VNTI Demonstration –
VNTI consist of different modules.
VNTI Explorer
The Explorer has different databases for different types of molecules:
(drag menu bottom left UP if it does not appear as below)
DNA
We will Empty the database together
Oligo (primers)
We will Empty the database together
Then we will Make Subsets (subfolders) (in both DNA and Oligo databases)
How to create and import DNA molecules and Oligo molecules
We will import the DNA sequence encoding NM_006020.2 from NCBI (or any text file) by copy
paste.
We will create the Oligo “AlkB_L170A”:
5´- CCGCTCAAACGTTTGCTAGCGGAACATGGCGATGTG -3´
Vector NTI
Open AlkB in Vector NTI window
“Display Setup”:
Click the display setup button (USAGE: Locate motifs/ primers and restriction sites)
Motifs: Find primers. Locate the oligo Oligo AlkB_L170A
Restriction MAP: Locate rest. enzymes. Demo NheI and
ORF´s: Locate open reading frames.
The “Add Feature BUTTON”:
Lets you annotate a part of a sequence. Annotate L170A. Annotate right and left.
The “View molecule fragment BUTTON”:
Zoom function. Select area and zoom in and out.
(Notice what happened with the restriction sites)
The “Translate BUTTONS”:
Translate forward and reverse Buttons. Erase Button.
Reverse a sequence:
File MENU - Molecule operations – Advanced – Reverse selection
Note that annotations will be lost
Edit MENU:
Delete sequence: Edit Delete sequence. Mark and delete.
Paste (insert) sequence. Edit Paste sequence. Place cursor and insert.