AN ABSTRACT OF THE THESIS OF
Carlos Rossi for the degree of Master of Science in Crop Science presented on September
2, 2005.
Title: Testing the Effectiveness of Barley Stripe Rust Resistance QTL Detected in
Mexico and the USA Against a Possible New Race in Peru and Mapping of Genes
Conferring Resistance to Leaf Rust and Mildew in the Same Population
Abstract approved:
Redacted for Privacy
Patrick M1 Hayes
Barley is the fourth most important cereal crop in the world because of its broad
adaptation, its utility as a feedstock and for human food, and the superior properties of
barley malt for brewing. Three of the most important foliar diseases of barley, on a
worldwide level are: barley leaf rust caused by Puccinia hordei G. Otth, barley stripe rust
(yellow rust) caused by Puccinia striformis Westend
f sp.
hordei and powdery mildew
caused by Blumeria graminis f. sp. hordei. Although barley is an autogamous species,
there is sufficient DNA-level diversity for efficient linkage map construction and this
polymorphism has been used for extensive mapping and QTL detection efforts. The
ICARDA/CIMMYT barley program is an important source of quantitative disease
resistance genes. Oregon State University and the ICARDA/CIMMYT barley program
have maintained a long-term collaborative effort to map and deploy stripe rust resistance
genes. This germplasm has shown consistent and adequate levels of resistance over the
past 18 years in repeated tests in Mexico and the USA. However, in the 1999-2000
season there were reports from Peru, Bolivia, and Ecuador that there was a new race of
stripe rust that was causing high levels of disease on formerly resistant varieties and
experimental materials. This was cause of concern because considerable effort had been
invested in identifying stripe rust quantitative resistance genes, based on the assumption
that they would prove durable.
We therefore used a well-characterized barley QTL
mapping population - the ORO population - which is derived from the cross of BCD47 x
Baronesse, to determine if barley stripe resistance QTL mapped in Mexico and the USA
were effective in Peru. The same resistances QTL were detected in Peru as in Mexico and
the USA. If there is a new virulence in Peru, the mapped QTL are still effective and
under field conditions do not show specificity to any race the population has been
challenged with in the Americas. This finding is of importance to barley breeders
interested in deploying effective resistance genes. Confirmation of a new race in Peru
will require characterization against a standard set of differentials, an experiment that is
planned.
The increase in disease severity of C110587, a genotype with a mapped
qualitative resistance gene, between Mexico and Peru suggests there is a new race in Peru.
The highest levels of resistance in Peru were achieved in lines where the qualitative
resistance gene was pyramided with quantitative resistance alleles. We also used the
ORO population to map QTL for barley leaf rust and barley powdery mildew in the
Andean region and for the latter disease identified resistance QTL in addition to the Mia
resistance mapped using specific isolates under controlled conditions. The availability of
this germplasm, with mapped genes conferring quantitative resistance to three diseases,
will be a resource for the barley breeding community.
©Copyright by Carlos Rossi
September 2, 2005
All Rights Reserved
Testing the Effectiveness of Barley Stripe Rust Resistance QTL Detected in Mexico and
the USA Against a Possible New Race in Peru and Mapping of Genes Conferring
Resistance to Leaf Rust and Mildew in the Same Population
by
Carlos Rossi
A THESIS
submitted to
Oregon State Univeristy
in partial fulfillment of
the requirements for the
degree of
Master of Science
Presented September 2, 2005
Commencement June 2006
Master of Science thesis of Carlos Rossi presented on September 2, 2005
Redacted for Privacy
Major Professor, representing Crop
Redacted for Privacy
Head of the Department of Crop and Soil Science
Redacted for Privacy
Dean of tl(ekraitiate School
I understand that my thesis will be part of the permanent collection of Oregon State
University libraries. My signature below authorizes release of my thesis to any reader
upon request.
Redacted for Privacy
Carlos Rossi, Author
ACKNOWLEDGEMENTS
I wish to express my eternal gratitude and sincere appreciation to my major
professor Dr. Patrick M. Hayes for his incredible support with me throughout my long
and difficult graduate program. I know that no one except him could understand my
situation.
My sincere appreciation extends to Dr. Isabel Vales who shared with me
invaluable information and guidance. Also a special thanks to Dr. Chris Mundt for
serving on my graduate committee now and at the old version.
To Alfonso Cuesta a special mention for his assistance with data analysis and for
his permanent disposition to help.
A special note of appreciation extended to the OSU barley team integrated by
Patrick Hayes, Ann Corey, Tanya Filichkin, Ariel Castro, Ivan Matus, Luis MarquezCedillo, Jarislav von Zitzewitz, Peter Szucs, and Kelley Richardson; because I believe
that our interaction made an important contribution not only to barley project, but most
significantly in our particular and professional lives.
I want to remember also the help of Dr. Hugo Vivar that kindly contributed with
ideas, data, and opinions during my study.
I also want to acknowledge my previous company CALPROSE that allowed me
to come to OSU the first time, and my actual institute INIA that encouraged me to finish
my degree.
I would like to extend my thanks to Susan Wheeler, who supported my wife and
me during our respective periods in Corvallis to finish our degrees.
An eternal gratitude with my parents, Gladys and Angel.
Finally, a very special thanks to all my divine family; my sons, Manuel, Joaquin
and Francisco and specially to my wife, Marina, who encouraged and supported me all
the time to finish this thesis, I love you so much.
CONTRIBUTION OF AUTHORS
Dr. Patrick M. Hayes had the initiative and the supervision of all aspects of this
project. He substantially contributed in formulating hypothesis and in preparation of this
manuscript. Dr. Isabel Vales contributed previously genotyping data of the population,
ideas and information of markers development. Alfonso Cuesta helped in the mapping
procedure and QTL analysis. Dr. Kazuhiro Sato and Dr. K. Hon contributed markers and
genotyped them in the population. Luz Gomez-Pando and Dr. Gissela Orjeda provided
field data observations and aspects about barley stripe rust changes in Peru. Dr. Roger
Wise performed powdery mildew screening under controlled conditions.
TABLE OF CONTENTS
Page
General Introduction ................................................................................. 1
Testing the effectiveness of barley stripe rust resistance QTL detected in Mexico
and the USA against a possible new race in Peru and mapping of genes conferring
resistance to leaf rust and mildew in the same population .................................... 18
ABSTRACT ................................................................................ 19
INTRODUCTION ......................................................................... 20
MATERIALS AND METHODS ......................................................... 25
RESULTS ................................................................................... 31
DISCUSSION .............................................................................. 44
LITERATURE CITED .................................................................... 52
General Conclusions ................................................................................ 58
Bibliography ......................................................................................... 63
Appendix ............................................................................................. 77
Table IA. Barley stripe rust severity for 23 accessions evaluated in the Toluca
Valley, Mexico 2000, Huancayo, Peru 2000 and 2004 .............................. 78
Table 2A. Primer sequences for expressed sequence tag (EST)-based
marker loci assayed at the Research Institute for Bioresources, Japan and
Oregon State University; sequence tagged site (STS) from GrainGenes and
TIGR assayed at Oregon State University, in the ORO (BCD47 x Baronesse)
population, listed in linkage map order ................................................. 79
LIST OF FIGURES
Page
Figure
1.
Linkage map of the ORO (BCD47 x Baronesse) population based on 94 DH
lines. Dashed lines indicate monomorphic regions. Distances are in Kosambi
cM. The bars to the left of each linkage group indicate 1-LOD intervals for
QTL abbreviated as follows: BSR-P, BSR-M, BSR-U (barley stripe rust
resistance QTL in Peru, Mexico and USA, respectively). SRIT-P (barley stripe
rust infection type QTL in Peru. BLR-P (barley leaf rust resistance QTL in
Peru). PM-P (powdery mildew resistance QTL in Peru). PM-I (powdery
mildew infection type in response to inoculation with Bgh isolates 5874 and
A27, at Iowa State University ............................................................ 33
2. Phenotypic frequency distributions: A) barley stripe rust, B) Barley leaf rust
and C) powdery mildew disease severity in BCD47 and Baronesse and ninety
four doubled haploid (DH) progeny at Huancayo, Peru in 2004 ..................... 35
3.
Phenotypic frequency distribution for infection type in BCD47 (B47) and
Baronesse (Bar) and 94 DH progeny in response to inoculation with powdery
mildew isolates Bgh 5874 and A27 ...................................................... 36
4.
Barley stripe rust disease seventies for selected barley accessions evaluated
at Toluca Valley, Mexico (2000) and Huancayo, Peru (2004). C110587,
D3-6, D3-6/B23, and D3-6/B61 all have a qualitative resistance gene
on chromosome 7H. Cali-sib, Orca, and BCD47 all have quantitative
resistance alleles on chromosome 4H and 5H .......................................... 42
5.
Barley stripe rust seventies for 23 barley accessions sorted by their stripe
rust resistance allele architecture at barley stripe rust resistance QTL on I H,
411, and 5H and a qualitative resistance gene on 7H. Huancayo, Peru (2004) ...... 43
6.
Graphical genotype of the DH line ORO-019 at barley stripe rust, barley leaf
rust and powdery mildew QTL and Mla locus at Huancayo, Peru 2004 ............ 50
LIST OF TABLES
Page
Table
1.
Accessions evaluated for barley stripe rust (BSR) severity in Huancayo, Peru
(2000 and 2004) and in the Toluca Valley, Mexico (2000). The chromosomes
containing mapped BSR resistance QTL are indicated (largest effect QTL are
shown in bold and putative major gene in bold-italic) .................................. 26
2. Barley stripe rust disease severity resistance QTL detected in the ORO population
of 94 DH lines (BCD47/Baronesse) at Huancayo, Peru in 2004; the Toluca
Valley, Mexico (TVM) in 2001, 2002 and Pullman and Mt. Vernon Washigton,
USA (WSU) in 2002 ........................................................................ 38
3. Barley leaf rust (A) and powdery mildew (B) disease severity resistance
QTL detected in the ORO population of 94 DH lines (BCD47/Baronesse)
at Huancayo, Peru in 2004 ................................................................. 40
Testing the effectiveness of barley stripe rust resistance QTL detected in Mexico and
the USA against a possible new race in Peru and mapping of genes conferring
resistance to leaf rust and mildew in the same population
General Introduction
Barley
Cultivated barley, Hordeum vulgare L. subsp. vulgare, is a member of the tribe
Triticeae in the grass family (Poaceae). The wild ancestor of cultivated barley is
Hordeum vulgare L. subsp. spontaneum (Koch). Barley was domesticated about 10,000
years ago in the Near East Fertile Crescent (Nevo, 1992). Cultivated and wild barley have
both winter and spring annual forms. The principal germplasm groups of cultivated
barley are two-row and six-row, which refers to spike morphology. In two-rowed barley,
the lateral spikelets are sterile, while in six-rowed barley all spikelets are fertile (Briggs,
1978). Barley is a self-pollinated diploid (2n = 2x = 14) (Bothmer et al. 1992). The
genome size of barley is approximately 5,000 Mbp, as compared to wheat (17,300 Mbp),
rice (450 Mbp) and Arabidopsis (125 Mbp).
Barley diseases
On a worldwide basis, diseases are one of the principal constraints to barley
production. Plant diseases can proliferate and cause epidemics, which reduce yield and
affect grain quality. Fungi, bacteria, nematodes and viruses are infectious pathogens that
affect barley crops. Fungi are, if not the most abundant plant pathogens, one of the most
important and well characterized. The rust fungi cause some of the most significant
diseases of barley (Line, 2002; Qi et al. 1998) and genetic resistance to rusts has been an
ii
area of intensive research in the Triticeae. Biffen (1905), working with yellow rust of
wheat provided the first proof that a single gene could confer resistance to a pathogen.
The pioneering work on genetic resistance was complicated by the variation in host
reaction at different locations or in response to different isolates. Stakman and coworkers
demonstrated the occurrence of different host genotypes for resistance and different
pathogen genotypes for virulence (physiological races) (Stakman 1914; Stakman et al.
1918). In barley, one of the first reports on pathogen races was made by Mains (1926),
who worked on barley leaf rust using two varieties and two races. A common theme to
these early rust research studies was that classification of races would be most effective if
based on parasitic behavior, not morphology (Levine, 1928). It is now known that there
are many different races of these pathogens around the world, and that they differ in their
virulence on barley varieties. Sets of barley genotypes have been selected as differentials
to identify races within each rust disease. Normally, different qualitative resistance genes
are present in each differential. These differentials are essential for detection of new
virulent rust phenotypes based on infection type ratings at the seedling stage.
The race concept
The now standard use of differentials for monitoring virulence traces back to the
pioneering work of Stakman (1914) and the discovery of physiologic races in cereal rusts.
Flor (1955) based on his results on genetics of resistance in flax rust, proposed the genefor-gene theory, in which successful infection depends on genetic factors in both the host
and the pathogen. Host and pathogen interact in an evolutionary process. In this genetic
3
interaction the pathogen has a clear advantage due to shorter life cycle and greater
reproductive capacity (Schumann, 1991). For this reason cultivars with single gene
resistance typically do not show durable resistance. In the gene-for-gene model,
resistance (incompatibility) is a recognition process between an active gene product from
the resistant host and an active gene product from the avirulent pathogen (Knott, 1989).
With the cloning of resistance genes, greater insights into mechanisms of qualitative
resistance are available. One remarkable finding is that unrelated taxa can have
functionally if not structurally similar genes for resistance to related pathogens (Cook,
Qualitative vs. quantitative resistance
Distinctions between different types of resistance can be made on the basis of
reaction type, race specificity, level of resistance, stage of expression during the plant life
cycle, and the type of gene involved (major vs. minor) (Parlevliet, 1997). Resistance
characterized by differential interaction between host and pathogen has been described as
"qualitative" (Qi, 1999) or "vertical" (Van der Plank, 1963). In contrast, resistance with a
greater probability of durability is described as "quantitative" (Qi, 1999), "horizontal"
(Van der Plank, 1963), "partial" (Parlevliet, 1975), "slow rusting" (Wilcoxon,
1 974)
andlor "adult plant" (Singh, 1992). R. Johnson (1979) defined durable resistance, as
"resistance that remains effective while a cultivar possessing it is widely cultivated."
Although there are examples of single gene durable resistance such as the Rpgl gene
that conferred resistance to all barley stem rust pathotypes for more than 50 years (Jin et
4
al.
1994)- quantitative resistance has been considered the optimum strategy for
prolonging the effectiveness of host resistance (Parlevliet, 1997).
The terms qualitative and quantitative resistance have been most extensively used
for the cereal rusts. To generalize, qualitative resistance is normally expressed at the
seedling stage and confers protection nearly always, during all growth stages; it is clearly
race specific; it is governed by one or few major genes; and it confers immunity or a
hypersensitive type of reaction (Vandeplank, 1968; Parlevliet, 1997). Quantitative
resistance allows some degree of infection; it is usually controlled by several genes with
small effects; it is often associated with a susceptible seedling reaction; and it shows less,
or no, race specificity (Parlevliet, 1977; Qi, 1999). Qualitative resistance has been the
most widely used tool for control of rust pathogens in cereals, but it requires continuous
monitoring of races and a continual search for new sources of resistance (Schumann,
1991). Quantitative resistance has been widely championed on theoretical grounds, but it
has had less application in mainstream variety development due to the difficulties of
selection for quantitatively, as opposed to qualitatively, inherited traits.
Sources of resistance
There are numerous sources of qualitative and quantitative resistance within the
barley gene pooi. Commercial barley varieties from different regions have been used to
detect sources of resistance to new or old pathogen virulence forms (Roelfs, 1995). Wild
barley (Hordeum vulgare subsp. spontaneum) is, for example, an important source of
resistance to leaf rust (Manisterski, 1986). Jin and Steffenson (1994; 1995) evaluated
5
2000 accessions of subsp. vulgare and 885 of subsp. spontaneum for resistance to
Puccinia hordei, and it was clear that there was greater diversity in terms of the number
of genes identified, range of resistance conferred and phenotypic expression in subsp.
spontaneum than in subsp. vulgare. Another important source of resistance to leaf and
stripe rust are landraces from different centers of diversity of barley. Studies of barley
landraces from Syria, Jordan (Leur et al. 1989) and Ethiopia (Fufa and Danial, 1995;
Alemayehu and Parlevliet, 1996) showed a range of resistance phenotypes from complete
and "partial" resistance to total susceptibility. The partial resistance phenotype has been
extensively explored in the barley leaf rust pathosystem (Parlevliet and Kuiper, 1985).
However, partial resistance has not been widely used in breeding programs due to the
challenges associated with selection for quantitatively inherited traits, such as low
heritability, genotype x environment interaction, etc. Furthermore, selection for
quantitative resistance can be also complicated by the presence of qualitative resistance
genes. Parlevliet (1988) used a recurrent selection approach in two populations without
major genes and obtained, after seven cycles of selection, a 50-fold reduction in leaf rust
severity. Parlevliet and Kuiper (1985) were able to combine partial and major gene
resistance for leaf rust using conventional selection.
Molecular genetics
Molecular breeding tools promise to facilitate selection for quantitative resistance
by shifting the basis of selection from phenotype to genotype. These molecular breeding
tools are based on the discovery in the l920s that genes reside in chromosomes. The first
6
linkage maps were constructed using morphological traits (Phoelman and Sleper, 1995).
Later, isozymes were added to the maps (Wettstein-Knowles, 1992). In 1991, the first
barley maps using molecular markers were published (Heun et al. 1991; Graner et al.
1991). These maps, as well as the SteptoelMorex map (Kleinhofs et al. 1993), were based
on Restriction Fragment Length Polymorphism (RFLP) markers. Later, maps based on
different markers were developed: Random Amplified Polymorphic DNA (RAPD)
(Giese et al. 1994), Amplified Fragment Length Polymorphisms (AFLP) (Qi et al. 1998,
Becker, 1995), Simple Sequence Repeat (SSR) (Liu et al. 1996; Ramsay et al. 2000),
Sequence Tagged Site (STS) (Mano et al. 1999), and Expressed Sequence Tag (EST)
(Thiel et al. 2003). Recently, Single Nucleotide Polymorphism (SNP) markers have been
used extensively for mapping (VonZitzewitz et al. 2005).
Many different types of molecular markers (principally DNA-based) are available
for genetic analysis and new marker types are continuously being developed. Markers
differ from each other in many aspects: discovery cost; application cost; simplicity; level
of polymorphism; dominance; reproducibility and genome distribution. Regardless of the
marker type employed, linkage map construction is based on observed recombination
between markers in a population.
Segregating progeny (e.g. F2) or single seed descent lines (S SD) are commonly
used. In barley a short cut to homozygosity can be achieved by the production of doubled
haploid (DH) lines either by anther culture, or through H. bulbosum-mediated
chromosome elimination (Pickering and Devaux, 1992). Mapping functions are used to
convert observed recombination to centiMorgans (cM). The Kosambi and Haldane
7
functions differ in how they estimate the effect of a crossover on the occurrence of
another nearby crossover. Many mapping populations have been developed in barley for
various purposes (http ://wheat.pw.usda.gov/ggpages/bgn!). Integrated barley maps have
been constructed with the objective of comparing gene location between populations
without common markers (Qi et al. 1996). In the consensus linkage maps, the lengths of
chromosomes range from
130 to - 200 cM. Two other approaches to map integration
are the use of BINS (Kleinhofs and Graner, 2001) and C-map functions available in
Grain Genes database (http ://wheat.pw.usda.gov/ggpages/bgn/).
The large size of the barley genome has precluded whole genome sequencing, but
sequencing of target regions in the Triticeae offers some insight into genome architecture.
In barley, like other cereals, the genome consists of a mixture of unique and repeated
nucleotide sequences. An average value of 4.4 Mb/cM is assumed for the barley genome,
with a range of>4.4 Mb/cM to <1.0 Mb/cM (Kunzel et al. 2000). This work corroborates
the expectation of less recombination in centromeric regions, and therefore there is no
constant relationship between linkage and physical distance. It is common to find genes
conferring resistance to different races of the same pathogen or resistance to different
pathogens in clusters (Ellis et al. 1998; Wisser et al. 2005). Genes may be physically
adjacent or in linkage blocks spanning large physical distances. For example, the wheat-
rye translocation 1BL-1RS used extensively in wheat breeding carries Yr9, Lr26, Sr31
and Pm8 genes for resistance to yellow rust, leaf rust, stem rust and powdery mildew,
respectively. Feuillet and Keller (1999) found five genes in a 23 kb DNA region around
the LrklO in wheat. In barley, there are complex clusters of multiple race-specific genes
on chromosome arms 1HS, 3HS, 3HL and 4HL (Williams, 2003).
Molecular breeding tools
The molecular tools used for linkage and physical mapping can facilitate
molecular breeding for qualitative and quantitative resistance. Qualitative resistance
genes can be scored based on phenotypes conferred in a segregating population and
mapped directly. Bulked segregant analysis (BSA) has been used to identify qualitative
resistance genes linked to molecular markers (Michelmore et al. 1991). The selective
genotyping approach proposed by Lander and Botstein (1989) is another good tool to
identify genes in the absence of the whole genome sequence. When a resistance gene is
cloned (e.g.
Mia, Mb
and Rpg]) ( Chelkowski et a]. 2003) the allele sequence can be
used to design a gene tag. Linkage maps are also useful for dissection of quantitative
disease resistance when coupled with quantitative trait locus (QTL) analysis tools. QTLs
conferring resistance can be identified, mapped, their effects measured and their
interactions quantified. Key features of QTL analysis experiments are: magnitude of the
resistance allele effects, phenotypic and genotypic data quality, population size, and
marker density (Williams, 2003).
QTL and linkage map information can be used to design marker assisted selection
(MAS) schemes for resistance breeding. The efficiency of MAS can be increased by
using markers flanking the target gene instead of a single linked marker (Peng et al.
2000). Markers bracketing the gene reduce the probability of linkage drag. This problem
9
is most important when unadapted lines or exotic germplasm are used in the breeding
process (Tanksley et al. 1996). Toojinda et al. (1998) introgressed two resistance QTL for
barley stripe rust (BSR) into the variety "Steptoe", obtaining the first barley variety
selected using this methodology. Tagged resistance genes can be moved more rapidly
from one varietal background to another and also provide a tool for pyramiding diverse
genes in single cultivars (Castro et al., 2003a). MAS can be used as an adjunct for any
breeding technique, such as backcrossing for variety conversion or recurrent selection for
allele accumulation where several parents are combined in the process (Lindhout, 2002;
Castro et al. 2003a).
Identifying resistance genes
Historically, new qualitative resistance genes were identified based on inoculation
with defined isolates, followed by allelism tests (Knott, 1989). The advent of molecular
tools allows for direct mapping of putative novels genes and reference to a database of
mapped genes (Ivandic et al. 1998). Resistance QTL, have been identified and mainly by
genome location, although isolate specificity has been demonstrated (Qi et al. 1999).
However, due to the lack of precision in linkage mapping and the clustering of resistance
genes, it is clear that coincident map position is not proof of allelism.
10
Perspectives on Barley Stripe Rust (BSR), Barley Leaf Rust (BLR) and powdery mildew
Stripe rust
Puccinia striformis Westend f. sp. hordei, is the formae speciale of the fungus
affecting barley and causing the disease known as barley stripe rust or yellow rust. No
sexual stage and alternate host of Puccinia striformis f. sp. hordei are known. The
fungus has a wider host range than stem and leaf rust, and can infect wheat and numerous
grasses. The wild barley species Hordeum pus illum Nuttall and Hordeum jubatum L. are
both susceptible to stripe rust and are common weeds of the northern and southern plains
(Roelfs and Huerta-Espino, 1994). In Texas, Hordeum jubatum and Hordeum leporinum
were found to be infected with Puccinia striformis f. sp. hordei (Marshall and Sutton,
1995).
Stripe rust infection occurs by urediospores that have survived locally or that are
dispersed by wind. Disease development is optimum between 100 and 15°C, when
intermittent rain or dew is present. Susceptible barley lines in Texas reached 100% of
severity in the soft dough stage, with a maximum yield loss of 72% (Marshall and Sutton,
1995). Historically, BSR has occurred in Western Europe, the Middle East, South Asia,
and East Africa, but in 1975 there was the first report of barley stripe rust in America
when cultivars in Colombia were infected with Puccinia striformis f. sp. hordei race 24.
The disease spread between 1975 and 1983 from Colombia to Argentina and to all South
American countries except Brazil. The pathogen was particularly damaging to the
Andean landraces that are an important staple of indigenous populations. A race survey
made between 1975 and 1983 with samples from many South American countries
established P.s. f. sp.
hordei,
race 24 or its variants, as the causal agent. This race is
similar to the then prevailing race in Europe (Dubin and Stubbs, 1986). By 1991, barley
stripe rust reached Texas, USA and in a few years all of the states in the Pacific
Northwest region. A preliminary study by Dubin and Stubbs (1986) in Ecuador revealed
that most North American barley cultivars were highly susceptible to stripe rust. Roelfs
and Huerta-Espino (1994) evaluated resistance at seedling stage of selected cultivars
from different barley production areas of the United States and found that only 30% were
resistant.
The first report of resistance genes to barley stripe rust was from India, where
eight loci conferring resistance to four Indian races in three varieties were named Psi to
Ps8 (Bakshi and Luthra, 1970). Later studies in Europe identified six resistance genes
designed as Rps loci (Nover and Scholz, 1969), but there were difficulties to integrating
the Indian and the European gene designations due to a lack of a common set of
differentials. Currently, only six resistance genes are named but many more have been
reported (Roelfs and Hughes, 2000). For example, Chen and Line (1999) studied 18
genotypes of barley and found at least 20 different stripe rust resistance genes tentatively
denominated as
Rps loci.
Resistance is recessive in most cases. So far, two qualitative
resistance genes have been mapped: Rps4 on short arm of chromosome IH (WettsteinKnowles, 1992) and
"Rpsx"
on long arm of chromosome 7H (Castro et al. 2003a).
Polygenic resistance conferring a partial level of resistance, at least in the adult
plant stage, is a possible alternative source of resistance. A study on advanced lines from
the ICARDA/CIMMYT barley program revealed the presence of quantitative resistance
12
(Sandoval-Islas et al. 1998). The ICARDA/CIMMYT program used a recurrent selection
approach, selecting plants with a high infection type at the seedling stage, but low disease
severity (10% or less) at the adult plant stage. The mechanism of this kind of resistance is
not well understood. Cultivars with moderate resistance in the field show clear difference
in their partial resistance components. Differences in mycelial growth and sporulation
rate between cultivars were clear, with few or slight cultivar-isolate interactions (OsmanGhani and Manners, 1985).
A doubled haploid population developed using an ICARDA/CIMMYT parent
(Calicuchima sib) with quantitative resistance and a backcross derivative of Bowman,
the susceptible parent, was used to map the first two QTLs conferring resistance to barley
stripe rust (Chen et al. 1994). Subsequent work revealed a cluster of quantitative and
qualitative resistance genes at the same region on chromosome I H. Three adult plant
resistance QTLs were mapped in the Bleheim/E224/3 population on chromosomes 7H,
IH and 5H (Thomas et al., 1995). The QTL on chromosome 11-I had the largest effect and
may be related with Yr4 locus. This was inferred by the ancestral relationship between
Blenheim and Deba Abed, a cultivar with the Yr4 resistance. Toojinda et al. (2000)
mapped a QTL in the same region in Shyri x Galena. Toojinda et al., (1998) in an
example of marker-assisted selection, introgressed adult plant resistance QTLs from
chromosome 4H and 5H in a new genetic background. An example of a resistance gene
pyramiding breeding strategy was developed by Castro et al. (2003a, 2003b) who
combined qualitative and quantitative resistance genes.
13
Leaf rust
Puccinia hordei Otth is the fungus that causes the disease known as leaf rust. Leaf
rust is found in every continent and is particularly important in regions where the crop
matures late. Leaf rust infection causes the greatest crop losses if the attack occurs at an
early stage of plant development, and if a high proportion of the leaf flag is affected. For
example, winter barley cultivars from Virginia, USA had estimated yield losses of 0.27%
to 0.52% for each 1% increment in leaf rust severity on the upper two leaves at the early
dough stage (Griffey et al. 1994). Plants infected with leaf rust may show the following
symptoms: small leaves, weak stems, earlier maturity, lower thousand kernel weight and
fewer grains per inflorescence.
The inoculum source is infected crops in warmer climates, or fall-infected overwintering plants (Mathre, 1982). New virulence of Puccinia hordel can result from sexual
recombination, introduction, or mutation (Steffenson and Jin, 1993; Cotterill et al. 1995).
Sexual recombination is a very important source of variation when the alternate host is
present that allows the fungus to complete its life cycle. (Reinhold and Sharp, 1982;
Yahyaoui and Sharp, 1987). The alternate host of Puccinia hordei is Star of Bethlehem
(Ornithogalum umbellatum L.). This plant is found in Asia, the Mediterranean, and in the
Eastern United States. However, aecial infections have been reported only in Asia and the
Mediterranean region. The presence of the alternate host allows recombination between
fungal strains and this results in a higher frequency of new races. Isolate introduction is
favored by the capacity of the urediospores to survive long distance wind transport.
Mutation has been reported to occur commonly under both laboratory and field
14
conditions (Levine, 1952). Two surveys conducted in North America in 1956-1958 and
1959-1964 identified the occurrence of three new pathogenic races attributed to
mutations (Moseman and Roane, 1959; Moseman and Greeley, 1965).
Qualitative and quantitative leaf rust resistance is found in barley. Qualitative
genes are designated Rph, followed by a number indicating order of discovery. Rph-genes
typically confer immunity or a hyper-sensitive reaction but the expression of resistance
can be affected by the genotype of the host (Clifford and Roderick, 1978), and
environmental conditions (Feuerstein et al. 1990; Manisterski et al. 1986). Currently,
there are 19 Rph genes defined and two new genes have been mapped, but the allelism
tests have not been completed (Hayes et al. 1996; Jin and Steffenson, 1994). At least nine
of the 19 Rph genes have their origin in subsp.
spontaneum,
confirming the importance of
this source of resistance (Jin and Steffenson, 1994). There are
Rph
genes on all
chromosomes except 4H (Borokova et al. 1997; Jin et al. 1996; Graner et al. 2000; Park
et al. 2002, 2003; Zhong et al. 2003; Mammadov et al. 2003).
The existence of genotypes with moderate levels of resistance and the occurrence
of clear differences
in
latent period between varieties were the basis for the
characterization of partial resistance to barley leaf rust (Parlevliet, 1975). Partial
resistance is a form of incomplete resistance characterized by a high infection type at all
growth stages, but with a slow rate of epidemic development. Latent period measures the
period between inoculation and pustule occurrence. Latent period is the most important
component of partial resistance and it has a high correlation with disease severity
(Parlevliet and Kuiper, 1977). Partial resistance is normally governed by the action of
15
more than one gene, on a "minor gene-for-minor gene" model (Parlevliet, 1977). Partial
resistance is determined by a variety of mechanisms. In some cultivars resistance occurs
during or shortly before stomata penetration, in a classical recognition process (Niks
1982). Other cultivars show reduced colony growth prior to spore formation (Statler and
Parleviet, 1987). There are also genes conferring quantitative resistance to leaf rust, and
QTL tools have been applied to their discovery. At least 21 resistance QTL have been
mapped on all chromosomes with the exception of 1H (Thomas et al. 1995; Spaner et al.
1998; Qi et al. 1998, 1999, 2000; Kircherer et al. 2000). Qualitative and quantitative
resistances QTL have been mapped in same regions and coincident QTL have been found
in multiple populations. For example, Thomas et al. (1995) mapped an adult plant
resistance QTL for leaf rust on chromosome 5H in Blenheim x E224. Triumph, a parent
of Blenheim (the source of resistant allele) carries RphI2 resistance, and this locus is
located in the same region of chromosome 5H as the QTL. In Harrington x TR306,
Spaner et al. (1998) mapped three adult plant resistance QTL and one on chromosome 5H
was located also in the same region as Rphl2 and the QTL reported by Thomas et al.
(1995). Clusters of qualitative and quantitative resistance for BSR and BLR are found on
chromosome 7H, 2H, lH, 6H and 5H (Williams, 2003; Hayes et al. 2003).
Powdery mildew
Blumeria graminis (DC.) Golovin ex Speer f. sp. hordei Em. Marchal (synamorph
Erysiphe gram mis DC. f. sp. hordei Em. Marchal) is an obligate pathogen of barley that
causes the disease known as powdery mildew. This pathogen is a biotrophic, air borne
16
fungus with a narrow host range and those attributes give it the ability to quickly
overcome host resistance genes (Parlevliet, 1997). An eloquent illustration was a classic
study undertaken in the 1950s in central Europe (Lehmann et al. 1976) where more than
4,000 barley accessions were evaluated after inoculation with all available races of
powdery mildew. Ninety-six accessions were completely resistant. Twenty years later,
only 26 of the 96 were still resistant to the available races (Lehmann et al. 1976).
Powdery mildew affects barley in areas with cool and humid weather during the
growing season; it is most destructive in Northern Europe, Japan, and the Eastern and
Southern areas of North America (Kiesling, 1985).
In Europe, the use of specific resistance genes began in the 1930s, with the
deployment of different alleles at the
Ivila
locus. Jørgensen (1994) described three kinds
of resistance present in the barley- powdery mildew pathosystem. Race-specific
resistance has been widely used by barley breeders and the majority of the European
varieties carry one to five race-specific mildew resistance genes (alleles). A particular
case of race-specific resistance is the Mia locus on chromosome lB that contains 28
named resistance alleles, with two of them cloned (Zhou, et al. 2001; Halterman et al.
2001). More than 85 race-specific resistance genes in addition to Mia genes have been
reported, and 14 of them have been mapped. They are located on all barley chromosomes
except 3H (Jørgensen, 1994; Williams, 2003; Pickering et al., 1998). Resistance at mb
locus has race non-specificity to powdery mildew and was identified by analysis of
mutant barley populations (Jørgensen, 1994). The mb resistance genes are all recessive
and are functional alleles at the mb locus on the long arm of chromosome 4H. The use of
17
mb
genes has been extensive in many barley varieties and the gene was also cloned
(Buschges et al. 1997). Some mb alleles interact with host gene background to give
different levels of expression (Jørgensen, 1994). Partial resistance represents grades of
susceptibility and is usually expressed as a polygenic trait. This kind of resistance is
assessed in field plots as the degree of disease severity (.Jørgensen, 1994). Indigenous
European barley germplasm appears to have a fair level of partial resistance; 12 QTL
have been mapped; there is at least one on each chromosome (Backes et al., 1995, 1996,
2003; Heun et al., 1992; Spaner et al., 1998; Falak et al., 1999; Thomas et al., 1995). The
limited availability of new resistance genes in cultivated barley and the high level of
pathogenic variability of Blumeria graminis have forced breeders to look for effective
resistance genes in wild relatives of barley. Powdery mildew resistance genes have been
introgressed from Hordeum bulbosum (Pickering et al., 1995), barley landraces
(Czembor, 2000) and wild barley (Hordeum vulgare ssp. spontaneum) (Backes, 2003).
Testing the effectiveness of barley stripe rust resistance QTL detected in Mexico and
the USA against a possible new race in Peru and mapping of genes conferring
resistance to leaf rust and mildew in the same population
Carlos Rossi"2, Alfonso Cuesta-Marcos3, Isabel Vales', Luz Gomez-Pando4,* Gisella
and Patrick Hayes'
Orjeda5, Roger Wise6, Kazuhiro Sato7, K. Hon
'Dept. of Crop and Soil Science, Oregon State University, Corvallis, Oregon, USA
2
Instituto Nacional de Investigaciones Agrarias (INIA), Colonia, Uruguay
Estación Experimental de Aula Dei (CSIC), Zaragoza, Spain
Prog. de Cereales y Granos Nativos, Univ. Nacional Agraria La Molina, Lima, Peru
Universidad Peruana Cayetano Heredia, Lima, Peru
6
Dept. of Plant Pathology, Iowa State University, Ames, Iowa, USA
Research Institute for Bioresources, Kurashiki, Japan
ABSTRACT
Quantitative resistance to plant pathogens is esteemed for its probable durability.
QTL mapping tools are essential for determining the number, genome location, and
effects of the genes that confer quantitative resistance. We used a well-characterized
barley QTL mapping population to determine if barley stripe rust resistance QTL mapped
in Mexico and the USA were effective against a reported new virulence in Peru. The
same resistance QTL that were detected in Mexico and the USA were detected in Peru.
This finding is of importance to barley breeders interested in deploying effective
resistance genes. Confirmation of a new race in Peru will require characterization against
a standard set of differentials, an experiment that is planned. The increase in disease
severity of C1l0587, a genotype with a mapped qualitative resistance gene, between
Mexico and Peru suggests there is a new race in Peru. The highest levels of resistance in
Peru were achieved in lines where the qualitative resistance gene was pyramided with
quantitative resistance alleles. We used the same doubled haploid population to map
QTL for barley leaf rust and barley powdery mildew in the Andean region. For the latter
disease we identified resistance QTL in addition to the Mia resistance mapped using
specific isolates under controlled conditions. These results demonstrate the long-term
utility of a carefully designed mapping population.
Keywords Hordeum vulgare subsp. vulgare, Puccinia striformis f. sp. hordei,
Puccinia recondita, Blumeria gram mis f. sp. hordei, quantitative resistance, qualitative
resistance
20
INTRODUCTION
One of the principal challenges faced by the users, producers, and breeders of
plants is achieving durable disease resistance. While durability is conceptually
straightforward - "resistance that remains effective while a cultivar possessing it,
widely cultivated" (Johnson, 1979)
is
it is difficult to achieve. In the perpetual battle
between pathogen and the defending host, the pathogen has the clear advantage, due to
shorter life cycle and greater reproductive capacity (Schumann, 1991). For example,
between 1993 and 1998 52 different new races of P.
striformis f. sp. hordei
were
identified in the United States. In the same time frame, this disease, commonly known as
barley stripe rust (BSR) or yellow rust (YR), spread throughout the western United States
and caused locally severe economic losses (Line, 2002).
The two principal tools for dealing with fungal pathogens new or endemic - are
fungicides and genetic resistance. The latter is usually preferable from economic and
environmental standpoints. Within the general category of genetic resistance, there are
two principal types: quantitative and qualitative. Qualitative resistance has been the most
commonly used tool by plant breeders because this type of resistance usually shows
Mendelian inheritance and thus is easily managed in a breeding program; it also confers
high levels of resistance (Vanderplank, 1968). Unfortunately, qualitative resistance is
usually less durable and thus requires constant monitoring of pathogen population
virulence and identification and introgression of new resistance genes.
There are
examples of qualitative, single gene, durability, such as the stem rust resistance in barley
conferred by Rpgl gene (Jin et al. 1994). However, quantitative resistance is generally
21
thought to have a higher probability of durability than qualitative resistance (Parlevliet,
1997).
The probable durability of quantitative resistance
is
based on several
considerations: allowance of some degree of infection and disease development; little or
no race-specificity; and, in some cases, differential expression patterns depending on
environmental factors and host plant growth stage (Parlevliet, 1977; Line and Chen,
1995; Line, 2002). The problem with quantitative resistance has been its typically
complex inheritance. With the advent of molecular marker technologies allowing for
linkage map construction and quantitative trait locus (QTL) detection, the genetic
determinants of quantitative resistance to many diseases in many plant models have been
identified (Young, 1996; Kover and Caicedo, 2001).
QTL mapping experiments have been very useful in identifying targets for
introgression and pyramiding. For example, using the barley stripe rust model, we have
mapped qualitative and quantitative resistance genes (Chen et al. 1994; Hayes et al. 1996;
Toojinda et al. 2000; Castro et al. 2003a). We have introgressed these genes singly, and in
combination, into susceptible backgrounds and demonstrated that they confer acceptable
levels of resistance (Toojinda et al., 1998; Castro et al., 2003a, 2003b; Vales at al. 2005);
and we have made some progress in characterizing their race and growth stage specificity
(Richardsson et al. unpublished). Similar progress has been made in other crop : pathogen
systems, e.g. rice (Hittalmani et al. 2000; Narayanan et al. 2004; Yi et al. 2004) and
soybean (Walker at al. 2004). A principal issue with QTL analysis, however, is the bias
due to small population size (Schon et al. 2004; Vales et al. 2005).
22
We recently expanded our efforts with the barley
barley stripe rust model to
address the question of population size and demonstrated that a large population (- 400
doubled haploid (DH) lines) is necessary for identifying the maximum number of QTL
with the best resolution (Vales et al., 2005). However, this work also demonstrated that
smaller (
100 DH lines) could identify principal QTL without excessive bias in
estimation of allele effects. The QTL alleles that were targeted by Vales et al. (2005) are
derived from quantitative resistance sources developed by the ICARDA/CIMMYT barley
program, based in Mexico. Notable characteristics of these sources of resistance are that
adult plants allow some symptom development ( 20 % severity) and this level of
resistance has been effective in Mexico and North America since we initiated this
collaboration in 1990.
In 2000, there were reports suggesting the presence of a new virulence of barley
stripe
rust
in
communication).
the
Andean
region
(H.
Vivar,
ICARDA/CIMMYT,
personal
The evidence for the putative new virulence was a change in the
resistance profile of commercial varieties like "Yanamuclo" the second most widelygrown barley variety in Peruvian Andes, and germplasm in breeding nurseries (80% of
the breeding lines of Peruvian Barley National Breeding Program turned susceptible)
(Luz Gomez, pers. comm.). Also in 2000-2001, we received data on entries we had
submitted to the USDA Barley Stripe Rust Screening Nursery (coordinated by Dr. R.
Brown) that was grown at Huancayo, Peru. Most notable in the data from this nursery
was the BSR severity of 60% on
C110587.
In repeated tests in Mexico,
C110587 had
shown very low levels of disease (typically < 1% and 0% in Mexico 2000). We have
23
mapped this resistance as a single gene on chromosome 7H (Castro et al. 2002b). Other
lines with barley stripe rust resistance QTL alleles were tested in the same nursery. Some
showed higher levels of disease severity than we typically observed in Mexico, but the
changes generally were not of the magnitude as that seen for C110587. For example, the
difference between disease seventies values in Peru vs. Mexico was 60% for C110587
and 24% for BCD47. We interpreted these data as evidence in support of the putative
new virulence in the Andean region.
Confirmation of a new virulence in Peru is complicated by several factors. We
were not able to import isolates to the USA for assay on differentials. No facilities were
available in the Andean region for controlled environment characterization of isolates on
the differential set, and in our experience, field assessment of the differentials is not
effective due to their poor adaptation, asynchronous growth habits, possible complex
pathogen population structure and the effects of other diseases that preclude accurate
disease rating. If quantitative resistance is indeed non-race specific and expressed at the
adult stage, there is limited relevance of the seedling resistance data obtained from
differential varieties to a quantitative resistance breeding effort. Finally, the immediate
issue of practical concern is the usefulness of characterized quantitative resistance genes
in the presence of a putative new virulence.
Accordingly, we decided to use a previously generated and characterized for
barley stripe rust resistance mapping resource (Vales et al. 2005) to determine if the
quantitative resistance genes identified are also effective against the virulence spectrum
in the Andean region and as a possible diagnostic tool for the new suspected virulence.
24
This approach is a variant on the theme of using a QTL mapping resource to search for
QTL for other disease resistance phenotypes, or for new QTL for the same phenotype in
different environments (Hayes et al. 2003). In addition to the mapping population, we
included a set of germplasm of known resistance gene architecture, and disease reaction
in several environments.
From a practical standpoint, our primary interest was to assess the prospective
durability of the resistance QTL alleles that we have extensively characterized by
challenging them with the virulence spectrum present under field conditions at a
representative field site in the Andean region. A supporting objective was determining
what, if any, resistance genes are present for powdery mildew caused by Blumeria
graminis f. sp. hordei and leaf rust caused by Puccinia hordei, diseases that are important
and endemic at the test site. We were also interested in using our mapping population
and germplasm array as diagnostic tools for the putative novel virulence. We
hypothesized that if we detected the same QTL in Peru as in other environments, this
would mean that (i) there was no new virulence, or (ii) there is a new virulence but the
same QTL alleles are effective. If the population was uniformly susceptible, this would
confirm a new virulence and race-specificity of the QTL. If different resistance QTL
were detected, this would suggest a shift in virulence and race-specificity of QTL, but it
would have the benefit of revealing new resistance loci. The disease reactions of the
characterized genetic stocks in the germplasm array, including C110587, would provide
important data in support of hypotheses based on data from the mapping population.
25
MATERIALS AND METHODS
Plant Material
The first ninety-four doubled haploid (DH) lines of the ORO mapping population
(n = 409) (Vales et al. 2005) were used for this research. BCD47 and Baronesse are the
parents of the ORO mapping population. BCD47 is a two-rowed, spring growth habit DH
line, developed via marker-assisted selection for BSR resistance alleles at QTL on
chromosomes 4H and 5H (Castro et al. 2003a). Baronesse is a two-rowed, spring growth
habit developed by Nordsaat and released in 1989 in Germany. The variety is grown
extensively in the Pacific Northwest of the USA.
A panel of varieties and genetic stocks related with the BSR resistance gene
pyramiding process described by Castro et al. (2003a, 2003b) was also employed. These
accessions have different barley stripe rust resistance QTL allele configuration, based on
previous mapping experiments (Table 1). Complete data are shown in Appendix Table
26
Table 1: Accessions evaluated for barley stripe rust (BSR) severity in Huancayo, Peru
(2000 and 2004) and in the Toluca Valley, Mexico (2000). The chromosomes containing
mapped BSR resistance QTL are shown (largest effect QTL are shown in bold and
putative major gene in bold-italic).
Accession
Harrington
Galena
Baronesse
Calicuchima-sib
Shyri
C110587
D1-72
D3-6
Orca
BCD47
BCD12
D3-6/B23, D3-6/B61
BU 16, 27, 37, 38, 45
OP 19, 66, 78
AJ 44, 59
Chromosome containing
BSR resistance QTL
.
None
None
2H, 5H, 7H (2)
4H, 5H, 6H, 7H
1H, 2H, 3H, 6H
7H
1H
7H
4H, 5H
3H (2), 4H, 5H, 6H
1H
7H
4H, 5H, 7H
1H, 7H
4H, 5H, 7H
Citation
Castro et al. 2003b
Toojinda et al. 2000
Vales et al. 2005
Castro et al. 2002b
Toojinda et al. 2000
Castroetal2003a
Toojinda et al. 2000
Castro et al. 2003 a
Toojinda et al. 1998
Vales et al. 2005
Castro et al. 2003a
Castro et al. 2003a
Castro et al. 2003a
Castro et al. 2003a
Castro et al. 2003a
Disease assessments under field conditions
The 94 ORO lines, BCD47, Baronesse and a panel of 23 varieties and genetic
stocks were evaluated at the Universidad Nacional Agraria La Molina research farm at
Huancayo, Peru (HP). The ORO population and the two parents were grown in two-row,
1-rn plots in a two replicate Randomized Complete Block Design. The Huancayo facility
is located at an elevation of 3,320 m, with latitude 110 49' South and longitude of 75° 23'
West. The following diseases occurred in response to natural infection without
supplemental inoculation: stripe rust, leaf rust, and powdery mildew. Stripe rust is an
endemic disease in this area and susceptible check lines produce the inoculum necessary
for infection. All three diseases were scored for disease severity on a plot basis using
27
visual assessment of the percentage of crop canopy infected by the particular disease.
Ratings were made when most test genotypes were at growth stage 55 on the Zadocks
scale. For barley stripe rust, infection types were scored at the same time as the disease
severity ratings, using R (resistant), MR (moderately resistant), MS (moderately
susceptible), and S (susceptible) scores.
For the purposes of comparison, the barley stripe rust disease severity data from
the ORO lines at Huancayo, Peru were compared with the barley stripe rust disease
severity data reported by Vales et al (2005) from the Toluca Valley, Mexico (TVM), and
Pullman and Mt. Vermon, Washington USA (WUSA).
Disease assessments under controlled conditions
Blumeria graminis f. sp. hordei (Bgh) isolates 5874 (Torp et al. 1978; Wei et al.
1999; AvrMlal, AvrMla6, AvrMlal2) and A27 (Giese et al. 1981; AvrMlal, AvrMla7,
AvrMlalO, AvrMlal3) were propagated on H. vulgare cv. Manchuria (C.I. 2330) in
separate growth chambers at 18°C (16 h Iight/8 h darkness). The same ninety four DH
lines that were characterized in Peru were grown in three, 36-cell flats. Groups of three
seedlings per DH line were sown per cell in each flat. The Baronesse and BCD47 parents,
C.I. 16137 (Mlal), C.I. 16151 (MlaO), C.I. 16149 (MialO), SultanS (M1a12), C.!. 16155
(M1a13), in addition to the fully susceptible Manchuria (C.I. 2330), were used as checks
(Moseman, 1972). Seedlings were grown to the 2nd_leaf stage with
1st
leaf unfolded, and
inoculation was performed at 16:00 hrs. U.S. Central Standard Time by tipping the flats
at 45° angIe and dusting the plants with a high density of fresh conidiospores (84 ± 19
28
spores/mm2). This conidial density per unit leaf area routinely results in greater than
50% of epidermal cells that are successfully infected (Bushnell, 2002; Collinge et al.
2002). Groups of flats were placed at 18°C (16 hours light, 8 hours darkness) in separate
controlled growth chambers corresponding to the two Bgh isolates (5874 and A27).
Infection types (IT) were scored at 7 and 9 days post inoculation as described in
Wei et al. (1999). The infection types 0, 1, or 2 are considered resistant reactions while
the infection types 3 or 4 are considered susceptible.
Genotyping and map construction
The genotype data reported by Vales et al. (2005) was used for linkage map
construction, with an additional 20 markers scored since that report. The new markers are
shown in bold in Figure 1. Markers *k04435, *k03512, *k08433, *ko83o2, *k06257,
*k04261, *ko3878, *k00688, *k04489, *k07339, *k00088, *k02892, *k03352 and
*k07229 are expressed sequence tag (EST)-based marker loci of known location on the
barley transcript map (Sato et al., 2004). They were identified as polymorphic in the
parents (BCD47 and Baronesse) and then scored on the full population. Primers for each
EST marker (primer sequences are shown in Appendix Table 2A) were used to amplify
the PCR product from genomic DNA with the following cycling conditions: 94 °C for 2
mm, 5 cycles of 94°C for 30 sec, 65°C for 30 sec decreasing 1°C per cycle and 72°C for
2 mm, 35 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 2 mm, and 72°C for 7
mm. PCR product size polymorphisms were scored directly after electrophoresis on 13%
acrylamide gel at constant voltage 250V for seven hours using a High Efficiency Genome
29
Scanning System (Hon et al. 2003). In cases where there were no clear amplicon size
differences, PCR products were sequenced to detect Single Nucleotide Polymorphisms
(SNPs). PCR products of cleaved amplified polymorphic sequence (CAPS) markers were
digested with respective restriction enzymes at appropriate temperatures and the samples
were electrophoresed on 3% agarose gels. The SNP markers, lacking appropriate
restriction enzyme recognition sites, were genotyped using a fluorescent polarization
SNP detection system (Perkin Elmer Co.).
Markers MWG218O and ABG54 were
developed by the North American Barley Genome Project and were originally scored as
Restriction Fragment Length Polymorphisms (RFLPs) (Kleinhofs et al. 1993). They were
converted to the Sequence Tagged Site (STS) markers based on the sequences available
at the GrainGenes website (http ://wheat.pw.usda.gov/GG2/index.shtml). Primers for each
marker (primer sequences are shown in Appendix Table 2A) were used to amplify the
PCR product from genomic DNA with the following cycling conditions: 94°C for 3mm,
40 cycles of 94°C for 1 mm, 55°C for I mm, 72°C for 1 mm, and 72°C for 5 mm, and
hold at 8°C. PCR product size polymorphisms were scored on 4% agarose gels in 0.5 x
TBE at 100V for 3 hours. Primers for baal29jl8RED marker were designed based on
unpublished RIB EST sequence of clone baal29j 18 (shown in Appendix Table IA). The
PCR cycling profile was: 94 °C for 3 mm, 5 cycles of 94 °C for 30 sec, 60 °C for 30 sec
and 70°C for 15 sec, decreasing 0.5°C per cycle, 35 cycles of94°C for 30 see, 55°C for
30 sec and 72°C for 15 see, and 72°C for 5 mm. PCR product size polymorphisms were
scored directly after separation on 4% agarose gel in 0.5 TBE buffer at constant voltage
100V for 3 hours. The EST-derived SSR-markers GBM1O71 and GBM1O15 were
developed by Thiel et al. (2003) and they were assayed on a 6% polyacrylamide gel in 1
x TBE at constant voltage 250 V for 4 hrs. The HvSnf2 locus was mapped using the
primers and procedures reported by Yan et al. (2002). TC493a locus sequence was
obtained from the tentative contig TC1 12493 sequence in The Institute for Genome
Research (TIGR) web page (http://www.tigr.org). Primer sequences are shown in
Appendix Table 2A. The PCR cycling profile was: 94 °C for 3 mm, 5 cycles of 94°C for
30 sec, 65°C for 30 sec and 72°C for 30 sec, decreasing 1°C per cycle, 35 cycles of94°C
for 30 sec, 60°C for 30 sec and 72 °C for 2 mm, with a final step of 72 °C for 5 mm. The
PCR products were assayed on a 6% polyacrylamide gel in 1 x TBE at a constant 250 V
for4hrs.
JoinMap® (van Ooijen and Voorrips, 2001) was used for linkage map construction,
using the Kosambi mapping function (Kosambi, 1944). Linkage groups and locus orders
were compared with Vales et al. (2005). The two-replicate means for barley stripe rust,
barley leaf rust and barley powdery mildew disease severity and barley stripe rust
infection type at field (Huancayo, Peru) and the single replicate data for each of the two
powdery mildew isolates (Iowa State University) were used for QTL analysis. The barley
stripe rust infection types were converted to 1 (R), 2 (MR), 3 (MS), 4 (S) for QTL
analysis. The QTL analyses were performed using the composite interval mapping (CIM)
procedure (Zeng, 1994) implemented in Windows QTL Cartographer 2.5 (Wang et al.,
31
2005). A forward-selection backward-elimination stepwise regression procedure was
used to identify co-factors for CIM for each trait; the LOD threshold values to declare a
QTL significant were obtained based on 1000 permutations, a 10 cM scan window and a
Type I error of 5%. Tests for epistasis between QTLs were evaluated using the MIM
(Multiple Interval Mapping) method of QTL Cartographer. With MIM, the proportion of
the phenotypic variance explained for each trait was calculated by fitting a model using
all detected QTL.
RESULTS
Linkage Map
As a starting point for this investigation, we updated the linkage map of Vales et
al. (2005) by adding additional markers, reconstructing the map, and eliminating markers
that co-segregate or that lacked sufficient data (i.e. > 10 missing data points). The
resulting map has 70 markers comprising eleven linkage groups at a LOD threshold
grouping value of 4.0. All linkage groups were assigned to barley chromosomes per
Vales et al. (2005), with more than one linkage group for chromosomes 2H, 5H and 7H.
The map covers 611.8 cM, corresponding to an average density of 8.7 cM per marker
(Fig. 1). Segregation distortion (p<O.OS) in favor of Baronesse was observed in
chromosome 3H (*koo688, *k04489, *k07339 and *k00088) and chromosome 4H
(Bmac3lO and GBMIO15); and in favor of BCD47 in chromosome 1H (Bamg77O,
HVM2O and Bmag5O4).
32
Figure 1. Linkage map of the ORO (BCD47 x Baronesse) population based on 94 DH
lines. Dashed lines indicate monomorphic regions. Distances are in Kosambi cM. The
bars to the left of each linkage group indicate 1 -LOD intervals for QTL abbreviated as
follows: BSR-P, BSR-M, BSR-U (barley stripe rust resistance QTL in Peru, Mexico and
USA, respectively). SRIT-P (barley stripe rust infection type QTL in Peru. BLR-P
(barley leaf rust resistance QTL in Peru). PM-P (powdery mildew resistance QTL in
Peru). PM-I (powdery mildew infection type in response to inoculation with Bgh isolates
5874 and A27 at Iowa State University.
1H
0
1
6
k04435
k03512
k08433
0
f
4H
3H
2H (a, b, c)
Bmacl34
0
6H
5H (a, b)
rna9
I-iVM4O
IBmac2O9
BmaglO5
GBM1039
7
BmagOO5
14
16
18
*1(06257
k04261
19
Bmac399
k03878
Bmac2l3
31
81
43
46
50
55
*1(00688
41
45
*k04489
*k07339
*k00088
51
52
55
HVMO3
lIII1!!1
12
Bmac3l6
r
0fl-
Bmag500
19
EBmac6O3
i
Bmacl8l
BmacO3OB
GBM1O7I
MWG2I8O
Bmac3lO
-
55
0
liii
Bmag77O
Bmagl73
-A-- GMSO61
LIII
71
Brnag5O4
BmacO32
Bmag225
! 0fl
HVM36
liii
62
19
rn
7H (a, b)
2
BmagOl3
nac684
27
EBrnac63S
*1(02892
[[[J
36
Bmagl2S
i::::::
BSR-M
BSR-P
JJ
105
106
0
HVCMA
8
TC493a
Bmag222
Bmag 507
!II
HvMLO3
107
baa29j18RED
108
117
123
126
130
*k07229
GBMIOI5
Bmag4l9
HvSnf2
HdAmyB
BSR-U
37
62
Bmagl2O
GMSOO1
R1s44
SRIT
BLR-P
PM-P
PM-I
94
Bmacl56
104
Bmagl35
34
Disease resistance phenotypes in the ORO population
The average disease severity for barley stripe rust in Huancayo, Peru was 48%,
with a range of 7.5% to 90% (Fig. 2A). The phenotypic frequency distribution reflects
quantitative inheritance and reveals positive and negative transgressive segregants.
Barley leaf rust severity values were low, with a mean of 14.6%, and a preponderance of
DH lines with severity values comparable to the more resistant parent (Baronesse) (Fig.
2B). Transgressive segregation for higher susceptibility was observed. Powdery mildew
disease severity under field conditions shows a continuous distribution with medium to
high infection values. The difference in disease severity between the parental genotypes
was 40% (20% in Baronesse vs. 60% in BCD47). Resistant transgressive segregants were
observed in the progeny (Fig. 2C). For all three diseases, even the most resistant lines
showed some level of disease. The population frequency distributions for reaction type to
both isolates were nearly identical (Fig. 3). These qualitative data showed excellent fit to
a 1: 1 ratio (%2=O.67), the expectation for segregation of alleles at a single locus in a DH
population.
35
Figure 2. Phenotypic frequency distributions: A) barley stripe rust, B) Barley leaf rust
and C) powdery mildew disease severity in BCD47 and Baronesse and ninety four
doubled haploid (DH) progeny at Huancayo, Peru in 2004.
A
20
15
a
10
E
z
0
Bar (61 %)
LIkI
B47 (20 %)
0
10
20
30
40
50
60
70
80
90
100
Disease severity (%)
C
(0
a
B47 (60 %)
Bar (20 %)
20
15
10
E
z
0
0
10
IkII
20
30
40
50
60
70
80
90
100
Disease severity (%)
(*) Horizontal bars indicate the standard error of the mean for each
of the parents.
36
Figure 3. Phenotypic frequency distribution for infection type in BCD47 (B47) and
Baronesse (Bar) and ninety four DH progeny in response to inoculation with Bgh isolates
5874 and A27.
B47 (4
B47 (3.5)
50
Bar (0.4)
I
i
B
2
15874 0A27
ii
- .
3
r
4
Infection type
(*) Horizontal bars indicate the standard error of the mean for each of the parents, except
that Baronesse with Bgh 5874 and BCD47 with Bgh A27 had standard errors equal to
zero.
Q TL analyses
In order to compare the QTL results from Peru with QTL detected in Mexico and
the USA, we re-analyzed the latter data using the new linkage map. In Peru, the LOD
threshold for barley stripe rust disease severity was 2.5, based on 1000 permutations and
a type I error of 5%. Barley stripe rust QTL with the resistance allele coming from
BCD47 were found on chromosomes 3H, 4H and 6H, and with resistance allele coming
from Baronesse on chromosome 7H (linkage groups a and b) (Table 2). Fig. 1 shows the
position of these QTL on the updated ORO linkage map. The QTL with the largest effect
was on chromosome 4H, and it accounted for 15.2 % of the phenotypic variance, with an
additive effect of 10.4%. Cumulatively, the five QTL explained 70.8% of the phenotypic
37
variance. The reanalysis of the Mexico and USA data with the updated linkage map
revealed the same total number of QTL as reported by Vales et al. (2005) for a population
size of 100 (Table 2).
38
Table 2. Barley stripe rust disease severity resistance QTL detected in the ORO
population of 94 DH lines (BCD47/Baronesse) at Huancayo, Peru in 2004; the Toluca
Valley, Mexico (TVM) in 2001, 2002 and Pullman and Mt. Vernon Washigton, USA
(WSU) in 2002.
Additive
Location
Chromos
QTL peak position and
1-LOD interval (cM)
TVM
2H(b)a
0 0 (0 0-7 5)
54
83
7 43
56.7 (5 1.6-67.0)
7.7
13.4
-9.70
54.7 (52.0-62.4)
5.9
9.6
-8.03
103.8(99.9-104.4)
11.8
24.6
-13.4
108.1 (107.3-111.6)
8.3
15.2
-10.37
101.8 (95.8-104.2)
4.9
13.0
-3.95
0.0 (0.0-10.0)
3.0
4.4
-5.78
2.0 (0.0-10.0)
5.0
8.3
-7.30
4.0
9.3
-3.41
3.6
5.7
6.07
4.3
9.9
3.29
16.2 (14.8-24.9)
7.1
11.9
8.79
16.2 (11.6-25.4)
4.9
11.5
3.56
TVM
Peru
TVM
Peru
WSU
3H
4H
TVM
Peru
6H
WSU
Peru
Peru
WSU
Total
(%)e
0.0
7fl(
\a
Hb
a
TVM
Peru
WSU
(0.0-6.2)
18.0 (0.0-19.1)
0.0(0.0-11.9)
ftQ,
LODb
R2
(%)C
effectd
65.4
70.9
52.3
The letter in parentheses indicates cases where there is more than one linkage group per
chromosome (see Figure 3).
b
LOD is the log-likehood at the QTL peak position. The LOD threshold, based on 1000
permutations and a type I error of 5% was 2.5, 2.6 and 2.3 for Peru, TVM and WSU
respectively.
R is the percentage of phenotypic variation explained by the QTL.
d
Negative and positive values indicate that BCD47 and Baronesse, respectively,
contributed the resistance QTL allele.
e
Proportion of the total variance explained by the QTL.
a
39
Only the BSR QTL on chromosomes 4H and 6H were detected in all environments. Of
the QTL that were significant in Peru, three were also significant in Mexico and four
were significant in the USA. Considering all three environments and the population size,
more QTL were detected in Peru. There were no significant epistatic interactions in any
data set. The LOD threshold for barley stripe rust infection type was 2.5.
For barley leaf rust and powdery mildew, the LOD thresholds were 2.6 and 2.5,
respectively, based on 1000 permutations and a type I error of 5%. For barley leaf rust,
two QTL were found (Table 3, Fig. 1), with resistance alleles contributed by each parent:
Baronesse on chromosome 3H and BCD47 on chromosome 7H (linkage group b). The
7H QTL had the largest effect, accounting for 31% of the phenotypic variance. There was
a significant epistatic interaction between the two QTL. Considering both QTL, they
accounted for 79.1% of the phenotypic variance. Two QTL for powdery mildew
resistance were detected with the Peru field data (Table 3, Fig. 1), one on chromosome
2H (linkage group b) with Baronesse contributing the resistance allele and the other on
7Hb with BCD47 contributing the resistance allele. Both QTL have a relative minor
effect accounting for 12.4% (2Hb) and 11.6% (7Hb) of the phenotypic variation (Table
3), respectively. There was no epistatic interaction between the QTL, and the total
percentage of phenotypic variance accounted for was 21.8%.
40
Table 3. Barley leaf rust (A) and powdery mildew (B) disease severity resistance QTL
detected in the ORO population of 94 DH lines (BCD47/Baronesse) at Huancayo, Peru in
2004. Data for leaf rust are based on the Multiple Interval Mapping procedure of QTL
Cartographer, due to the presence of significant QTL x QTL interaction.
A
Chromosome
QTL peak position and
1-LOD interval (cM)
3H
7H(b)a
42.7 (3 1.6-49.0)
68.6 (67.4-76.3)
3H x 7H(b)
Total (%)e
LODb
6.2
9.4
5.6
R2
(%)C
21.6
47.1
10.4
79.1
Additive
effectd
9.48
-13.96
8.42
[11
Linkage group
QTL peak position and
1 -LOD interval (cM)
LODb
2H(b)a
7H(b)a
0.0 (0.0-2.2)
101.6 (93.5-103.6)
4.2
3.6
Total
(%)e
R2
(%)C
12.4
11.6
21.8
Additive
effectd
5.36
-5.11
The letter in parentheses indicates cases where there is more than one linkage group per
chromosome (see Fig. 3).
b
LOD is the log-likehood at the QTL peak position. The LOD thresholds, based on 1000
permutations and a type I error of 5% was 2.
R is the percentage of phenotypic variation explained by the QTL.
d
Negative and positive values indicate that BCD47 and Baronesse, respectively,
contributed the resistance QTL allele.
Proportion of the total variance explained by the QTL.
a
The controlled environment inoculations with two races of mildew gave nearly
identical results. When the phenotype data were used for QTL analysis a single QTL was
detected, on chromosome 1H (Fig. 1), with a peak between 10 cM and 13 cM at LOD 2.6
and it accounted for 93.9 % of the phenotypic variance. When the data were considered
41
as discrete and used to map the locus, it mapped to the same position as the QTL peak
between GMS21 and *k06257 markers.
Germplasm survey
The panel of 23 accessions that had been previously characterized for their BSR
resistance phenotypes and QTL architecture was used for two purposes: (i) to determine
if there was evidence for a new virulence based on dramatic changes in the level of BSR
severity in Peru vs. Mexico (a test environment where normally these lines are
evaluated), and (ii) to determine if there is a relationship between resistance QTL number
and the level of resistance.
The total germplasm array was not grown in TVM in 2004 due to a lack of seed.
However, a subset of the genotypes for which seed was available were grown in the TVM
and the disease severity values were consistent with previous years (data not shown). To
determine if there were changes in disease severity between locations that could indicate
a change in races, we compared data on the germplasm array from TVM2000 with
HP2000 and HP2004. The correlation between the 2000 and 2004 HP datasets was 0.81,
lending validity to the approach of referencing both years of HP data to the 2000 TVM
data. The correlations between TVM and HP 2000, and HP 2004 data were 0.79 and 0.90
respectively. These high correlations indicate that most lines showed consistent levels of
disease severity. However, there was a clear difference between the increases in disease
severity of C110587 in the two environments as opposed to most of the lines with
42
quantitative resistance alleles (Figure 4). C110587, with the qualitative resistance gene at
7H had a 20% increase in severity whereas the 4H+5H QTL lines showed a more
consistent response across the two environments. It is noteworthy that lines derived from
C110587 (all D3
lines) and known to carry the 7H qualitative resistance genes, did not
show the same rate of increase in disease severity as C110587. This is circumstantial
evidence for a new virulence in Peru compatible with C1l0587, but a virulence against
which the 4H + 5H QTL resistance alleles remain effective.
Figure 4. Barley stripe rust disease seventies for selected barley accessions evaluated at
Toluca Valley, Mexico (2000) and Huancayo, Peru (2004). C110587, D3-6, D3-6/B23,
and D3-6/B61 all have a qualitative resistance gene on chromosome 7H. Cali-sib, Orca,
and BCD47 all have quantitative resistance alleles on chromosome 4H and 5H.
25
2.._
20
Cali-sib
Cali-sib
CI 10587
OrcaA
D3 61B23
D3-6/B61
10
D3-6/B23
D3-6/B61
-
)K D3-6
--
5
0
CI 10587
---i5e
MEXICO 2000
PERU 2004
43
Using the 2004 data, there was a clear difference in percentage severity between
accessions with at least one resistance allele and those considered susceptible (Fig. 5).
For example, accessions with no known resistance alleles (Galena and Harrington), or
only small-effect resistance alleles (Baronesse) had BSR seventies between 40 and 70%.
The highest disease severity among lines with one to three resistance alleles was 25%.
Lines with pyramided resistance alleles at loci on chromosomes 1H and 7H and
chromosomes 4H, 5H and 7H showed the lowest values of severity.
Fig. 5: Barley stripe rust seventies for 23 barley accessions sorted by their stripe rust
resistance allele architecture at barely stripe rust resistance QTL on 1H, 4H, and 5H and a
qualitative resistance gene on 7H. Huancayo, Peru (2004).
44
DISCUSSION
The coincidence of stripe rust severity QTL detected with the new phenotypic
data from HP and the reference data sets from TVM and WUSA confirms that the
quantitative resistance genes present in the ORO population are effective against the
spectrum of virulence encountered in each of the three environments.
This is an
encouraging finding, since it indicates that introgression of these genes into susceptible,
but adapted, germplasm may be justifiable given that the genes have a reasonable
expectation of durability: they have proven effective over the past 18 years in repeated
tests in Mexico and North America. These data cannot, however, rule out the possibility
that there is a new virulence in the region. In fact, the change in resistance phenotype in
80% of locally adapted varieties and germplasm in the Peruvian National Program, and
the different resistance phenotypes observed for C110587 and others lines of known
resistance gene architecture (Fig. 4) in Peru vs. Mexico lend support to the report of new
virulence. A defining attribute of quantitative resistance is non-race specificity (Van der
Plank 1963, 1968) and if there is indeed a new virulence in Peru, then perhaps some of
the stripe rust resistance QTL in BCD47 and Baronesse may indeed reflect the action of
quantitative resistance genes. The question of race-specificity of QTL is an interesting
one, as a degree of race specificity has been reported for some leaf rust resistance QTL
(Qi et al. 1998, 1999; Lindhout, 2002).
The five resistances QTL that were detected with the Peru data were detected
either in Mexico, or in the USA, but not all five were detected in either Mexico or the
USA. This could be of biological importance and indicate that there are different
45
virulence spectra at the three locations and that some of the QTL show race-specificity.
Likewise, the different magnitudes of QTL effects could also reflect QTL specificity. The
4H QTL had the largest effect in all three environments, but the smaller-effect QTL
varied in their relative magnitudes of effect. For example, 7H(b), 3H and 6H were most
important in HP; 3H and 2H(b) for TVM, and 7H(b), 7H(a) and 6H for W\
SA. However, we consider that is more likely that the difference in the number of QTL
detected, and the differences in estimates of QTL effect, are biases due to small
population size.
Based on random samples taken from the full ORO population, Vales et al. (2005)
detected three to five QTL when the population size of 100 and more (up to 9) were
detected using larger population sizes. The magnitudes of effect and allele phases at all
QTL were in agreement between the three data sets. In general, there are some very
minor differences in QTL position between the current map (Figure 1) and Vales et al.
(2005). An exception is the position at the 4H QTL. With a population size of 94 and the
current map, there are broad QTL peaks for TVM and WUSA, spanning 8.6 cM and
*k03352 - *k02892 marker intervals. Vales et al. (2005) reported the same phenomenon
with smaller population sizes, but at n = 409, a single QTL was observed at interval
EBmac635
HvMLO3. In the Peru data, a single distinct peak is observed at interval
ABG54 - *k07229. Castro et al. (2002a) also observed broad QTL peaks in this region
and concluded that there are at least two linked QTL. We are currently dissecting this
region with QTL isolines in order to understand the basis of this complexity. We attribute
the differences in map length to the use of the Kosambi instead of the Haldane mapping
46
ftinction and the slight differences in QTL position to the inclusion of new markers.
Using a population of 94 DH lines and TVM and Peru location we detected six of the
nine QTL detected by Vales et al. (2005) also in two locations (TVM and WUSA) but
with 409 DH lines. One implication of the number of QTL detected in HP vs. TVM and
WUSA is that HP may be an excellent testing site for BSR resistance gene mapping. If
HP is used, and the same resources are available, it could be advantageous to increase
population size and reduce assessment time by omitting collecting data on infection type.
All QTL for infection type were coincident with disease severity QTL, and all of them
had a modest effect (maximum LOD 4.4;
R2
max. 12.3). At the level of resolution
afforded by a QTL mapping experiment, it is not possible to determine if this correlated
response is due to pleiotropy or tight linkage.
There is ample evidence for the existence of resistance gene clusters in plants
(Chelkowski et al. 2003; Williams, 2003), and for the occurrence of quantitative and
qualitative resistance genes within such clusters (Wisser et al., 2005). The BSR QTL that
were targets of this investigation are located in regions of the genome where other
resistance genes are found (Toojinda et al. 2000; Hayes et al. 2003).
Of particular
interest is the presence of previously mapped BSR resistance QTL in the same region in
this and other germplasm (Toojinda et al. 2000) as two well-characterized powdery
mildew resistance loci: the Mia
locus
on IH and the mb
locus
on 4H. This association of
resistance QTL and mildew resistance prompted us to determine if either Mia or
mb
resistance alleles were present in BCD47 and/or Baronesse. BCD47 had not been
characterized for its response to specific isolates of mildew. Baronesse is reported to
47
carry the M1a3 resistance alleles (Hovmøller et al. 2000; Dreiseitl, 2003), analysis of its
pedigree (Mentor/Minerva//mutantVadal///Carlsberg/Union!//Opvasky/Salle//Ricardo/////
OriolI6 1 53P40) reveals that Mentor, Carlsberg, Oriol and Ricardo parents are reported to
carry M1a12, M1a8, M1a7 and M1a3 alleles, respectively (www.scri.sari.ac.uk!cprad).
The differential reaction of the parents to inoculation with isolates Bgh 5874 and
A27 confirmed the susceptibility of BCD47 and the resistance of Baronesse (Fig. 3). The
progeny had nearly identical infection types to inoculation with the two isolates and
mapping of the resistance, either as a QTL or as a Mendelian gene, positions the gene at
the reported position of the Mia locus on 1H (Figure 1). The natural occurrence of a
mildew epidemic at HP allowed rating of the population for mildew disease severity,
which revealed two QTL and the presence of resistance alleles in both parents. There are
no reports of mildew resistance, either qualitative or quantitative, at 2H(b) QTL. Based
on visual alignment of linkage maps, the QTL on chromosome 7H(b) appears to be
located in the same region as the Mlf gene (SchOnfeld et al. 1996) and a powdery mildew
resistance QTL in H. vulgare spp.
spontaneum
(Backes et al. 2003).
We were also able to capitalize on natural infection with leaf rust. Although the
disease pressure was low and both parents had similar levels of resistance, we were able
to map two QTL. The two QTL, with contrasting favorable alleles, interact in an epistatic
fashion and this may account for the preponderance of resistant lines in the population
(e.g. '-25% of the population has susceptible alleles at both loci and thus a susceptible
phenotype). The QTL on chromosome 3H appears to be located in the same region as
RphlO (Feuerstein et al. 1990), although a lack of common markers precludes to say if
48
the QTL and the major gene are coincident or are tightly linked. The QTL on 7H(b),
which accounted for 31% of the phenotypic variance, it is located in the same region as
the RphX gene mapped in Cali-sib and Shyri (Hayes et al. 1996; Toojinda et al. 2000).
Also mapping to this region are RphQ9, a QTL with race specificity (Qi 1999; Lindhout,
2002), and Rph3 (Park and Karakousis, 2002).
The array of germplasm included in the study consists primarily of genetic stocks
with varying numbers of BSR QTL resistance alleles at the chromosome 1 H, 4H, and 5H
QTL alleles and a major gene allele for resistance on 7H. We also included susceptible
parents of resistant x susceptible mapping populations (Harrington, Galena, and
Baronesse) in this array, although we subsequently discovered that Baronesse has
resistance alleles with minor effect QTL (Vales et al. 2005). We also included C110587,
donor of a qualitative resistance gene on 7H. Our rationale was that one or more of the
genetic stocks would be diagnostic of a shift in virulence that would reveal race-specific
QTL. C110587 showed the most dramatic change in phenotype, with a 60% disease
severity rating in HP2000 vs. 0% in TVM2000 (Castro et al. 2003 a). The same response
is seen in the USA and this level of resistance has been maintained in both countries since
that time. The disease severity of C110587 was only 20% in HP2004. This discrepancy
merits further study, since the 0
60% difference in disease severity suggests a "defeat"
of a major gene by a new race whereas a 20% increase in disease is more indicative of a
resistance gene behaving as a major gene in response to one race and as a QTL to another
race, a phenomenon reported in rice with bacterial blight (Li et al. 1999).
49
When the resistance stocks were grouped by the number of resistance QTL alleles
they are known to carry and then compared, every line had significantly lower disease
seventies than the 0-QTL allele group and the susceptible varieties (which included
Baronesse for reasons described previously) (Fig. 5). This is evidence for the continued
utility of this germplasm as donors of resistance genes. There was a tendency toward
increasing levels of resistance when more QTL alleles were pyramided per line, as
reported by Castro et al (2003a), although with the HP data from 2004, the differences
were not notable and they were not significant. Of particular interest are the lines with 7H
qualitative resistance gene from C110587. When deployed in C110587 at HP, this gene
did not confer an acceptable level of resistance in 2000 and significantly more disease
was observed in 2004 than expected, based on prior ratings in Mexico. However, when
deployed in combination with quantitative resistance alleles at 1H or 4H+5H it led to
some of the lowest levels of disease severity.
From a practical standpoint, the ORO population was useful since BCD47 also
contributed leaf rust and mildew resistance genes. Interestingly, Baronesse, of European
origin, and considered susceptible to BSR, also contributed resistance alleles effective in
the Andean environment. Of the two parents, it was the most resistant to leaf rust and
mildew and thus may contribute useful genes. The presence of positive and negative
transgressive segregants is reported in many disease QTL studies and thus the
contribution of positive alleles from "susceptible" parents is not entirely unexpected
(Hayes et al., 2003). The availability of genotype and phenotype information on this
population can be very useful. For example, as shown in Figure 6, ORO DH line 19 has
50
resistance to all three diseases under field conditions in Peru and the Baronesse resistance
gene at the Mia locus. The graphical genotype shows that this genotype carries expected
parental alleles at all marker loci for barley stripe rust resistance QTL.
Figure 6: The graphical genotype of ORO-019 at barley stripe rust, barley leaf rust and
powdery mildew QTL and Mla locus at Huancayo, Peru 2004.
Barley stripe rust
QTL
3H(*)
4H
6H
7Ha
7Hb
H
Severity 15 %
I
I
BCD47
I
I
Baronesse
(*) The split panel for 3H indicates contrasting alleles at the loci flanking the QTL peak.
There was a crossover between the markers flanking the 3H QTL, which may assist in
future efforts for finer mapping of this locus. ORO-19 does not have the target smalleffect QTL at the 7H(b). This line carries the contrasting target alleles at the two barley
leaf rust QTL and the predicted favorable allele at the barley powdery mildew QTL on
7H(b). It is only lacking the favorable allele at the 2H(b) QTL; this could be remedied in
a subsequent cycle of crossing. Such knowledge will be very useful in introgression
resistance genes from BCD47 and Baronesse into locally adapted material.
51
In conclusion, this research was useful in confirming the value of quantitative
stripe rust resistance genes that we have mapped and introgressed, via MAS, into North
American germplasm. These resistance genes were discovered through collaborative
efforts with the ICARDA/CIMMYT program and National Program scientists in the
Andean region. Calicuchima sib and Shyri, for example, were identified as resistant and
released in the Andean region. It is thus fitting that these genes are returned to the
Andean National Programs, with value added via marker information that will allow for
their efficient introgression.
resistance.
Optimistically, this will lead to high levels of durable
However, vigilance and continued gene discovery and introgression are
essential, because what appears to be a non-race specific QTL today may, in the face of
new virulence, become a "defeated" major gene, or vice versa. Considered in the context
of our previous research with these genes, we conclude that the optimum defense strategy
will be based on marker-assisted pyramiding of multiple quantitative and/or qualitative
resistance genes. We believe that long term collaboration, involving monitoring of
virulence through race typing and the field assessment of mapping populations and
genetic stocks, will be essential for the continued health of the barley crop.
ACKNOWLEDGEMENTS
We offer special thanks to Ann Corey, Tanya Filichkina and Kelly Richardson for their
technical support in the lab and in the preparation of the set lines.
52
LITERATURE CITED
Backes, G., L.H. Madsen, H. Jaiser, J. Stougaard, M. Herz, V. Mohier and A. Jahoor.
2003. Localisation of genes for resistance against Blumeri graminis f.sp. hordei
and Puccinia graminis in a cross between a barley cultivar and a wild barley
(Hordeum vulgare ssp. spontaneum) line. Theor. Appl. Genet. 106:353-362.
Bushnell, W.R. 2002. The role of powdery mildew research in understanding hostparasite interaction: Past, present and future. In The Powdery Mildews: A
Comprehensive Treatise, R.R. Bélanger, W.R. Bushnell, A.J. Dik, and T.L.W.
Carver, eds (St. Paul, MN: APS Press), pp. 1-12.
Castro, A.J., X.M. Chen, P.M. Hayes, S.J. Knapp, R.F. Line, T. Toojinda, H. Vivar.
2002a. Coincident QTL which determine seedling and adult plant resistance to
stripe rust barley. Crop Sci. 42:1701-1708.
Castro, A.J., P.M. Hayes, T. Fillichkin and C. Rossi. 2002b. Update of barley stripe rust
resistance in the Calicuchima-sib x Bowman mapping population. Barley Genetic
Newsl. 32:1-12.
Castro, A.J., F. Capettini, A.E. Corey, T. Fillichkin, P.M. Hayes, A. Kleinhofs, D.
Kudrna, K. Richardson, S. Sandoval-Islas, C. Rossi and H. Vivar. 2003a.
Mapping and pyramiding of qualitative and quantitative resistance to stripe rust in
barley. Theor. Appi. Genet. 107:922-930.
Castro, A.J., X.M. Chen, P.M. Hayes and M. Johnston. 2003b. Pyramiding quantitative
trait locus (QTL) alleles determining resistance to barley stripe rust: effects on
resistance at seedling stage. Crop Sci. 43:651-659.
Chelkowski, J., M. Tyraka and A. Sobkiewicz. 2003. Resistance genes in barley
(Horedum vulgare) and their identification with molecular markers. Journal of
Applied Genetics 44(3):291-309.
Chen, F., D. Prehn, P.M. Hayes, D. Muirooney, A. Corey and H. Vivar. 1994. Mapping
genes for resistance to barley stripe rust (Puccinia striformis f. sp. hordei).
Theoretical and Applied Genetic 88:215-2 19.
Collinge, D.B., Gregersen, P.L., and Thordal-Christensen, H. 2002. The nature and role
of defense response genes in cereals. In The Powdery Mildews: A Comprehensive
Treatise, R.R. Bélanger, W.R. Bushnell, A.J. Dik, and T.L.W. Carver, eds (St.
Paul, MN: APS Press), pp. 146-1 60.
53
Dreiseitl, A. 2003. Adapation of Blumeria graminis f.sp. hordei to barley resistance
genes in the Czech Republic in 1971-2000. Plant Soil Environment 49(6):241248.
Feurestein, U., A.H.D. Brown and J.J. Burdon. 1990. Linkage of Rust Resistance Genes
from Wild Barley (Hordeum spontaneum) with Isozyme Markers. Plant Breeding
104, 3 18-324.
Giese, H., J.H. Jørgensen, H.P. Jensen and J. Jensen. 1981. Linkage relationships of ten
powdery mildew resistance genes on barley chromosome 5. Hereditas 95: 43-50.
Hayes, P., D. Prehn, H. Vivar, T. Blake, A. Comeau, I. Henry, M. Johnston, B. Jones, B.
Steffenson, C.A. St. Pierre and F. Chen. 1996. Multiple Disease Resistance Loci
and Their Relationship to Agronomic and Quality Loci in a Spring Barley
Population. http://probe.nalusda.gov :8000/otherdocs/igtl/iqtl I 996-021iqt122 .html
Hayes, P.M., A. Castro, L. Marquez-Cedillo, A. Corey, C. Henson, B.L. Jones, J. Kling,
D. Mather,
I.
Matus, C. Rossi and K. Sato. 2003. Genetic diversity for
quantitative inherited agronomic and malting quality traits. In R. von Bothmer at
al. (ed.) Diversity in Barley (Hordeum vulgare). Elsevier Science Publishers,
Amsterdam.
Hittalmani, S., A. Parco, T.V. Mew, R.S. Zeigler and N. Huang. 2000. Fine mapping and
DNA marker-assisted pyramiding of the three major genes for blast resistance in
rice. Theoretical and Applied Genetics 100(7):1 121-1128.
Hon K., T. Kobayashi, A. Shimizu, K. Sato, K. Takeda and S. Kawasaki. 2003. Efficient
con-struction of high-density linkage map and its application to QTL analysis in
barley. Theoretical and Applied Genetics. 107: 806-8 13.
Hovmøller, M.S., V. Caffier, M. Jalli, 0. Andersen, G. Besenhofer, J.H. Czembor, A.
Dreiseiti, F. Felsenstein, A. Fleck, F. Heinrics, R. Jonsson, E. Limpert, P. Mercer,
S. Plesnik, I. Rashal, H. Skinnes, S. Slater and 0. Vronska. 2000. The European
barley powdery mildew virulence survey and disease nursery 1993-1999.
Agronomie 20:729-743.
Ji, Y., B.J. Steffenson and T.G. Fetch Jr. 1994. Sources of resistance to pathotype QCC of
Puccinia gram mis f. sp. tritici in barley. Crop Science 34:1, 285-288.
Johnson, R. 1979. The concept of durable resistance. Phytopathology 69:198-1999.
54
Kleinhofs, A., A. Kilian, M.A. Saghai Maroof, R.M. Biyashev, P. Hayes, F.Q. Chen, N.
Lapitan, A. Fenwich, T.K. Blake, V. Kanazin, E. Ananiev, L. Dahleen, D.
Kudma, J. Bollinger, S.J. Knapp, B. Liu, M. Sorrells, M. Heun, J.D. Franckowiak,
D. Hoffman, R. Skadsen, and B.J. Steffenson. 1993. A molecular, isozyme and
morphological map of the barley (Hordeum vulgare) genome. Theoretical and
Applied Genetics 86:705-7 12.
Kover, P.X. and A.L. Caicedo. 2001. The genetic architecture of disease resistance in
plants and the maintenance of recombination by parasites. Molecular Ecology
10: 1-16.
Kosambi, D.D. 1944. The estimation of map distance from recombination values. Annals
of Eugenics. 12:172-175.
Li
,
Z.K., L.J. Luo, H.W. Mei, A.H. Paterson, X.H. Zhao, D.B. Zhong, Y.P. Wang, X.Q.
Yu, L. Zhu, R. Tabien, J.W. Stansel, C.S. Ying. 1999.A "defeated" rice resistance
gene acts as a QTL against a virulent strain of Xanthomonas oryzae pv. oryzae.
Molecular and general genetics 261:58-63.
Lindhout P. 2002. The perspectives of polygenic resistance in breeding for durable
disease resistance. Euphytica 124:217-226.
Line, R.F. 2002. Stripe rust of wheat and barley in North America: a retrospective
historical review. Annu. Rev. Phytopathol. 40:75-118.
Line, R.F., and X.M. Chen. 1995. Success in breeding for and managing durable
resistance to wheat rusts. Plant Dis. 79:1254-1255.
Moseman, J.G., 1972 Isogenic barley lines for reaction to Erysiphe graminis f. sp. hordei.
Crop Science 12: 68 1-682.
Narayanan, N.N., Niranjan-Baisakh, N.P. Oliva, C.M. VeraCruz, S.S. Gnanamanickam,
Karabi-Datta and S.K. Datta. 2004. Molecular breeding: marker assisted selection
combined with biolistic transformation for blast and bacterial blight resistance in
Indica rice (cv. C039). Molecular Breeding 14(1)61-7 1.
Park, R.F. and A. Karakousis. 2002. Characterization and mapping of gene Rph 19
conferring resistance to Puccinia hordei in the cultivar Reka 1 and several
Australian barleys. Plant breeding 12 1:232-236.
Parlevliet, J.E. 1977. Evidence of Differential Interaction in the Polygenic Hordeum
Puccinia hordei Relation During Epidemic Development.
vulgare
Phytopathology 67: 776-778.
55
Qi, X., E.E. Nicks, P. Stam, and P. Lindhourt. 1998. Identification of QTLs for partial
resistance to leaf rust (Puccinia hordei) in barley. Theor. Appi. Genet. 96:120512135.
Qi, X., G. Jiang, W. Chen, R.E. Nicks, P. Stam, and P. Lindhourt. 1999. Isolate-specific
QTLs for partial resistance to Puccinia hordei in barley. Theor. App!. Genet.
99:877-884.
Schön C.C., H.F. Utz, S. Groh, B. Truberg, S. Openshaw and A.E. Melchinger. 2004.
Quantitative trait locus mapping based on resampling in a vast maize testcross
experiment and its relevance to quantitative genetics for complex traits. Genetics
167:485-498.
Schonfeld M., A. Ragni, Fischbeck G. and Jahoor A. 1996. RFLP mapping of three new
loci for resistance genes to powdery mildew (Erysiphe graminis f. sp. hordei) in
barley. Theoretical and Applied Genetic 93: 48-5 6
Schumann, G.L. 1991. Plant diseases. Their Biology and Social Impact. American
Phytopathological Society, St. Paul, Minnesota
Thiel, T., W. Michalek, R.K. Varshney and A. Graner. 2003. Exploiting EST database for
the development and characterization of gene-derived S SR-markers in barley
(Hordeum vulgare L.) Theoretical and applied genetics 106:4 1 1-422.
Toojinda, T., E. Baird, A. Booth, L. Broers, P. Hayes, W. Powell, W. Thomas, H. Vivar
and G. Young. 1998. Introgression of quantitative trait loci (QTL5) determining
stripe rust resistance in barley: an example of marker-assisted line development.
Theor. Appl. Genet. 96: 123-13 1.
Toojinda, T., E. Baird, L. Broers, X.M. Chen, P.M. Hayes, A. Kleinhofs, J. Korte, D.
Kudrna, H. Leung, R.F. Line, W. Powell, and H. Vivar. 2000. Mapping
quantitative and qualitative disease resistance genes in a doubled haploid
population of barley. Theor. App!. Genet. 101:580-589.
Torp J, H.P. Jensen and J.H. Jørgensen. 1978. Powdery mildew resistance genes in 106
Northwest European spring barley varieties. Royal Veterinary and Agricultural
Univeristy Yearbook, Copenhagen, 75-102.
Vales, M.I, C.C. Schön, F. Capettini, X.M. Chen, A.E. Corey, D.E. Mather, C.C. Mundt,
K.L. Richardson, J.S. Sandoval-Islas, H.F. Utz and P.M. Hayes. 2005. Effect of
population size on the estimation of QTL: A test using resistance to barley stripe
rust. Theoretical and Applied Genetic (in press)
56
Vanderplank, J.E. 1963. Plant diseases: epidemics and control. Academic Press, New
York/London, 349 pp.
Vanderplank, J.E. 1968. Disease resistance in plants. Academic Pres, New York/London,
206 p.
van Ooijen, J.W. and R.E. Voorrips. 2001. JoinMap 3.0 software for the calculation of
genetic linkage maps. Biometris, Wageningen Univ., Plant Res. mt., the
Netherlands.
Wang S., C. J. Basten, and Z.-B. Zeng. 2005. Windows QTL Cartographer 2.5.
Department of Statistics, North Carolina State University, Raleigh, NC.
(http://statgen.ncsu.edu/gticart/ WOTLCart.htm)
Walker, D.R., J.M. Narvel, H.R. Boerma, J.N. All and W.A. Parrott. 2004. A QTL that
enhance and broadens Bt insect resistance in soybean. Theoretical and Applied
Genetics 109(5):1051-1057.
Wei, F., K. Gobelman-Werner, S. Morroll, J. Long, L. Mao, R. Wing, D. Leister, P.
Schulze-Lefert and R. Wise. 1999. The Mla (Powdery Mildew) Resistance
Cluster Is Associated with Three Nbs Lrr Gene Families and Suppressed
Recombination Within a 240-Kb DNA Interval on Chromosome 5s (lhs) of
Barley. Genetics 153:1929-1948.
Williams, K.J. 2003. The molecular genetics of diseases resistance in barley. Australian
Journal of Agriculture Research 54:1065-1079.
Wisser R.J., Q. Sun, S.H. Hulbert, S. Kresovich and R.J. Nelson. 2005. Identification and
Characterization of Regions of the Rice Genome Associated with BroadSpectrum, Quantitative Disease Resistance. Genome 169:2277-2293.
Yan L, V. Echenique, C. Busso, P. SanMiguel, W. Ramakrishna, J.L. Bennetzen, S.
Harrington and J. Dubcovsky. 2002 Cereal genes similar to Snf2 define a new
subfamily that includes human and mouse genes. Molecular Genetics and
Genomics 268: 488-499.
Yi, G., S.K. Lee, Y.K. Hong, Y.C. Cho, M.H. Nam, S.C. Kim, S.S. Han, G.L. Wang,
T.R. Hahn, P.C. Ronald and J.S. Jeon. 2004. Use of P15(t) markers in markerassisted selection to screen for cultivars with resistance to Magnaporthe grisea.
Theoretical and Applied Genetics 1 09(5):978-985.
57
Young, N.D. 1996. QTL mapping and quantitative disease resistance in plants. Ann. Rev.
Phytopathology 34:479-501.
Zeng, Z.B. 1994. Precision mapping of quantitative trait loci. Genetics 136:1457-1468
58
General Conclusions
Quantitative trait locus (QTL) mapping has been a widely-used tool in plant
genetics research. The usefulness of the technique has been questioned on the grounds of
bias attributable to population size. Linkage disequilibrium approaches to gene detection
in germplasm arrays are currently the focus of intensive research because they do not
require the time and resources necessary for structure population development and
assessment. The results of this research demonstrate that a structured mapping population
can have long-term utility.
The ORO population was developed primarily for determining the effects of
population size on the estimates of barley stripe rust resistance QTL number, location,
effect, and interaction. In this research, the ORO population was grown in a field
experiment at Huncayo, Peru and in a controlled environment experiment at Ames, Iowa.
The goal of the Peru experiment was to answer the question "are the same stripe rust
resistance QTL, different QTL, or no QTL detected when the population is challenged
with a putative new race of the pathogen?" In the course of the experiment, we were also
able to rate the population for reaction to natural infection with two other diseases
leaf
rust and powdery mildew. As an adjunct to this mapping population experiment, we
included an array of barley genotypes of known stripe rust resistance gene architecture in
order to compare their disease levels across environments. The goal of the Iowa
experiment was to determine if the parents contrasted for their reaction to specific
59
mildew isolates diagnostic for the Mia and mb loci so that this polymorphism could be
mapped in the ORO population. This research was prompted by the observation that two
well-characterized mildew resistance genes - IvIla and mb - are in the proximity of stripe
rust resistance QTL we have mapped in the ORO population (4H, mb) and in the Shyri x
Galena population (1H,
Mba).
Baronesse was reported to carry Mla resistance; the
mildew resistance of BCD47 was unknown.
Key results of these two experiments
Stripe rust
* The same stripe rust resistances QTL were detected at Huancayo, Peru that had
previously been mapped in the Toluca Valley of Mexico and at Mount Vernon and
Pullman, Washington. Even if there is new race of stripe rust in Peru, at least the mapped
QTL are still effective.
* There were some differences in the significance and magnitude of stripe rust
resistance QTL across the different environments: this could be a consequence of the
small population size or it could indicate a degree of QTL: race specificity.
* The chromosome 4H resistance QTL has the largest effect in all environments.
Higher marker density has not improved QTL resolution, suggesting that there may be
multiple linked QTL in this region.
* The higher stripe rust disease severity for C110587 in Peru vs. Mexico is
indirect evidence for different pathogen races at the two locations. Based on a
60
comparison of disease seventies in the two environments from 2000, it would appear that
the major gene in C110587 was defeated in Peru. Based on a comparison of disease
seventies in the two environments in 2004, it would appear that the major gene is now a
QTL in Peru.
* The major gene, when present together with quantitative resistance alleles,
appears to still have some effect since the highest levels of stripe rust resistance were
seen in genotypes that are pyramids of multiple resistance genes.
* In general, information on the number and location of stripe rust resistance
genes is predictive of their resistance phenotype, but there were some notable exceptions,
suggesting that there are still uncharacterized resistance genes in this germplasm.
Leaf rust
* The ORO population is a resource for leaf rust resistance gene mapping and
both parents contribute favorable alleles. These alleles interact in an epistatic fashion
such that either resistance allele gave a quantitatively resistant phenotype. Higher levels
of disease were observed when there were susceptible alleles at both QTL.
* The map positions of the leaf rust resistance QTL are in proximity with
qualitative leaf rust resistance genes.
61
Mildew
* The use of diagnostic isolates confirms the Mia resistance in Baronesse.
* At Huancayo, the
Mia locus
was not a determinant of mildew reaction. Instead,
QTL were mapped where, as in the case of leaf rust, both parents contributed resistance
alleles determinants of resistance.
* The map position of one QTL is in proximity with a qualitative resistance gene.
At the other QTL, there are no reports of mildew resistance genes.
Recommendations for future research
Ideally, a balanced data set should be generated that would involve field
assessment of stripe rust resistance in the full ORO mapping population and the
germplasm array in Peru, Mexico, and the USA. In each environment, the pathogen race
composition should be determined. The same individuals should perform disease ratings
in
all environments and to the extent possible, the effects of other diseases and
environmental factors should be minimized.
The germplasm array should be genotyped at all quantitative and qualitative
resistance gene positions. This will provide better estimates of the effects of gene
pyramiding and facilitate resistance gene introgression.
The question of whether the 7H qualitative resistance gene is defeated in Peru or
converted to a resistance QTL could be addressed by including the C110587 x Galena
mapping population in the multi-environment test.
62
Resolving the complexity of the 4H QTL will require the use of QTL isolines
with defined breakpoints throughout the 4H region.
The ORO population has been very useful in identifying resistance gene clusters
that involve quantitative and qualitative genes conferring resistance to the same pathogen
(e.g. leaf rust QTL and Rphx on 7H) and different pathogens (e.g. mb and stripe rust
QTL on 4H). The use of QTL isolines should further narrow down the target regions and
ultimately comparative sequencing of key regions in representative regions should reveal
the structure and function of these resistance gene clusters.
63
Bibliography
Alemayehu, F. and J.E. Parlevliet. 1996. Variation for resistance to Puccinia hordei in
Ethiopian barley landraces. Euphytica 90: 365-370.
Backes G., A. Granner, B. Foroughi-Wehr, G. Fischbeck, G. Wenzel and A. Jahoor.1995.
Localization of quantitative trait loci (QTL) for agronomic important characters
by the use of a RFLP map in barley (Hordeum vulgare L.). Theor. Appi. Genet.
90: 294-302.
Backes G., G. Schwarz, G. Wenzel and A. Jahoor. 1996. Comparison between
QTLanalysis of powdery mildew resistance in barley based on detached primary
leaves and onfield data. Plant Breeding 115: 419-421.
Backes, G., L.H. Madsen, H. Jaiser, J. Stougaard, M. Herz, V. Mohler and A. Jahoor.
2003. Localisation of genes for resistance against Blumeri graminis f.sp. hordei
and Puccinia graminis in a cross between a barley cultivar and a wild barley
(Hordeum vulgare ssp. spontaneum) line. Theor. Appl. Genet. 106:353-362.
Bakshi, J.S. and J.K. Luthra 1971. Inheritance of resistance to stripe rust (Puccinia
striformis west.) in barley. In: Nilan RA (ed) Proc Symp Barley Genet II.
Washington State University Press, Pullman, Washington, pp 478-483.
Becker, J., P. Vos, M. Kuiper, F. Salamini and M. Heun. 1995. Combined mapping of
AFLP and RFLP markers in barley. Molecular and Genome Genetics 249:65-73.
Biffen, R.H. 1905. Mendel's laws of inheritance and wheat breeding. J Agric Sci 1:4-48.
Borovkova, I.G., Y. Jin, B. J. Steffenson, A. Kilian, T.K. Blake and A. Kleinhofs. 1997.
Identification and mapping of a leaf rust resistance gene in barley line Q21 861.
Genome, 40: 236-241.
Bothmer von R. 1992. The wild species of Hordeum: Relationships and potential use for
improvement of cultivated barley. In Shewry, P.R. (ed.) Barley: Genetics,
biochemistry, molecular biology and biotechnology, p. 3
Oxford.
18, CAB International,
Briggs, D.E. 1978. Barley. Chapman & Hall, London, 612 p.
Buschges, R., K. Holiricher, R. Panstruga, G. Simons, M. Wolter, A. Frijters, R. van
Daelen, T. van der Lee, P. Diergaarde, J. Groenendijk, S. Topsch, P. Vos, F.
Salamini and P. Schuze-Lefert. 1997. The barley Mb gene: a novel control
element of plant pathogen resistance. Cell 88,695-705.
64
Bushnell, W.R. 2002. The role of powdery mildew research in understanding hostparasite interaction: Past, present and future. In The Powdery Mildews: A
Comprehensive Treatise, R.R. Bélanger, W.R. Bushnell, A.J. Dik, and T.L.W.
Carver, eds (St. Paul, MN: APS Press), pp. 1-12.
Castro, A.J., X.M. Chen, P.M. Hayes, S.J. Knapp, R.F. Line, T. Toojinda, H. Vivar.
2002a. Coincident QTL which determine seedling and adult plant resistance to
stripe rust barley. Crop Sci. 42:1701-1708.
Castro, A.J., P.M. Hayes, T. Fillichkin and C. Rossi. 2002b. Update of barley stripe rust
resistance in the Calicuchima-sib x Bowman mapping population. Barley Genetic
Newsl. 32:1-12.
Castro, A.J., F. Capettini, A.E. Corey, T. Fillichkin, P.M. Hayes, A. Kleinhofs, D.
Kudrna, K. Richardson, S. Sandoval-Islas, C. Rossi and H. Vivar. 2003a.
Mapping and pyramiding of qualitative and quantitative resistance to stripe rust in
barley. Theor. Appl. Genet. 107:922-930.
Castro, A.J., X.M. Chen, P.M. Hayes and M. Johnston. 2003b. Pyramiding quantitative
trait locus (QTL) alleles determining resistance to barley stripe rust: effects on
resistance at seedling stage. Crop Sci. 43:651-659.
Chelkowski, J., M. Tyraka and A. Sobkiewicz. 2003. Resistance genes in barley
(Horedum vulgare) and their identification with molecular markers. Journal of
Applied Genetics 44(3):291-309.
Chen, F., D. Prehn, P.M. Hayes, D. Mulrooney, A. Corey and H. Vivar. 1994. Mapping
genes for resistance to barley stripe rust (Puccinia striformis f. sp. hordei).
Theoretical and Applied Genetic 88:215-219.
Chen X.M., R.F. Line and H. Leungh. 1998. Genome scanning for resistance-gene
analogs in rice, barley, and wheat by high-resolution electrophoresis. Theoretical
and Applied Genetics 97:345-3 55.
Chen, X.M. and R.F. Line. 1999. Recessive genes for resistance to Puccinia striformis f.
sp. hordei in barley. Phytopathology 89:226-232.
Clifford, B.C. and H.W. Roderick. 1978. A comparative histology of some barley brown
rust interactions. Ann AppI Biol 89, 295-298.
Collinge, D.B., Gregersen, P.L., and Thordal-Christensen, H. 2002. The nature and role
of defense response genes in cereals. In The Powdery Mildews: A Comprehensive
Treatise, R.R. Bélanger, W.R. Bushnell, A.J. Dik, and T.L.W. Carver, eds (St.
Paul, MN: APS Press), pp. 146-1 60.
65
Collins, N., R. Park, W. Spielmeyer, J. Ellis and A.J. Pryor. 2001. Resistance gene
analogs in barley and their relationship to rust resistance genes. Genome 44:375381.
Cook, J.R. 1998. The molecular mechanism responsible for resistance in plant-pathogen
interactions of the gene-for-gene type function more broadly then previously
imagined. Proceedings of the National Academy of Science of the United State of
America Vol.95(17):971 1-97 12.
Cotterill, P.J., R.F. Park and R.G. Rees. 1995. Pathogenic Specialization of Puccinia
hordei Otth. in Australia, 1966-1990. Aust. J. Agric. 46, 127-34.
Czembor, J.H. 2000. Sources of powdery mildew resistance in barley landraces collected
form Algeria and Tunisia. Cereal Rust and Powdery Mildew Bulletin
(www.crpmb.org/) 2000/O607czembor.
Dreiseiti, A. 2003. Adapation of Blumeria graminis f.sp. hordei to barley resistance
genes in the Czech Republic in 1971-2000. Plant Soil Environment 49(6):241248.
Drescher, A., V. Ivandic, U. Walther and A. Graner. 2000. High resolution mapping of
the Rph 16 locus in barley. In 'Proceedings of the 8th International Barley
Genetics Symposium'. (Ed. S. Logue) (Adelaide University, Department of Plant
Science: Adelaide, S. Aust.)
Dubin, H.J. and R.W. Stubbs. 1986. Epidemic spread of barley stripe rust in South
America. Plant Disease 70:141-144.
Ellis J.G., G.J. Lawrence, W.J. Peacock and A.J. Pryor. 1998. Approaches to cloning
plant genes conferring resistance to fungal pathogens. Annu Rev Phytopathol
26:245-263
Falak, I., D.E. Falk, N.A. Tinker and D.E. Mather. 1999. Resistance to powdery mildew
in a doubled haploid barley population and its association with marker loci.
Euphytica 107:185-192.
Feurestein, U., A.H.D. Brown and J.J. Burdon. 1990. Linkage of Rust Resistance Genes
from Wild Barley (Hordeum spontaneum) with Isozyme Markers. Plant Breeding
104, 3 18-324.
Feuillet, C. and B. Keller. 1999. High gene density is conserved at syntenic loci of small
and large grass genome. Proc Nat Acad Sci 96:8265-8270.
66
Flor, H.H. 1955. Host-parasite interactions in flax rust
implications. Phytopathology 45:680-685.
its genetics and other
Franckowiak, J.D., Y. Jin and B.J. Steffenson. 1996. Recommended allele symbols for
leaf rust resistance genes in barley. Barley Genetics News!. 27:36-44.
Fufa, F. and D.L. Danial. 1995. Evaluation of barley landraces for resistance and
agronomic traits in north western Ethiopia. Breeding for disease resistance with
emphasis on durability. Proceeding of a regional workshop for eastern, central
and southern Africa, Njoro, Kenya, Oct. 2-6, 1994. Pag. 167-170.
Giese, H., J.H. Jørgensen, H.P. Jensen and J. Jensen. 1981. Linkage relationships of ten
powdery mildew resistance genes on barley chromosome 5. Hereditas 95: 43-50.
Giese, H., A.J. Holm-Jensen, H. Mathiassen, B. Kjaer, S.K. Rasmussen, H. Bay and J.
Jensen. 1994. Distribution of RAPD markers on a linkage map of barley.
Hereditas 3:267-273.
Graner, A., A. Jahoor, J. Schondelmaier, H. Siedler, K. Pillen, G. Fischbeck, G. Wenzel
and R.G. Herrmann. 1991. Construction of an RFLP map in barley. Theoretical
and Applied Genetic 83:250-256
Graner, A., S. Streng, A. Drescher, Y. un, I. Borovkova and B.J. Steffenson. 2000.
Molecular mapping of the leaf rust resistance gene Rph7 in barley. Plant Breeding
119:389-392.
Griffey, C.A. and M.K. Das. 1994. Yield Losses in Winter Barley Resulting from a New
Race of Puccinia hordei in North America. Plant Dis. 78:256-260.
Halterman, D., F.S. Zhou, F.S. Wei, R. Wise and P. Schuze-Lefert. 2001. The MLA6
coiled-coil, NBS-LRR protein confers AvrMla6-dependent resistance specificity
to Blumeriagraminis f.sp. hordei in barley and wheat. Plant journal 25,335-348.
Hayes, P., D. Prehn, H. Vivar, T. Blake, A. Comeau, I. Henry, M. Johnston, B. Jones, B.
Steffenson, C. A. St. Pierre and F. Chen. 1996. Multiple Disease Resistance Loci
and Their Relationship to Agronomic and Quality Loci in a Spring Barley
Population. http://probe.nalusda.gov : 8000/otherdocs/j gtlligtl 1 996-02/igtl22.html
Hayes, P.M., A. Castro, L. Marquez-Cedillo, A. Corey, C. Henson, B.L. Jones, J. Kling,
D. Mather,
I.
Matus, C. Rossi and K. Sato. 2003. Genetic diversity for
quantitative inherited agronomic and malting quality traits. In R. von Bothmer at
al. (ed.) Diversity in Barley (Hordeum vulgare). Elsevier Science Publishers,
Amsterdam.
67
Heun M, A.E. Kennedy, J.A. Anderson, N.L.V. Lapitan, M.E. Sorrells and S.D.
Tanksley. 1991. Construction of a restriction fragment length polymorphism map
for barley (Hordeum vulgare). Genome 34: 437-447.
Heun M. 1992. Mapping quantitative powdery mildew resistance of barley using a
restriction fragment length polymorphisms map. Genome 32: 1019-1025.
Hittalmani, S., A. Parco, T.V. Mew, R.S. Zeigler and N. Huang. 2000. Fine mapping and
DNA marker-assisted pyramiding of the three major genes for blast resistance in
rice. Theoretical and Applied Genetics 100(7):1 121-1 128.
Hon K., T. Kobayashi, A. Shimizu, K. Sato, K. Takeda and S. Kawasaki. 2003. Efficient
con-struction of high-density linkage map and its application to QTL analysis in
barley. Theoretical and Applied Genetics. 107: 806-8 13.
Hovmøller, M.S., V. Caffier, M. Jalli, 0. Andersen, G. Besenhofer, J.H. Czembor, A.
Dreiseiti, F. Felsenstein, A. Fleck, F. Heinrics, R. Jonsson, E. Limpert, P. Mercer,
S. Plesnik, I. Rashal, H. Skinnes, S. Slater and 0. Vronska. 2000. The European
barley powdery mildew virulence survey and disease nursery 1993-1999.
Agronomie 20:729-743.
Ivandic V, U. Waither and A. Graner. 1998. Molecular mapping of a new gene in wild
barley conferring complete resistance to leaf rust (Puccinia hordei Otth.).
Theoretical and Applied Genetic 97:1235-1239.
Jin, Y., G.D. Statler, J.D. Franckowiak and B.J. Steffenson. 1993. Linkage between leaf
rust resistance and morphological markers in barley. Phytopathology 83 :230-233.
Jin, Y. and B.J. Steffenson. 1994. Inheritance of Resistance to Puccinia hordei in
Cultivated and Wild Barley. Journal of Heredity 85:45 1-454.
Jin, Y., B.J. Steffenson and T.G. Fetch Jr. 1994. Sources of resistance to pathotype QCC
ofPucciniagraminis f. sp. tritici in barley. Crop Science 34:1, 285-288.
Jin, Y., B.J. Steffenson and H.E. Bockelman. 1995. Evaluation of cultivated and wild
barley for resistance to pathotypes of Puccinia hordei with wide virulence.
Genetic Resources and Crop Evolution 42:1, 1-6.
Jin, Y., G.H. Cui, B.J. Steffenson, and J.D. Franckowiak. 1996. New Leaf Rust
Resistance Gene in Barley and Their Allelic and Linkage Relationship with Other
Rph Genes. Phytopathology 86: 887-890.
68
Johnson, R. 1979. The concept of durable resistance. Phytopathology 69:198-1999.
Jorgensen, J.H. 1994. Genetics of powdery mildew resistance in barley. Crit Rev Plant
Sci 13:97-119.
Kiesling, R.L. 1985. The diseases of barley. p. 269-308. In. D.C.Rasmusson (ed.) Barley.
Agronomy 26. ASA.
Kircherer, S., G. Backes, U. Walther and A. Jahoor. 2000. Localising QTLs for leaf rust
resistance and agronomics traits in barley (Hordeum vulgare L.). Theoretical and
Applied Genetics 100: 88 1-888.
Kleinhofs, A., A. Kilian, M.A. Saghai Maroof, R.M. Biyashev, P. Hayes, F.Q. Chen, N.
Lapitan, A. Fenwich, T.K. Blake, V. Kanazin, E. Ananiev, L. Dahleen, D.
Kudrna, J. Bollinger, S.J. Knapp, B. Liu, M. Sorrells, M. Heun, J.D. Franckowiak,
D. Hoffman, R. Skadsen, and B.J. Steffenson. 1993. A molecular, isozyme and
morphological map of the barley (Hordeum vulgare) genome. Theoretical and
Applied Genetics 86:705-712.
Kleinhofs A. and A. Graner. 2001. An integrated map of the barley genome. in DNAbased markers in plants (R. L. Phillips and I. K. Vasil editors). ppl87-199.
Kluver Academic Publishers.
Kunzel, G., Korzun, L. and Meister, A. 2000. Cytologically integrated physical
restriction fragment length polymorphism maps for barley genome based on
translocation breakpoints. Genetics 154: 397-4l2.
Knott, D.R. 1989. The wheat rusts-breeding for resistance. Springer, Berlin Heidelberg
New York. Monographs on theoretical and applied genetics, vol. 12. 2Olpp.
Kover, P.X. and A.L. Caicedo. 2001. The genetic architecture of disease resistance in
plants and the maintenance of recombination by parasites. Molecular Ecology
10: 1-16.
Kosambi, D.D. 1944. The estimation of map distance from recombination values. Annals
of Eugenics. 12:172-175.
Landar, E.S. and D. Botstein, 1989. Mapping Mendelian factors underlying quantitative
traits using RFLP linkage maps. Genetics 121: 195-199.
Lehmann, C.O., I. Nover and F. Scholz. 1976. The Gatersleben Barley Collection and its
evaluation. Pp. 64-69 in Barley Genetics III. Proc. Third Internat. Barley Genetics
Symposium, MUnchen.
69
Leur, J.A.G., S. Ceccarelli and S. Grando. 1989. Diversity for disease resistance in barley
landraces from Syria and Jordan. Plant Breeding 103:4, 324-335.
Levine, M.N. 1928. Biometrical studies on the variation of physiological forms of
Puccinia graminis tritici and the effects of ecological factors on the susceptibility
of wheat varieties. Phytopathology 18, 7-123.
Levine, M.N. 1952. Studies on Dwarf Leaf Rust of Barley. Technical Bulletin, U. S.
Dept. of Agriculture. 1056, 1-16.
Li , Z.K., L.J. Luo, H.W. Mei, A.H. Paterson, X.H. Zhao, D.B. Zhong, Y.P. Wang, X.Q.
Yu, L. Zhu, R. Tabien, J.W. Stansel, C.S. Ying. 1999. A "defeated" rice
resistance gene acts as a QTL against a virulent strain of Xanthomonas oryzae pv.
oryzae. Molecular and general genetics 26 1:58-63.
Lindhout P. 2002. The perspectives of polygenic resistance in breeding for durable
disease resistance. Euphytica 124:217-226.
Line, R.F. 2002. Stripe rust of wheat and barley in North America: a retrospective
historical review. Annu. Rev. Phytopathol. 40:75-118.
Line, R.F., and X.M. Chen. 1995. Success in breeding for and managing durable
resistance to wheat rusts. Plant Dis. 79:1254-1255.
Liu, Z.W., R.M. Biyashev and M.A. Saghai Maroof. 1996. Development of simple
sequence repeat DNA markers and their integration into a barley linkage map.
Theoretical and Applied Genetics 93: 869-876.
Mains, E.B., and H.S. Jackson. 1926. Physiologic specialization in the leaf rust of wheat,
Puccinia triticina Erikss. Phytopathology 16:89-119.
Mammadov, J.A., J.C. Zwonitzer, R.M. Biyasher, C.A. Griffey, Y. Jin, B.J. Steffenson
and M. Saghai Maroof. 2003. Molecular mapping of Rph5, a gene conferring
resistance to barley leaf rust (Puccinia hordei Otth). Crop Sci. 43:388-393.
Manisterki, J., L. Treeful, J.R. Tomerlin, Y. Anikster, J.G. Moseman, I. Wahl, and R.D.
Wilcoxon. 1986. Resistance of wild barley accessions from Israel to leaf rust
collected in the USA and Israel. Crop Sci. 26:727-730.
Mano Y, B.E. Sayed-Tabatabaei, A. Graner, T. Blake, F. Takaiwa, S. Oka and T.
Komatsuda. 1999. STS marker-based map construction in Japanese barley
(Hordeum vulgare L.). Theoretical and Applied Genetic 98: 93 7-946.
70
Marshall, D. and R.L. Sutton 1995. Epidemiology of stripe rust, virulence of Puccinia
striformis f. sp. hordei, and yield loss in barley. Plant Disease 70:732-737
Mathre, D.E. (Ed.). 1982. Compendium of barley diseases. American Phytopathological
Society.
Michelmore, W.E., I.P Mand and R.V. Kesseli. 1991 Identification of markers linked to
disease resistance genes by bulked segregant analysis: a rapid method to detect
markers in specific genomic regions by using segregating populations. Proc. Nat!.
Acad. Sci. USA 98:9828-9832.
Moseman, J.G. and C.W. Roane. 1959. Physiological races of barley leaf rust (Puccinia
hordei) isolated in the United States from 1956 through 1958. Plant Disease
Reporter Vol. 43, No. 9, 1000-1003.
Moseman, J.G. and L.W. Greeley. 1965. New pathogenic strains of Puccinia hordei
among physiologic races identified in United States from 1959 through 1964.
Plant Disease Reporter Vol. 49, No. 7, 575-578.
Moseman, J.G., 1972 Isogenic barley lines for reaction to Erysiphe graminis f. sp. hordei.
Crop Science 12: 68 1-682.
Moseman, J.G., E. Nevo, and M.A. EL-Morshidy. 1990. Reactions of Hordeum
spontaneum to infection with two cultures of Puccinia hordei from Israel and
United State. Euphytica 49:169-175.
Narayanan, N.N., Niranjan-Baisakh, N.P. Oliva, C.M. VeraCruz, S.S. Gnanamanickam,
Karabi-Datta and S.K. Datta. 2004. Molecular breeding: marker assisted selection
combined with biolistic transformation for blast and bacterial blight resistance in
Indica rice (cv. C039). Molecular Breeding 14(1)61-71.
Nevo, E. 1992. Origin, Evolution, Population Genetics and Resources for Breeding of
Wild Barley, Hordeum spontaneum, in the Fertile Crescent. In Shewry, P.R. (ed.)
Barley: Genetics, biochemistry, molecular biology and biotechnology, p. 19-43,
CAB International, Oxford.
Niks, R.E. 1982. Early abortion of colonies of leaf rust, Puccinia hordei, in partial
resistant seedlings. Can. J. Bot. 60:714-723.
Nover, I. and F. Scholz. 1969. Genetic studies on the resistance of barley to yellow rust
(Puccinia striformis West.). Theoretical and Applied Genetic 39:150-155.
Osman-Ghani, N. and J.G. Manners. 1985. Components of partial resistance to Puccinia
striiformis in barley. Plant Pathology 34(1):75-82.
71
Park, R.F. and A. Karakousis. 2002. Characterization and mapping of gene Rphl9
conferring resistance to Puccinia hordel in the cultivar Reka 1 and several
Australian barleys. Plant breeding 12 1:232-236.
Park, R.F., D. Poulsen, A.R. Barr, M. Cakir, D.B. Moody, H. Raman and B.J. Read.
2003. Mapping genes for resistance to Puccinia hordeiin barley. Australian
Journal of Agriculture Research 54:1323-1333.
Parlevliet, J.E. 1975. Partial resistance of Barley to leaf rust, Puccinia hordei. I. Effect of
cultivar and development stage on latent period. Euphytica 24: 21-27.
Parlevliet, J.E. 1977. Evidence of Differential Interaction in the Polygenic Hordeum
Puccinia hordei Relation During Epidemic Development.
vulgare
Phytopathology 67: 776-778.
Parlevliet, J.E. 1978. Further evidence of polygenic inheritance of partial reistsnace in
barley to leaf rust, Puccinia hordei. Euphytica 27: 369-379.
Parlevliet J.E. and H.J. Kuiper. 1977. Partial resistance of barley to leaf rust, Puccinia
hordei. IV. Effect of cultivar and development stage on infection frequency.
Euphytica 26 : 249-255.
Parlevliet, J.E. and H.J. Kuiper 1985. Accumulating polygenes for partial resistance in
barley to barley leaf rust, Puccinia hordei. I. Selection for increased latent
periods. Euphytica 34: 7-13.
Parlevliet, J.E. 1988. Strategies for the utilization of partial resistance for the control of
cereal rusts. In N.W. Simmonds and S. Rajaram (eds.): Breeding strategies for
resistance to the rusts of wheat. 48-62. Mexico D.F. CIMMYT.
Parlevliet, J.E. 1997. Durable resistance. In Gustav Fischer (ed.). Resistance of crop
plants against fungi. pag 238-253. Jena. Stuttgart. Germany.
Peng J.Y., J.C. Glaszmann and S.S. Virmani. 1988. Heterosis and isozyme divergence in
indica rice. Crop Science 28:56 1-563.
Phoelman, J.M. and D.A. Sleper. 1995. Breeding field crops. Iowa State University Press,
Ames. 494 p.
Pickering R.A. and P. Devaux. 1992. Haploid production: approaches and use in plant
breeding. In: Barley: genetics, molecular biology and biotechnology, pp. 5 19-548.
Ed P Shewry. C A B International Oxford.
72
Pickering, R.A., A.M. Hill, M. Michel and G.M. Timmerman-Vaughan. 1995. The
transfer of a powdery mildew resistance gene from Hordeum bulbosum L. to
barley (H. vulgare) chromosome 2(21). Theor. Appi. Genet. 91:1288-1292.
Pickering, R.A., B.J. Steffenson, A.M. Hill and I. Borovkova. 1998. Association of leaf
rust and powdery mildew resistance in a recombinant derived from a Hordeum
vulgare x Hordeum bulbosum hybrid. Plant Breeding 117,83-84.
Qi, X., P. Stam and P. Lindhout. 1996. Comparison and integration of four barley genetic
maps. Genome 39:379-394
Qi, X., E.E. Nicks, P. Stam, and P. Lindhourt. 1998. Identification of QTLs for partial
resistance to leaf rust (Puccinia hordei) in barley. Theor. Appl. Genet. 96:120512135.
Qi, X., G. Jiang, W. Chen, R.E. Nicks, P. Stam, and P. Lindhourt. 1999. Isolate-specific
QTLs for partial resistance to Puccinia hordei in barley. Theor. Appi. Genet.
99:877-884.
Qi, X., F. Fufa, D. Sijtsma, R.E. Niks, P. Lindhout and P. Stam. 2000. The evidence for
abundance of QTLs for partial resistance to Puccinia hordei on the barley
genome. Molecular Breeding 6:1-9.
Ramsay, L., M. Macaulay, S. degli Ivanissevich, K. MacLean, L. Cardle, J. Fuller, K.J.
Edwards, S. Tuveson, M. Morgante, A. Massari, E. Maestri, N. Marmiroli, T.
Sjakste, M. Ganal, W. Powell and R. Waugh. 2000. A simple sequence repeatbased linkage map of barley. Genetics 156:1997-2005.
Reinhold, M. and E.L. Sharp. 1982. Virulence types of Puccinia hordei from North
America, North Africa, and the Middle East. Plant Disease 66:1009-1011.
Roane, C.W. 1962. Inheritance of reaction to Puccinia hordei in barley. I. Genes for
resistance among North America race differentiating varieties. Phytopathology
52:1288-1295.
Roane, C.W. 1976. BGSO7O, Resistance to Puccinia hordei Otth. (Barley leaf rust),
Rphla. BGN 6:120.
Roane, C.W. and T.M. Starling. 1967. Inheritance of reaction to Puccinia hordei in
barley. II Gene symbols for loci in differential cultivars. Phytopathology 57,6668.
73
Roane, C.W. and T.M. Starling. 1970. Inheritance of Reaction to Puccinia hordei in
Barley. III. Genes in the Cultivar Cebada Capa and Franger. Phytopathology 60:
788-790.
Roelfs A.P., B.J. Steffenson, R. Dill-Macky, D.L. Long and M.E. Hughes ME. 1993.
Barley rust in the United States in 1993. Barley News!. 37:56-63
Roelfs, A.P.and J. Huerta-Espino. 1994. Seedling resistance in Hordeum to barley stripe
rust from Texas. Plant Disease 78 (1 1):1046-1049.
Roelfs, A.P. and M.E. Hughes. 2000. Catalog of Rust Resistance Genes in Small Grains.
Publication No. CDL-EP#005 at http://www.cdl.umn.edu (date accessed).
Sandoval-Islas, J.S., L.H.M. Broers, H. Vivar and K.S. Osada. 1998. Evaluation of
quantitative resistance to yellow rust (Puccinia striformis f. sp. hordei) in the
ICARDA/CIMMYT barley breeding programme. Plant Breeding 117, 127-130.
Sato, K., N. Nankaku, Y. Motoi and K. Takeda. 2004. Large scale mapping of ESTs on
barley genome. In: Spunar J. and Janikova J. (eds), Proc. 9th International Barley
Genetics Symposium, Vol.!, Brno, Czech Republic, pp. 79-85.
Sayed, H., G. Backes, H. Kayyal, A. Yahyaoui, S. Ceccarelli, S. Grando, A. Jahoor, and
M. Baum. 2004. New molecular markers linked to qualitative and quantitative
powdery mildew and scald resistance genes in barley for dry areas. Euphytica
135: 225-228.
Schön C.C., H.P. Utz, S. Groh, B. Truberg, S. Openshaw and A.E. Melchinger. 2004.
Quantitative trait locus mapping based on resampling in a vast maize testcross
experiment and its relevance to quantitative genetics for complex traits. Genetics
167:485-498.
Schonfeld M., A. Ragni, Fischbeck G. and Jahoor A. 1996. RFLP mapping of three new
loci for resistance genes to powdery mildew (Erysiphe graminis f. sp. hordei) in
barley. Theoretical and Applied Genetic 93: 48-5 6
Schumann, G.L. 1991. Plant diseases. Their Biology and Social Impact. American
Phytopathological Society, St. Paul, Minnesota
Singh, R.P. 1992. Association between gene Lr34 for leaf rust resistance and leaf tip
necrosis in wheat. Crop Science 32:874-878.
Spaner, D., L.P. Shugar, T.M. Choo, I. Falak, K.G. Briggs, W.G. Legge, D.E. Falk, S.E.
Ullrich, N.A. Tinker, B.J. Steffenson, and D.E. Mather. 1998. Mapping of disease
74
resistance loci in barley on the basis of visual assessment of naturally occurring
symptoms. Crop Sci. 3 8:843-850.
Stakman, E.C. 1914. A study in cereal rusts: Physiological races. Minn Agric Exp Stn
Bull 138.
Stakman, E.C., F.J. Piemeisel. and M.N. Levine. 1918. Plasticity of biologic forms on
Pucciniagraminis. J Agric Res 15:221-250.
Statler, G.D. and J.E. Parlevliet 1987. Factors Related to Partial Resistance of Barley to
Leaf Rust. Phytopathology 77: 549-55 1.
Steffenson, B.J., Y. Jin and C.A. Griffey. 1993. Pathotypes of Puccinia hordei with
virulence for the barley leaf rust resistance gene Rph7 in the United States. Plant
Dis. 77:867-869.
Tan, B.H. 1978. Verifying the genetic relationships between three leaf rust resistance
genes in barley. Euphytica 27, 3 17-323.
Tanksley, S.D., S. Grandillo, M.T. Fulton, D. Zamir, Y. Eshed, V. Petiard, J. Lopez and
T. Beck-Bunn. 1996. Advanced backcross QTL analysis in a cross between an
elite processing line of tomato and its wild relative L. pimpinellfolium.
Theoretical and Applied Genetic 92: 935-95 1.
Thiel, T., W. Michalek, R.K. Varshney and A. Graner. 2003. Exploiting EST database for
the development and characterization of gene-derived SSR-markers in barley
(Hordeum vulgare L.) Theoretical and applied genetics 106:411-422.
Thomas, W.T.B., W. Powell, R. Waugh, K. J. Chalmers, U.M. Barua, P. Jack, V. Lea, B.
P. Forster, J.S. Swanston, R.P. Ellis, P.R. Hanson, and R.C.M. Lance.
1995.
Detection of quantitative trait loci for agronomic, yield, grain and disease
characters in spring barley (Hordeum vulgare L.). Theor. AppI. Genet. 91:10371047.
Toojinda, T., E. Baird, A. Booth, L. Broers, P. Hayes, W. Powell, W. Thomas, H. Vivar
and G. Young. 1998. Introgression of quantitative trait loci (QTLs) determining
stripe rust resistance in barley: an example of marker-assisted line development.
Theor. AppI. Genet. 96: 123-13 1.
Toojinda, T., E. Baird, L. Broers, X.M. Chen, P.M. Hayes, A. Kleinhofs, J. Korte, D.
Kudrna, H. Leung, R.F. Line, W. Powell, and H. Vivar. 2000. Mapping
quantitative and qualitative disease resistance genes in a doubled haploid
population of barley. Theor. Appl. Genet. 101:580-589.
75
Torp J, H.P. Jensen and J.H. Jørgensen. 1978. Powdery mildew resistance genes in 106
Northwest European spring barley varieties. Royal Veterinary and Agricultural
Univeristy Yearbook, Copenhagen, 75-102.
Vales, M.I, C.C. Schon, F. Capettini, X.M. Chen, A.E. Corey, D.E. Mather, C.C. Mundt,
K.L. Richardson, J.S. Sandoval-Islas, H.F. Utz and P.M. Hayes. 2005. Effect of
population size on the estimation of QTL: A test using resistance to barley stripe
rust. Theoretical and Applied Genetic (in press)
Vanderplank, J.E. 1963. Plant diseases: epidemics and control. Academic Press, New
York/London, 349 pp.
Vanderplank, J.E. 1968. Disease resistance in plants. Academic Pres, New York/London,
206 p.
van Ooijen, J.W. and R.E. Voorrips. 2001. JoinMap 3.0 software for the calculation of
genetic linkage maps. Biometris, Wageningen Univ., Plant Res. mt., the
Netherlands.
von Zitzewitz, J., J.S. Skinner, P. Szucs, T. H. Chen, P.M. Hayes, J. Dubcovsky and L.
Yan. 2005. Structural and functional characterization of candidate vernalization
genes in barley.
Wang S., C.J. Basten, and Z.-B. Zeng. 2005. Windows QTL Cartographer 2.5.
Department of Statistics, North Carolina State University, Raleigh, NC.
(http://statgen.ncsu.edu/gticart/WOTLCart.htm)
Walker, D.R., J.M. Narvel, H.R. Boerma, J.N. All and W.A. Parrott. 2004. A QTL that
enhance and broadens Bt insect resistance in soybean. Theoretical and Applied
Genetics 109(5):1051-1057.
Watson, l.A. and F.C. Butler. 1947. Resistance to barley leaf rust (Puccinia anomala
Rostr.). Linnean Soc. New South Wales, Proc. 72:379-386.
Wei, F., K. Gobelman-Werner, S. Morroll, J. Long, L. Mao, R. Wing, D. Leister, P.
Schulze-Lefert and R. Wise. 1999. The Mla (Powdery Mildew) Resistance
Cluster Is Associated with Three Nbs Lrr Gene Families and Suppressed
Recombination Within a 240-Kb DNA Interval on Chromosome 5s (lhs) of
Barley. Genetics 153:1929-1948.
Wettstein-Knowles, von P. 1992. Cloned and mapped genes: Current status. In Shewry,
P.R. (ed.) Barley: Genetics, biochemistry, molecular biology and biotechnology,
p. 73-98, CAB International, Oxford.
76
Wilcoxon, R.D,, A.H. Atif and B. Skovmand. 1974. Slow rusting of wheat varieties in the
field correlated with stem rust severity on detached leaves in the greenhouse.
Plant Dis. Rep. 58:1085-1087.
Williams, K.J. 2003. The molecular genetics of diseases resistance in barley. Australian
Journal of Agriculture Research 54:1065-1079.
Wisser R.J., Q. Sun, S.H. Hulbert, S. Kresovich and R.J. Nelson. 2005. Identification and
Characterization of Regions of the Rice Genome Associated with BroadSpectrum, Quantitative Disease Resistance. Genome 169:2277-2293.
Yahyaoui, A.H. and E.L. Sharp. 1987. Virulence Spectrum of Puccinia hordei in North
Africa and the Middle East. Plant Disease 71:597-598.
Yan L, V. Echenique, C. Busso, P. SanMiguel, W. Ramakrishna, J.L. Bennetzen, S.
Harrington and J. Dubcovsky. 2002 Cereal genes similar to Snf2 define a new
subfamily that includes human and mouse genes. Molecular Genetics and
Genomics 268: 488-499.
Yahyaoui, A.H., E.L. Sharp and M. Reinhold. 1988. New sources of resistance to
Puccinia hordei in barley landrace cultivars. Phytopathology 78, 905-908.
Yi, G., S.K. Lee, Y.K. Hong, Y.C. Cho, M.H. Nam, S.C. Kim, S.S. Han, G.L. Wang,
T.R. Hahn, P.C. Ronald and J.S. Jeon. 2004. Use of Pi5(t) markers in markerassisted selection to screen for cultivars with resistance to Magnaporthe grisea.
Theoretical and Applied Genetics 109(5):978-985.
Young, N.D. 1996. QTL mapping and quantitative disease resistance in plants. Ann. Rev.
Phytopathology 34:479-501.
Zeng,
Z.B. 1994.
Precision mapping of quantitative trait loci.
1994.
Genetics
136:1457-
1468
Zhong, S., R.J. Effertz, Y. Jin, D. Franckowiak and B.J. Steffenson. 2003. Molecular
mapping of the leaf rust resistance gene Rph6 in barley and its linkage
relationship with Rph5 and Rph7. Phytopathology 93:604-609.
Zhou, F.S., J.C. Kurth, F.S. Wei, C. Elliot, G. Vale, N. Yahaiaoui, B. Keller, S.
Somerville, R. Wise and P. Schuze-Lefert. 2001. Cell-autonomous expression of
barley Mia 1 confers race-specific resistance to the powdery mildew fungus via
Rar 1-independent signaling pathway. Plant Cell 13:337-350.
77
Appendix
78
Table Al. Barley stripe rust severity for 23 accessions evaluated in Toluca Valley,
Mexico 2000, Huancayo, Peru 2000 and 2004.
Accession
Harrington
Galena
Baronesse
Calicuchima-sib
Shyri
Chromosome
position of BSR
resistance QTL
(1)
None
None
2H, 5H, 7H (2)
4H, 5H, 6H, 7H
1H,2H,3H,6H
MEXICO 2000
PERU 2000
PERU 2004
77
86
40
72,5
95
50
76
84
70
20
60
20
0
0
0
0
60
20
(2)
(3)
(4)
C110587
7H
D1-72
1H
15
20
7.5
D3-6
Urea
7H
4H, 5H
0.1
NA
7.5
17
72
18.8
19
43
20
BCD47
BCD12
3H(2), 4H, SH,
IH
30
60
25
D3-6/B-23
D3-6/B-61
7H
7H
111, 7H
7.5
30
15
5.8
70
15
0.1
0
5
IH, 7H
IH, 7H
4H, 5H, 7H
0.4
0.1
10
0.4
0
10
8.4
20
25
411, 5H, 7H
1.7
0
7.5
4H, 5H, 7H
4H, SH, 7H
3.4
10
12.5
0.1
0
7.5
411,511, 7H
0.1
0.1
0
0
0
2.5
0
0.1
5
UPS 19
UPS 66
UPS 78
AJU 44
AJO 59
BU 16
BU 27
BU37
BU 38
BU45
4H, 5H, 7H
4H,5H,7H
(1) Largest effect QTL are shown in bold and putative major gene in bold-italic.
(2) Toluca Valley, Mexico (ICARDA/CIMMYT)
(3) Huancayo, Peru (USDA Barley Stripe Rust Screening Nursery)
(4) Huancayo, Peru (Universidad Nacional Agraria La Molina)
79
Table 2A. Primer sequences for expressed sequence tag (EST)-based marker loci;
sequence tagged site (STS) from GrainGenes and TIGR, in the ORO (BCD47 x
Baronesse) population, listed in linkage map order.
Locus
Chrom
*k0443 5
1 H
*k035 12
IH
*k08433
1 H
*k08302
1 H
*k0625 7
1 H
*k0426 1
1 H
Forward primer
TTTCCGGGATAAGAGTGTGC
CATCCCGACAGAAGCAAAAT
TACTGGTCTTGGATGCGACA
Reverse primer
CGACTCGGTTGTTTGCTACA
TACCTACCAGTGACCCCTGC
*k03 878
1 H
*k00688
*k04489
3H
3H
3H
3H
4H
4H
AACATGCATGGTGACAAGGA
TAGCCTGGCAGCTTTCTGTT
GTGGGCATGAAGAACGCTAC
AGGCACAGGCTCTTTTGCTA
ACACGGTCCATGGAAGAAAC
AACGTAACAACCGAACGCAT
CTTTGCATGGCTGATGAAGA
GCGCCAAATCTGATAGCACT
CATTGATTGACACCACCAGC
CATCCATCAACGTCCTCCTC
AGGTGCTAGACGGTTTCCCT
AAGGGCTTCGTCAATGTTTG
CTACTTCCCCCGTTTCGAC
CGAAGTGGTTCCATGGAGTT
GAGCCTTGCTACTGAATGGG
CATAGATGGGCCCTTGAAGA
ATCACGACTGCTCCAATTCC
CAATCTGATGGGGAGCACTT
baal29j 18
4H
TGTTGATGAATCGCTCTTGC
CACAACAACCACTACGACGG
ABG54
4H
4H
7H
GTGCTTGGCGGTCGACCAGT
AGGCACACAAGCAACAACAG
TTTCGGTTTCTTGGAAATGG
GATGTCCAACGGTGGCTTGA
GTTGTGAGCCATCGTGAAGA
AGCTGCTGGAAGGTGAACTC
*k07339
*k00088
*k02892
*k033 52
*k07229
TC493a
GAACGACAAAGATGATGGCA
GGCACACATTTACCAAGTGC
GGGAATTTTCTCCGTTTGGT