following the procedure described by
Rovozzo and Burke (1973). Briefly, cells were washed
with PBS, and the coverslips were removed from the
culture plate and fixed in Carnoy fixative for 5 min. The
316
Curr. Res. J. Biol. Sci., 4(3): 315-322, 2012
Table 1: Sequences of the primers used for real-time PCR
Gene
Primers
GAPDH
F:5’ACAAGATTGTGAAGG TCG GTG TCA 3’
R:5’AGCTTCCCATTCTCAGCCTTGACT 3’
CASP8
F:5’GCAAAAGCACGGGAGAAAGT 3’
R:5’TGCATCCAAGTGTGTTCCATT3’
CASP9
F:5’GCTCTTCCTTTGTTCATCTCC 3’
R:5’GTTTTCTAGGGTTGGCTTCG 3’
APC
F:5’AAAGCGCCATGATATTGCACGGTC 3’
R:5’TGTTTGCTGTGCTCACGTTTCCAG 3’
CTNNB1
F:5’CCTATGCAGGGGTGGTCAAC3’
R:5’CGACCTGGAAAACGCCATCA3’
References/accession # (NCBI)
(Sugaya et al., 2005)
(Castaneda and Rosin-Steiner, 2006)
(Chen et al., 2009)
Constructed/ M 74088
Constructed/NP-064633
SYBR Green (Platinum SYBR Green qPCR SupermixUDG, Invitrogen) upon binding to double-stranded DNA.
The thermocycler conditions were as follows: cDNA
denaturation at 50ºC for 1 min and 95ºC for 3 min,
followed by 35 cycles at 95ºC for 20 sec, primer
annealing at 60ºC for 30 sec, and elongation at 72ºC for
20 sec, followed by 95ºC for 10 sec and 40ºC for 1 min.
A melting curve analysis was performed at the end of the
reaction with 0.5ºC steps from 50 to 95ºC for 5 sec each.
Data were normalized with primers for glyceraldehyde-3phophodehygrogenase (GAPDH) amplified in conjunction
with the experiment. The primers used in the PCR
experiments are shown in Table 1. All experiments were
performed on two independent cultures, and each cDNA
sample was analyzed in triplicate for each primer.
coverslips were dipped in plates containing decreasing
concentrations of ethanol (95 to 25%), followed by a
wash in McIlvaine buffer for 5 min, staining with acridine
orange (0.01%, 5 min), and another wash in buffer. The
coverslips were inverted onto a slide containing a drop of
buffer and sealed with nail polish. The slide was analyzed
under a fluorescent microscope (420-490 nm excitation
filter and a 520 nm barrier filter). The experiments were
performed in three repetitions, and 1,500 cells were
analyzed per treatment. Apoptotic cells were identified by
analyzing morphological changes in cells, including
chromatin condensation, formation of apoptotic bodies, or
nuclear DNA fragmentation after acridine orange staining.
Quantitative real-time reverse-transcription PCR
(qRT-PCR): A qRT-PCR experiment was performed
following instructions provided in the guidelines of the
Minimum Information for Publication of Quantitative RTPCR Experiments MIQE (Bustin et al., 2009). First, 106
cells were seeded in 25 cm2 culture flasks, and cultures
were established for 24 h. After the incubation period, the
treatments (control, chlorophyllin) were performed in
duplicate. Total RNA was isolated using Trizol-LS
reagent (Invitrogen) after 12 h of treatment following the
manufacturer’s instructions. The samples chosen for the
experiment were those with a 260 nm/280 nm absorbance
ratio between 1.9 and 2.1. Sufficient quantities of intact
genomic RNA were run on a 0.8% agarose gel and were
used to synthesize cDNA. Two microliters of DNTPs (10
mM; Invitrogen), 1 :L oligo(dT) (10 pmol/µL;
Invitrogen), and 500 ng genomic RNA were mixed and
brought to a volume of 14.9 :L with DEPC water (1%).
The reaction was incubated for 5 min at 65°C in a
thermocycler (TECHNE TC 412) and rapidly transferred
to ice. Four microliters of Mlv 5x buffer (Invitrogen), 0.1
:L ribonuclease inhibitor (RNase out, Invitrogen), and 1
:L reverse transcriptase (M-Mlv-RT, Invitrogen) were
then added. The total volume was 20 :L. Finally, the
reaction was incubated in a thermocycler at 37°C for 50
min and at 70°C for 15 min. The obtained cDNA was
stored in a 80ºC freezer. Real-time PCR was performed in
a PTC 200 DNA Engine Cycler with a Chromo 4
detection system (MJ Research-BIO RAD). Amplification
was detected by measuring fluorescence emission from
Statistical analysis: Data from the MTT cytotoxicity
assay were analyzed using analysis of variance (ANOVA)
followed by Tukey’s test (" = 0.05) using the GraphPad
Prism5 program. Data obtained in the cell proliferation
kinetics, cell viability and apoptosis induction assays were
analyzed using ANOVA followed by Dunnett’s test (" =
0.05) using GraphPad Prism5. The expression levels were
determined by the method of Pfaffl et al. (2002) and
analyzed with REST-384 software.
RESULTS
Analysis of cytotoxicity: As demonstrated by the MTT
assay, chlorophyllin decreased the cell survival rate in a
dose-dependent manner (Fig. 1). At 24 h, only the 100
:g/mL concentration had a survival rate equivalent to the
control or, in other words, was not cytotoxic. All
concentrations (100, 500, and 1000 :g/mL, respectively)
significantly decreased the survival rate compared to
controls at 48 and 72 h. Therefore, they were cytotoxic.
Based on these results, the 100 and 500 :g/mL
concentrations were chosen for the other assays.
To better understand the cytotoxic effects of the
chosen chlorophyllin concentrations (100 and 500
:g/mL), we evaluated the cell proliferation kinetics at 24,
48 and 72 h, respectively. Figure 2 shows that 100 :g/mL
chlorophyllin did not significantly change the HT29 cell
proliferation rate at 24 h. However, 500 :g/mL
317
Curr. Res. J. Biol. Sci., 4(3): 315-322, 2012
24h
48h
27h
140
45
40
100
***
80
Apoptotic cells
Cells survival (%)
120
*
***
60
***
***
40
***
20
***
35
30
25
20
15
10
5
0
*** ***
500
Camptotecin
100
Chlorophyllin concentration (µg/mL)
0
100
500
1000
Chlorophyllin concentration (µg/mL)
Fig. 4: Average number of apoptotic cells identified by acridine
orange staining in HT29 cells treated with chlorophyllin
for 24 h. Camptothecin: 10 :g/mL; ***: p<0.001
compared to control
Fig. 1: Cell survival percentages. Calculations are based on
absorbance levels obtained from the MTT test on HT29
cells treated with chlorophyllin for 24, 48, or 72 h
(control = 100%); Error bars represent the
mean±standard deviation from three independent
experiments; *: p<0.05; ***: p<0.001 compared to
control
-2.5
100µg/mL
500µg/mL
**
16
Cells number × 10
5
14
12
Control
Cisplatin
100 µg/mL
150 µg/mL
**
-1.5
-1.0
10
-0.5
8
***
**
6
***
0.0
***
4
*
**
2
APC
***
0
24
48
Time (hours)
72
Fig. 2: Cell proliferation kinetics. Total cell counts were
obtained by counting HT29 cells in a Neubauer chamber
after 24, 48 and 72 h of chlorophyllin treatment.
Cisplatin: 1 :g/mL; *: p<0.05; **: p<0.01; ***:
p<0.001 compared to control
1.4
1.2
Relative expression
120
24h
48h
27h
100
80
*
***
60
β-catenin
Fig. 5: Analysis of the relative expression of the APC and $catenin genes by RT-PCR in HT29 cells after 12 h of
chlorophyllin treatment at 100 or 500 :g/mL; **:
p<0.01 compared to control (the statistical analysis was
done using REST-384 software)
***
0
Cell viability (%)
**
**
-2.0
100µg/mL
500µg/mL
1.0
0.8
0.6
0.4
0.2
***
0
CASP8
40
CASP9
Fig. 6: Analysis of CASP8 and CASP9 expression in HT29 cells
by RT-PCR after 24 h of chlorophyllin treatment at 100
or 500 m :g/mL; **: p<0.01 compared to control (the
statistical analysis was done using REST-384 software)
20
0
100
500
Control
Cisplatin
Chlorophyllin concentration (µg/mL)
chlorophyllin significantly decreased cell proliferation at
all time points. This reduction was dose-dependent at the
studied concentrations. The positive control (cisplatin 1
:g/mL) was significantly cytotoxic compared to the
negative control after 24 h of treatment.
Fig. 3: Percentage of cell viability in HT29 cells treated with
chlorophyllin for 24, 48 or 72 h. Cisplatin: 1 :g/m;
Error bars represent mean±standard deviation of three
independent experiments; *: p<0.05; ***: p<0.001
compared to control
318
Curr. Res. J. Biol. Sci., 4(3): 315-322, 2012
To determine if the antiproliferative effects observed
in the proliferation kinetics assay were due to cell death
or to decreased cell proliferation, we analyzed cell
viability. The results in Fig. 3 show that a concentration
of 100 :g/mL at 24 and 48 h and 500 :g/mL at 24 h
induced a survival rate greater than 80% and were similar
to the control. However, the higher concentration
promoted statistically lower cell viability rates at 48 and
72 h, as did the 100 :g/mL concentration at 72 h.
2006). However, this assay, which is commonly referred
to simply as a cytotoxicity assay, not only evaluates cell
death but can also show cell growth inhibition or
cytostatic effects.
In this study, we showed that a minimum
chlorophyllin concentration of 500 :g/mL was necessary
for cytotoxicity at 24 h. This concentration reduced the
cell survival rate by approximately 20%. Cytotoxicity was
observed starting at 48 h for the lower concentration.
Currently, the Food and Drug Administration allows three
200 mg chlorophyllin tablets to be ingested daily. This
dose has been effective in preliminary studies of
populations at risk for aflatoxin B1 exposure (Egner et al.,
2001), but little is known about the actual concentrations
in situ, systemically, or in the gastrointestinal tract of this
oral dose. Rats do not exhibit toxic effects from long-term
exposure to chlorophyllin concentrations as high as 1-3%
in the diet, which produce plasma chlorophyllin
concentrations of 56 to 116 :g/mL (Harrison et al., 1954).
Data from the cell proliferation kinetics study, which
showed the cell growth curve after different treatment
periods, were consistent with the results from the MTT
assay. In this analysis, the highest concentration
diminished cell proliferation starting at 24 h of exposure.
At the lowest concentration, cell growth was inhibited at
48 h. Therefore, chlorophyllin had an antiproliferative
effect on tumor cells.
Likewise, the proliferation assay showed that
chlorophyllin induced a dose-dependent decrease in cell
growth, but viability analysis demonstrated that cell
processes were responsible for this inhibition. The cell
viability assay, performed concurrently with the cell
proliferation kinetics assay, showed that more than 80%
of cells were viable in samples with the highest
chlorophyllin concentration at 24 h and in samples with
the lowest concentration at 48 h. This pattern indicates
that the inhibition was not due to apoptosis or changes in
cell permeability but to apoptosis-independent inhibition
of cell proliferation. Lower concentrations of
chlorophyllin have cytostatic effects, while higher
concentrations are cytocidal in mouse myeloma cell lines
(Chernomorsky et al., 1997). This outcome may indicate
that cytostatic effects of chlorophyllin used as a coadjuvant with a chemotherapeutic agent that causes cell
death may have beneficial effects on cancer treatment. In
acute treatments, chlorophyllin would be used to reduce
cell growth with low toxicity and could be used for longer
times, while chemotherapy would promote cancer cell
death.
Given the inhibitory effects of chlorophyllin, we
investigated the molecular mechanism of this compound
by studying gene expression levels of APC and CTNNB1.
APC regulates cell division by binding to $-catenin and
targeting it for degradation in the proteasome (Wang
et al., 2006). $-Catenin, which is present in the
cytoplasm, binds to and activates transcription factors that
promote cell division (e.g., cyclin-D1). $-Catenin
Apoptosis induction analysis: Figure 4 shows the results
from the apoptosis induction analysis after 24 h of
chlorophyllin treatment at concentrations of 100 and 500
:g/mL. No concentrations induced apoptosis, as the
results were similar to the negative control. No apoptotic
cells were seen in the negative control. Conversely, the
positive control (camptothecin 10 :g/mL) significantly
induced apoptosis compared to the negative control after
24 h of treatment.
Gene expression: To further investigate the
antiproliferative effects of chlorophyllin, we analyzed the
expression of genes involved in cell proliferation, namely
APC and $-catenin (CTNNB1), and genes involved in
apoptosis, namely CASP8 and CASP9, in HT29 cells after
12 h of chlorophyllin treatment (100 or 500 :g/mL) by
qRT-PCR.
Analysis of relative expression levels, normalized to
the constitutive gene GAPDH, showed that chlorophyllin
treatment significantly decreased the expression of the
APC gene compared to control (Fig. 5). This decrease was
2.1 times lower with a concentration of 100 :g/mL and
1.99 times at 500 :g/mL. The expression of CTNNB1 was
also significantly lower, with a 1.98-fold decrease at 100
:g/mL and 1.86-fold lower at 500 :g/mL (Fig. 5).
Figure 6 shows the relative expression of the CASP8
and CASP9 genes. Chlorophyllin treatments (100 and 500
:g/mL) did not significantly affect gene expression
compared to the control.
DISCUSSION
Chlorophyllin is a semi-synthetic derivative of
chlorophyll belonging to the porphyrin class of
compounds, and it is commonly used as a food dye. It is
also part of a group of phytochemicals implicated in
cancer prevention (Ferruzzi and Blakeslee, 2007). The
chlorophyll of green vegetables and its derivative,
chlorophyllin, have antigenotoxic effects against several
mutagens in vitro, as well as anticarcinogenic effects in
vivo (Dashwood, 1997) and in clinical studies (Egner
et al., 2001).
To determine the appropriate concentrations to be
used, we performed an MTT cytotoxicity assay. This is a
test used to determine the cytotoxicity of substances, and
it is one of the mostly used and most sensitive methods
for cytotoxicity detection in vitro (Fotakis and Timbrell,
319
Curr. Res. J. Biol. Sci., 4(3): 315-322, 2012
translocation to the nucleus normally occurs in response
to external signals that promote proliferation (Yochum et
al., 2007). However, mutation of the APC gene causes a
loss of $-catenin control, leading to increased cytoplasmic
concentrations and translocation to the nucleus. APC is
mutated in the majority of colon cancers, including HT29
cells, resulting in a non-functioning protein, which, in
turn, leads to uncontrolled cell proliferation (Morin et al.,
1996).
Chlorophyllin decreased the expression of both APC
and CTNNB1 at both tested concentrations. Based on
these results, we propose that chlorophyllin decreases cell
proliferation mainly by decreasing the expression of the
$-catenin gene (a promoter of proliferation). This
outcome leads to a decrease in APC gene expression. APC
inhibition is downstream of decreased $-catenin
expression due to low demand for this protein and a
decreased need for its regulation. According to Carter et
al. (2004), proteomic studies may improve our
understanding of this mechanism.
In human HL-60 (promyelocytic leukemia), K-562
(myelogenous leukemia), MCF-7 (breast carcinoma), and
mouse S-180 (sarcoma) cells, a dose-dependent decrease
in cell density or cell growth has been observed after 72
h of chlorophyllin treatment at 25, 50, 100, 200 or 400
:g/mL, respectively (Chiu et al., 2003). Similarly, the
authors showed a decrease in cyclin-D1 and cyclin-E by
western blot and flow cytometry, respectively, in MCF-7
cells treated with chlorophyllin at either 200 or 400
:g/mL for 72 h, suggesting a possible mechanism for cell
cycle control (Chiu et al., 2003). The decrease in cyclinD1 expression might be downstream of decreased $catenin expression, as seen in our study.
Reduced cell proliferation and viability may not only
be due to cytotoxic or cytostatic effects on cells or their
genetic material but could also be due to induction of
apoptosis. Diaz et al. (2003) reported that chlorophyllin
leads to apoptosis in the colon cancer cell line HTC116 at
concentrations of 62.5, 125, 250 and 500 :M (45-360
:g/mL), as identified by morphological observations and
increased protein levels of caspase-8, but not caspase-9.
This pattern suggests that the extrinsic apoptotic pathway
is activated in this type of cancer.
Chiu et al. (2005) have studied the potential of
chlorophyllin as an apoptotic inducer at 200 and 400
:g/mL in MCF-7 breast cancer cells. Their results show
that only the highest concentration (400 :g/mL) caused
increased apoptosis at 24, 48 or 72 h, respectively. In
addition, their study noted an antiproliferative effect at the
highest concentration of chlorophyllin by depleting
cyclin-D1, a cell cycle protein.
We analyzed two chlorophyllin concentrations (100
and 500 :g/mL) through morphological analysis under
fluorescent microscopy and through gene expression
analysis of caspase-8 and-9. The experimental results
from our analysis of morphological changes in cells, such
as chromatin condensation, formation of apoptotic bodies,
and increased caspase expression, show that none of the
studied concentrations induces apoptosis. These
differences between our results and those from previous
studies could be due to the different cell lines used in each
study, showing that different tissues and organs do not
respond in the same way to chlorophyllin treatment and
that some types of cancer are resistant to apoptotic cell
death.
Based on our results, we propose that the cytotoxicity
detected in the MTT assay is not due to cell death;
instead, it might be attributed to decreased cell
proliferation (cytostatic effect), which was confirmed by
our assays. To conclude, chlorophyllin has an inhibitory
effect on cell proliferation in HT29 cells at the studied
concentrations, possibly due to decreased $-catenin
expression. Moreover, chlorophyllin does not induce
apoptosis in this cell line at 24 h, and it has a cytostatic,
not cytocidal, effect.
ACKNOWLEDGMENT
This study was supported by CNPq, CAPES and the
Fundação Araucaria.
REFERENCES
Abraham, S.K., L. Sarma and P.C. Kesavan, 1994. Role
of chlorophyllin as an in vivo anticlastogen:
Protection against gamma radiation and chemical
clastogens. Mutation Res., 322: 209-212.
Arimoto, S., S. Fukuoko, C. Itome, H. Nakano, H. Rai
and H. Hayatsu, 1993. Binding of polycyclic planar
mutagens to chlorophyllin resulting in inhibition of
the mutagenic activity. Mutation Res., 287: 293-305.
Bez, G.C., B.Q. Jordão, V.E.P. Vicentini and
M.S. Mantovani, 2001. Investigation of genotoxic
and antigenotoxic activities of chlorophylls and
chlorophyllin in cultured V79 cells. Mutation Res.,
497: 139-145.
Bronzetti, G., A. Galli and C. Della, 1990. Antimutagenic
effects of chlorophyllin. Basic Life Sci., 52: 463-468.
Bustin, S.A., V. Benes, J.A. Garson, J. Hellemans,
J. Huggett, M. Kubista, R. Mueller, T. Nolan,
M.W. Pfafll, G.L. Shipley, J. Vandesompele and
C.T. Wittwer, 2009. MIQE guidelines: the minimum
information for publication of quantitative real-time
pcr experiments. Clin. Chem., 55: 611-622.
Carter, O., B.S. George and R.H. Dashwood, 2004. The
dietary
phytochemical
chlorophyllin alters
E-cadherin and $-catenin expression in human colon
cancer Cells. J. Nutr., 134: 3441-3444.
Castaneda, F. and S. Rosin-Steiner, 2006. Low
concentration of ethanol induce apoptosis in HepG2
cells: Role of various signal transduction pathways.
Int. J. Med. Sci., 3: 160-167.
320
Curr. Res. J. Biol. Sci., 4(3): 315-322, 2012
Chen, X.Y., J. Liu and K.S. Xu, 2009. Apoptosis of
human hepatocellular carcinoma cell (HepG2)
induced by cardiotoxin III through S-phase arrest.
Exp. Toxicol. Pathol., 61: 307-315.
Chernomorsky, S., R. Rancourt, K. Virdi, A. Segelman
and R.D. Poretz, 1997. Antimutagenicity,
cytotoxicity and composition of chlorophyllin copper
complex. Cancer Lett., 120: 141-147.
Chiu, L.C., C.K.L. Kong and V.E.C. Ooi, 2003.
Antiproliferative effect of chlorophyllin derived from
a traditional Chinese medicine Bombyx mori excreta
on human breast cancer MCF-7 cells. Int. J. Oncol.,
23: 729-735.
Chiu, L.C., C.K. Kong and V.E.C. Ooi, 2005. The
chlorophyllin-induced cell cycle arrest and apoptosis
In human breast cancer MCF-7 cells is associated
with ERK deactivation and cyclin D1 depletion. Int.
J. Mol. Med., 16: 735-40.
Dashwood, R.H., V. Breinholt and G.S. Bailey, 1991.
Chemopreventive properties of chlorophyllin:
inhibition of aflatoxin B1 (AFB1)-DNA binding in
vivo and antimutagenic activity against AFB1 and
two heterocyclic amines in the Salmonella
mutagenicity assay. Carcinogenesis, 12: 939-942.
Dashwood, R.H., 1997. Chlorophylls as anticarcinogens.
Int. J. Oncol., 10: 721-727.
Diaz, G.D., Q. Li and R.H. Dashwood, 2003. Caspase-8
and apoptosis-inducing factor mediate a cytochrome
c-independent pathway of apoptosis in human colon
cancer cells induced by the dietary
phytochemicalchlorophyllin. Cancer Res., 63:
1254-1261.
Edwards, B.J., 1954. Treatment of chronic leg ulcers with
ointment containing soluble chlorophyll.
Physiotherapy, 40: 177-179.
Egner, P.A., J.B. Wang, Y.R. Zhu, B.C. Zhang, Y. Wu,
Q.N. Zhang, G.S. Qian, S.Y. Kuang, S.J. Gange,
L.P. Jacobson, K.J. Helzlsouer, G.S. Bailey,
J.D. Groopman and T.W. Kenspler, 2001.
Chlorophyllin intervention reduces aflatoxin-DNA
adducts in individuals at high risk for liver cancer.
Proc. Natl. Acad. Sci. U.S.A., 98: 14601-14606.
Ferruzzi, M.G., V. Bfhm, P. Courtney and S.J. Schwartz,
2002. Antioxidant and antimutagenic activity of
dietary chlorophyll derivatives determined by radical
scavenging and bacterial reverse mutagenesis assays.
J. Food Sci., 67: 2589-2595.
Ferruzzi, M.G. and J. Blakesleeb, 2007. Digestion,
absorption, and cancer preventative activity of
dietary chlorophyll derivatives. Nutr. Res., 27:
1-12.
Fotakis, G. and J.A. Timbrell, 2006. In vitro cytotoxicity
assays: Comparison of LDH, neutral red, MTT and
protein assay in hepatoma cell lines following
exposure to cadmium chloride. Toxocol. Lett., 160:
171-177.
Harrison, J.W.E., S.E. Levin and B. Trabin, 1954. The
safety and fate of potassium sodium copper
chlorophyllin and other copper compounds. J. Am.
Pharm. Assoc., 18: 722-737.
Larato, D.C. and F.R. Pfau, 1970. Effects of water soluble
chlorophyllin ointment on gingival inflammation.
N.Y. Dent. J., 36: 291-293.
Madrigal-Bujaidar, E., N. Velazquez-Guadarrama and
S. Diaz-Barriga, 1997. Inhibitory effect of
chlorophyllin on the frequency of sister chromatid
exchanges produced by benzo[a]pyrene in vivo.
Mutation Res., 388: 79-83.
Morin, P.J., B. Vogelstein and K.W. Kinzler, 1996.
Apoptosis and APC in colorectal tumorigenesis.
Proc. Natl. Acad. Sci. U.S.A., 93: 7950-7954.
Mossmann, T., 1983. Rapid Colorimetric assay for
cellular growth and survival: Application to
proliferation and cytotoxicity assays. J. Immun.
Meth., 65: 55-56.
Negishi, T., S. Arimoto, C. Nishizaki and H. Hayatsu,
1989. Inhibition of the genotoxicity of 3-amino-1
methyl-5H-pyrido [4,3-b] Indole (trp-P-2-) in
Drosophila by chlorophyllin. Carcinogenesis, 10:
145-149.
Negraes, P.D., B.Q. Jordão, V.E.P. Vicentini and
M.S. Mantovani, 2004. Anticlastogenicity of
chlorophyllin in the different cell cycle phases in
cultured mammalian cells. Mutation Res., 557:
177-182.
Olvera, O., S. Zimmering, C. Arceo and M. Cruces, 1993.
The protective effects of chlorophyllin in treatment
with chromium (VI) oxide in somatic cells of
Drosophila. Mutation Res., 301: 201-204.
Ong, T.M., W.Z. Whong, J.D. Stewart and
H.E. Brockman, 1986. Chlorophyllin: A potent
antimutagen against environmental and dietary
complex mixtures. Mutation Res., 173: 111-115.
Pfaffl, M.W., G.W. Horgan and L. Dempfle, 2002.
Relative expression software tool (REST©) for
group-wise comparison and statistical analysis of
relative expression results in real-time PCR. Nucleic
Acids Res., 30: 1-10.
Rampazo, L.G.L., J.Q. Jordão, V.E.P. Vicentini and
M.S. Mantovani, 2002. Chlorophyllin antimutagenis
mechanism under different treatment conditions in
the micronucleus assay in V79 cells. Cytologia, 67:
323-327.
Rovozzo, G.C. and C.N. Burke, 1973. A manual of Basic
Virological Techniques. Prentice Hall, New Jersey.
Santosh Kumar, S., R.C. Chaubey, T.P.A. Devasagayam,
K.I. Priyadarsini and P.S. Chauhan, 1999. Inhibition
of radiation induced DNA damage in plasmid
pBR322 by chlorophyllin and possible mechanism(s)
action. Mutation Res., 425: 71-79.
Sarkar, D., A. Sharma and G. Talukder, 1994.
Chlorophyll and chlorophyllin as modifiers of
genotoxic effects. Mutation Res., 318: 239-247.
321
Curr. Res. J. Biol. Sci., 4(3): 315-322, 2012
Sarkar, D., A. Sharma and G. Talukder, 1995.
Comparison of the effects of crude extract of
spinach-beet leaves and equivalent amounts of
chlorophyll and chlorophyllin in modifying the
clastogenic activity of chromium (VI) oxide in mice
in vivo. Phytother. Res., 9: 199-202.
Sugaya, S., H. Nakanishi and H. Tanzawa, 2005. Downregulation of SMT3A gene expression in association
with DNA synthesis induction after X-ray irradiation
in nevoid basal cell carcinoma syndrome (NBCCS)
cells. Mutation Res., 578: 327-332.
Tawashi, R., M. Cousineau and M. Sharkawi, 1980.
Effect of sodium copper chlorophyllin on the
formation of calcium oxalate crystals in rat kidney.
Invest. Urol., 18: 90-92.
Wang, R., W.M. Dashwood, G.S. Bailey, D.E. Williams
and R.H. Dashwood, 2006. Tumors from rats given
1, 2-dimethylhydrazine plus chlorophyllin or indole3-carbinol contain transcriptional changes in $catenin that are independent of $-catenin mutation
status. Mutation Res., 601: 11-18.
Yochum, G.S., R. Cleland, S. McWeeney and
R.H. Goodman, 2007. An antisense transcript
induced by Wnt/-$-Catenin signaling decreases
E2F4. J. Bio. Chem., 282: 871-878.
Young, R.W. and J.S. Beregi, 1980. Use of chlorophyllin
in the care of geriatric patients. J. Am. Geriatr. Soc.,
28: 46-47.
322