0013-7227/08/$15.00/0
Printed in U.S.A.
Endocrinology 149(3):1091–1102
Copyright © 2008 by The Endocrine Society
doi: 10.1210/en.2007-1498
Synergistic Induction of Follicle-Stimulating Hormone
␤-Subunit Gene Expression by Gonadal Steroid Hormone
Receptors and Smad Proteins
Varykina G. Thackray and Pamela L. Mellon
Departments of Reproductive Medicine and Neurosciences and the Center for Reproductive Science and Medicine,
University of California, San Diego (UCSD), La Jolla, California 92093
LH and FSH play crucial roles in mammalian reproduction by
mediating steroidogenesis and gametogenesis. Gonadal steroid hormones influence gonadotropin production via feedback to the hypothalamus and pituitary. We previously demonstrated that progesterone and testosterone can stimulate
expression of the FSH ␤-subunit gene in immortalized gonadotrope-derived L␤T2 cells. Herein, we investigate how these
gonadal steroids modulate activin signaling in the gonadotrope. Cotreatment of L␤T2 cells or mouse primary pituitary
cells with steroids and activin results in a synergistic induction of FSH␤ gene expression. This synergy decreases when
DNA-binding mutations are introduced into the steroid receptors or when mutations that reduce steroid hormone responsiveness are introduced into the FSH␤ promoter, indicating that synergy requires direct DNA binding of the steroid
receptors. Furthermore, classical activin signaling via Smad
proteins is necessary for this synergy. In addition, these steroid receptors physically interact with Smads and are sufficient for the synergism to occur on the FSH␤ promoter. Disruption of Smad binding to the promoter with a Smad protein
lacking the DNA-binding domain or an FSH␤ promoter containing mutated activin-response elements prevents the synergistic enhancement of FSH␤ transcription. Collectively, our
data demonstrate that the molecular mechanism for gonadal
steroid hormone action on the FSH␤ promoter involves crosstalk between the steroid and activin signaling pathways. They
also reveal that this synergism requires binding of both the
steroid receptors and Smad proteins to their cognate DNAbinding elements and likely involves a direct protein-protein
interaction between the two types of transcription factors.
(Endocrinology 149: 1091–1102, 2008)
M
contribute to the regulation of LH␤ and FSH␤ gene
expression.
Both steroid and peptide hormones have been shown to
modulate LH␤ and FSH␤ gene expression. For example, the
hypothalamic neuropeptide GnRH mediates the synthesis of
both gonadotropin ␤-subunits in addition to its well-characterized role in secretion (7). The induction of FSH␤ and
LH␤ gene expression by activin has also been well characterized (8 –13). Moreover, steroid hormones have been
shown to modulate the transcription of LH␤ and FSH␤ subunit genes at the level of the pituitary (reviewed by Burger
et al. in Ref. 14). Recently, we demonstrated that two gonadal
steroid hormones, progesterone and testosterone, can differentially modulate LH␤ and FSH␤ gene expression in immortalized pituitary gonadotrope cells and, therefore, potentially play a role in differential regulation of LH and FSH
(15). Because activin is a potent activator of FSH␤ and its
levels remain relatively uniform during the reproductive
cycle, we focused on whether gonadal steroid hormones
modulate activin signaling in the pituitary gonadotrope. Our
previous study supports the hypothesis that progesterone
and testosterone act to increase FSH␤ gene expression directly at the level of the gonadotrope through the classical
steroid receptor signaling pathway. However, other studies
suggest that gonadal steroid hormones may also regulate
FSH␤ indirectly through modulation of components of the
activin signaling pathway. Activin signaling may be modulated by gonadal steroid hormones via altering the bioavailability of activin or the intracellular signaling pathways.
AMMALIAN REPRODUCTION DEPENDS upon a
complex orchestration of hormonal regulation in the
hypothalamic-pituitary-gonadal axis. The gonadotrope cell
in the anterior pituitary acts as a central integrator of steroid
and peptide hormone signaling in this axis. Signaling events
in the gonadotrope culminate in the synthesis and secretion
of two hormones: LH and FSH. These hormones are secreted
into the bloodstream where they bind to receptors on the
female ovary and male testes and play essential roles in
ovulation, steroidogenesis, and gametogenesis (1–3).
LH and FSH are heterodimeric glycoproteins composed of
an ␣-subunit shared by both hormones as well as a unique
␤-subunit that confers the biological specificity of LH and
FSH (4). Synthesis of the LH and FSH ␤-subunits appears to
be the rate-limiting step for production of FSH and LH (5, 6).
Understanding the mechanisms by which steroid and peptide hormones regulate the transcription of LH␤ and FSH␤
is critical for comprehending the process of LH and FSH
production. Although much is known about the responsiveness of the gonadotropin genes to individual hormones, it is
still unclear how interactions among these various hormones
First Published Online December 13, 2007
Abbreviations: AR, Androgen receptor; DBD, DNA-binding domain;
DHT, dihydrotestosterone; GFP, green fluorescent protein; GST, glutathione-S-transferase; HRE, hormone response element; MMTV, mouse
mammary tumor virus; PR, progesterone receptor; SBE, Smad-binding
element.
Endocrinology is published monthly by The Endocrine Society (http://
www.endo-society.org), the foremost professional society serving the
endocrine community.
1091
1092
Endocrinology, March 2008, 149(3):1091–1102
Follistatin is a glycoprotein expressed in both gonadotropes
and pituitary folliculostellate cells that binds and inactivates
activin (16). Testosterone has been shown to suppress follistatin mRNA and primary transcripts in rat primary cell
cultures (17, 18). Smad mRNA and Smad phosphorylation
have also been reported to change after testosterone treatment in rat primary cells (19). Furthermore, cotreatment of
rat primary cells with testosterone and activin enhances
FSH␤ gene expression levels beyond those observed with
activin alone (20), and its action can be blunted by follistatin
(21, 22).
Development of the L␤T2 cells provided the opportunity
to analyze the mechanisms of steroid and peptide hormonal
regulation of the gonadotropin genes in the context of a pure
population of gonadotrope cells (23). Because the gonadotrope cell is exposed to multiple hormonal signals at the same
time, there is a high potential for cooperation or synergy
among these hormones. The immortalized L␤T2 cell line is
an excellent model system in which to study gonadotropin
gene expression because it expresses many markers of a
mature gonadotrope including FSH␤, LH␤, GnRH receptor,
activin, activin receptor, follistatin, and inhibin (24 –27). This
cell model became even more useful when it became apparent that folliculostellate cells producing follistatin rapidly
overgrow primary pituitary cell cultures (28), thus complicating the interpretation of experiments performed in vitro.
In this study, we investigated the potential for cross-talk
between gonadal steroid and activin signaling in gonadotrope cells. Specifically, we used L␤T2 and mouse primary
pituitary cells to determine whether progesterone, as well as
testosterone, can synergize with activin to mediate expression of the FSH␤ gene. We used transient transfection experiments with a murine FSH␤-luciferase reporter gene to
characterize the responsiveness of the proximal promoter to
the combined action of gonadal steroids and activin. In addition, we determined whether the synergy between steroids
and activin occurred through classical Smad-dependent signaling. Glutathione-S-transferase (GST) interaction assays
were used to determine whether progesterone receptor (PR)
and androgen receptor (AR) could partner with Smad proteins. And finally, we investigated whether DNA binding of
the steroid receptors and/or Smad proteins to the FSH␤
promoter was required for the synergy.
Thackray and Mellon • PR and AR Synergize with Smads
and pSG5-rARC562G were provided by Jorma Palvimo (31). Benita
Katzenellenbogen donated the pCMV5-rPRB plasmid, and Dean Edwards provided the pcDNA-I-mPRB and pcDNA-I-mPRA plasmids. Rik
Derynck kindly provided the pRK5-Smad3 and PRK5-Smad7 plasmids.
Mutagenesis
Generation of the mutated ⫺381 hormone response element (HRE) in
FSH␤ and the PRC577A mutant unable to bind DNA were described
previously (15). We used the QuikChange Site-Directed Mutagenesis Kit
(Stratagene, La Jolla, CA) to generate mutations in three Smad-binding
elements (SBE) in the proximal FSH␤ promoter. The first round of
mutagenesis was performed using the ⫺1000FSH␤luc plasmid and the
appropriate oligonucleotides according to the manufacturer’s protocol:
⫺267SBEmut (5⬘-AGATCAGAAAGAATAGTAGCTACTCTAGAGTCACA
TTTAATTTAC-3⬘). Then a second round used the plasmid with the mutated
⫺267 SBE and the appropriate oligos: 153&120SBEmut (5⬘-TGGCATTT
CTACTGCTTTGGCGAGGCTTGATCTCCCTGTCCGTAGAAACAATG-3⬘)
to generate the 3xSBE mutation (the mutated residues are underlined). We
confirmed the sequences of all promoter fragments through dideoxynucleotide
sequencing performed by the DNA Sequencing Shared Resource, UCSD Cancer Center.
Cell culture and transient transfection
Cell culture and transient transfection experiments were performed
with the L␤T2 cell line (24). L␤T2 cells were maintained in 10-cmdiameter dishes in DMEM (Cellgro; Mediatech., Herndon, VA) supplemented with 10% fetal bovine serum (Omega Scientific, Inc., Tarzana,
CA) at 37 C with 5% CO2. One day before transfection, 3 ⫻ 105 cells were
plated per well into 12-well plates. Transient transfection was performed
using Fugene 6 reagent (Roche Molecular Biochemicals, Indianapolis,
IN) following the manufacturer’s instructions. Each well was transfected
with 0.4 ␮g reporter plasmid. Additionally, the cells were transfected
with 0.2 ␮g steroid receptor. As an internal control for transfection
efficiency, we cotransfected the L␤T2 cells with a reporter plasmid
containing ␤-galactosidase driven by the Rous sarcoma virus promoter
(RSV-␤-gal). The cells were switched to serum-free DMEM 6 h after
transfection to eliminate the influence of activin, growth factors, and
steroids in the serum. The following day, the cells were treated with
ethanol (vehicle control) or hormone for 24 h.
Luciferase and ␤-galactosidase activity assays
The cells were washed once with 1⫻ PBS and then lysed with 0.1 m
K-phosphate buffer (pH 7.8) containing 0.2% Triton X-100. After lysing
the cells, we assayed the luciferase activity using a buffer containing 100
mm Tris-HCl (pH 7.8), 15 mm MgSO4, 10 mm ATP, and 65 ␮m luciferin.
␤-Galactosidase activity was measured using the Galacto-light assay
(Tropix, Bedford, MA) according to the manufacturer’s protocol. Both
luciferase and ␤-galactosidase activity were measured using an EG&G
Berthold Microplate Luminometer (PerkinElmer Corp., Norwalk, CT).
Mouse primary pituitary cell culture
Materials and Methods
Reagents
Promegestone (R5020) and methyltrienolone (R1881) were purchased
from NEN Life Science Products Life Sciences (Boston, MA). Progesterone and dihydrotestosterone (DHT) were purchased from Sigma
Chemical Co. (St. Louis, MO), whereas activin and follistatin were obtained from R&D Systems (Minneapolis, MN). The inhibitors SB-202190
and SB-431541 were obtained from Sigma.
Plasmids
Construction of the ⫺1000FSH␤luc plasmid was described previously (15, 29). The GRAS-tk-luc plasmid was also previously described
(22). It is a luciferase reporter gene linked to four repeats of the GRAS
element (⫺340 to ⫺315) from the mouse GnRH receptor gene (30) upstream of a minimal ⫺81 herpes simplex virus thymidine kinase promoter. The pGL3 MMTV plasmid was provided by Jeff Miner of Ligand
Pharmaceuticals. The steroid receptor expression plasmids pSG5-rAR
Eight-week-old, male C57 Black 6 mice, purchased from Harlan
Sprague Dawley, Inc. (Indianapolis, IN), were killed, and the pituitaries
were collected in ice-cold Dulbecco’s A PBS. After rinsing in PBS, the
pituitaries were placed in Hanks’ balanced salt solution with 25 mm
HEPES (pH 7.2) containing 0.25% collagenase and 0.25% trypsin. After
cell dispersion for 30 min at 37 C in a shaker water bath, the same volume
of DMEM with 10% fetal bovine serum was added to stop the reaction,
and DNase was added to a final concentration of 20 ␮g/ml and incubated for another 15 min at 37 C. After removal of tissue debris, the cells
were pelleted by centrifugation and plated at 106 cells/2-cm2 well density. The media was changed to serum-free DMEM with 0.1% BSA 16 h
before treatment. Cells were treated with the relevant hormones for 24 h,
after which the cells were lysed to obtain total RNA. These studies were
approved by the UCSD Institutional Animal Care and Use Committee.
Quantitative real-time PCR
RNA was obtained with Trizol reagent (Invitrogen, Carlsbad, CA)
according to the manufacturer’s instructions. Contaminating DNA was
Thackray and Mellon • PR and AR Synergize with Smads
removed with DNA-free reagent (Ambion, Austin, TX), and 2 ␮g RNA
was reverse transcribed using Superscript III First-Strand Synthesis System (Invitrogen). Quantitative real-time PCR was performed using an
iCycler from Bio-Rad (Hercules, CA), using QuantiTect SYBR Green
PCR Kit (QIAGEN, Valencia, CA) and the following primers: FSH forward, GCCGTTTCTGCATAAGC; FSH reverse, CAATCTTACGGTCTCGTATACC; GAPDH forward, TGCACCACCAACTGCTTAG;
GAPDH reverse, GGATGCAGGGATGATGTTC. The PCR was performed under the following conditions: 95 C for 15 min followed by 40
cycles at 95 C for 15 sec, 54 C for 30 sec, and 72 C for 30 sec. For FSH␤
measurements, the equivalent of 50 ng starting RNA (as quantified
before reverse transcription) was used in each reaction, whereas for
GAPDH, 10 ng was sufficient. Each sample was assayed in triplicate. A
standard curve with dilutions of 10 pg/well, 1 pg/well, 100 fg/well, and
10 fg/well of a plasmid containing FSH␤ or GAPDH cDNA was generated in each run with the samples. In each experiment, the amount of
FSH␤ was calculated by comparing the threshold cycle obtained for each
sample with the standard curve generated in the same run. After each
run, a melting-curve analysis was performed to confirm that a single
amplicon was generated in each reaction.
GST interaction assay
The GST-Smad2, -Smad3, and -Smad4 plasmids were kindly provided by Rik Derynck. The GFP expression plasmid was obtained from
Douglass Forbes (UCSD). 35S-labeled proteins were produced using the
TnT Coupled Reticulolysate System (Promega Corp., Madison, WI).
Bacteria transformed with the GST plasmids were grown to an OD of
0.6 and then induced with isopropyl-␤-d-thiogalactoside overnight at 30
C. The bacterial pellets were sonicated in 0.1% Triton X-100 and 5 mm
EDTA in 1⫻ PBS and centrifuged, and the supernatant was bound to
glutathione Sepharose 4B resin (Amersham Pharmacia Biotech, Piscataway, NJ). The beads were washed four times in PBS and then in HND
buffer [10 mg/ml BSA, 20 mm HEPES (pH 7.8), 50 mm NaCl, 5 mm
dithiothreitol, and 0.1% Nonidet P-40]. For the interaction assay, 40 ␮l
35
S-labeled in vitro-transcribed and -translated AR, PRB, or PRA was
added to the beads with 400 ␮l HND buffer, after which 5 ␮l GFP was
added to the beads. The beads were incubated overnight at 4 C and then
washed twice with HND buffer and twice with 0.1% Nonidet P-40 in
PBS. Thirty microliters of 2⫻ Laemmli load buffer were added, and the
samples were boiled and then electrophoresed on a 10% SDS-polyacrylamide gel. One tenth of the 35S-labeled in vitro-transcribed and -translated product was loaded onto the gel as input. The gel was dried, and
the proteins were visualized by autoradiography.
Statistical analyses
Transient transfections were performed in triplicate, and each experiment was repeated independently at least three times. We normalized
the data for transfection efficiency by expressing luciferase activity relative to ␤-galactosidase activity and relative to the empty pGL3 plasmid
to control for hormone effects on the vector DNA. The data were analyzed by one-way ANOVA, followed by post hoc comparisons with the
Tukey-Kramer honestly significant difference test or two-way ANOVA
(32) using the statistical package JMP 5.0 (SAS, Cary, NC). In the figures,
an asterisk indicates significant differences from the vehicle-treated control, whereas a dagger indicates a synergistic interaction as defined by
a two-way ANOVA (P ⬍ 0.05).
Results
Synergy between gonadal steroid hormones and activin
enhances FSH␤ gene expression in pituitary gonadotropes
The immortalized L␤T2 gonadotrope cell line was used to
test whether the gonadal steroid hormones, progesterone
and testosterone, cooperate with activin to alter FSH␤ gene
expression directly in the pituitary gonadotrope. Although
L␤T2 cells have been shown to express AR and PR (15, 27,
33), the levels appear to be low because the hormone response with the endogenous receptors is less than 2-fold.
Thus, to amplify the hormone response and allow us to
Endocrinology, March 2008, 149(3):1091–1102
1093
compare the effects of different receptor isoforms and receptor mutants, we transfected exogenous steroid receptors
into the cells. We demonstrated previously that a significant
hormone response could be detected on the FSH␤ promoter
with even a small amount of exogenous receptor added to the
cells and that the responsiveness continued to increase with
additional receptor (15). These results indicate that the responsiveness is not likely due to artificially high levels of
exogenous receptors because the receptor is limiting in the
cells.
Activin or progesterone treatment significantly induced
the ⫺1000FSH␤luc reporter gene (3- and 30-fold, respectively) in cells transfected with the rat PR (Fig. 1A). The
induction of FSH␤ gene expression was also greatly enhanced (110-fold) after the cells were treated with both
activin and progesterone (Fig. 1A). This positive interaction was determined to be synergistic using a two-way
ANOVA [see Slinker (32) for details on using a two-way
ANOVA to determine whether two factors are additive or
synergistic].
We recently demonstrated that androgens synergize with
activin on the ovine FSH␤ proximal promoter and that this
synergy was dependent upon an androgen response element
(⫺245ARE) and an activin response element (⫺138SBE) (22).
Thus, we were interested in determining whether a similar
effect occurred on the murine FSH␤ promoter, because not
all of the androgen- and activin-responsive regions are conserved between the murine and ovine promoters and because the L␤T2 cells are of murine origin. Activin or DHT
significantly induced FSH␤ gene expression 4- and 11-fold,
respectively (Fig. 1B). Synergy was observed after cotreatment of the cells with activin and DHT (22-fold induction),
indicating that both the ovine and murine FSH␤ promoters
respond similarly in this regard and that AR is necessary for
this cooperative effect.
A similar synergism on the FSH␤ promoter was also observed using synthetic analogs of progesterone and testosterone in concert with activin. Activin or the synthetic progestin
R5020 significantly induced FSH␤ gene expression 2- and 39fold, respectively (Fig. 1C). Synergy was also observed after
cotreatment of the cells with activin and R5020 (96-fold induction). Activin or the synthetic androgen R1881 induced FSH␤
gene expression 5- and 12-fold, respectively (Fig. 1D). Synergy
was observed after cotreatment of the cells with activin and
R1881 (21-fold induction).
We then determined whether the synergy between gonadal steroid hormones and activin could also be observed
in cultured pituitary cells. Treatment of mouse primary pituitary cells with activin resulted in a robust induction of
FSH␤ mRNA levels by approximately 8-fold (Fig. 1, E and F).
Although treatment of the cells with either R5020 or R1881
alone did not result in a significant induction over vehicle
control, cotreatment of the primary cells with activin and
R5020 synergistically stimulated FSH␤ mRNA levels (12fold). Similar to the findings of Leal et al. (20) with rat pituitary cells, we also observed a synergistic induction of FSH␤
by 14-fold in mouse primary pituitary cells after cotreatment
with activin and R1881.
1094
Endocrinology, March 2008, 149(3):1091–1102
Thackray and Mellon • PR and AR Synergize with Smads
FIG. 1. Progestins and androgens synergize with activin to
induce FSH␤ gene expression in immortalized gonadotrope and mouse primary pituitary cells. A–D, The
⫺1000FSH␤luc reporter plasmid was transiently transfected into L␤T2 cells along with 200 ng rat PR (A and C)
or AR (B and D). After overnight starvation in serum-free
media, the cells were treated for 24 h with vehicle (Veh), 10
ng/␮l activin (Act), 100 nM progesterone (P) (A), DHT (B),
R5020 (C), R1881 (D), or both activin and the relevant
steroid hormone, as indicated. Luciferase activity was normalized to ␤-galactosidase activity and set relative to the
empty reporter vector. Results represent the mean ⫾ SEM of
at least three independent experiments performed in triplicate and are presented as fold induction of hormone treatment relative to the vehicle control. E and F, Primary pituitary cells were dispersed from 8-wk-old male mice and
plated in culture. The cells were treated for 24 h with vehicle
(Veh), 10 ng/␮l activin (Act), 100 nM R5020 (E), R1881 (F),
or both activin and the relevant steroid hormone, as indicated. Total RNA was purified and reverse transcribed, and
the level of FSH␤ expression was assayed by real-time PCR.
In each sample, the amount of FSH␤, calculated from the
standard curve, was compared with the amount of GAPDH.
The results represent the mean ⫾ SEM of FSH␤ levels relative to GAPDH performed in triplicate. *, Significant differences from the vehicle-treated control; †, synergistic interaction as defined by a two-way ANOVA (P ⬍ 0.05).
Maximal synergy between progestins and activin requires
the full-length PRB isoform
Synergy between progestins or androgens and activin is
specific to FSH␤
Activin or the synthetic progestin R5020 significantly induced the ⫺1000FSH␤luc reporter gene (6- and 13-fold, respectively) in cells transfected with the full-length mouse
PRB isoform (Fig. 2A). The induction of FSH␤ gene expression was also greatly enhanced (94-fold) after the cells were
treated with both activin and R5020 (Fig. 2A). We then tested
whether the alternative isoform of PR, PRA, which lacks the
amino-terminal 164 amino acids of PRB, could also interact
with activin to modulate FSH␤ expression. Activin still induced FSH␤ gene expression 7-fold when the cells were
transfected with mouse PRA (Fig. 2B). In addition, progestins
significantly induced the ⫺1000FSH␤luc reporter 2-fold, although the hormonal response was 85% less than with PRB.
The combination of activin with R5020 also synergistically
induced FSH␤ by 16-fold. However, the hormonal response
was reduced by 83% compared with the synergistic response
with PRB. These results indicate that maximal progesterone
responsiveness on the FSH␤ promoter occurs in the context
of the full-length PRB isoform and in concert with activin.
Because the interaction between gonadal steroid hormones and activin has been proposed to be due to steroid
modulation of activin signaling inhibitors such as follistatin
and inhibin, we tested whether promoters known to exhibit
steroid hormone and/or activin responsiveness other than
FSH␤ exhibited a synergistic induction upon cotreatment
with activin and the relevant steroid hormone. Initially, we
determined whether synergy occurred on a luciferase reporter gene linked to an activin-responsive element derived
from the GnRH receptor promoter (the GRAS element) (30).
As indicated in Fig. 3, the GRAS-tk-luc reporter gene was
induced by activin, whereas there was no response to progestins or androgens on the GRAS promoter. In contrast to
the synergy obtained on the FSH␤ promoter (Fig. 1), there
was no increase in expression from the GRAS element after
cotreatment with activin and gonadal steroid hormones compared with activin treatment alone (Fig. 3, A and B). We then
tested whether synergy between steroid hormones and activin could be observed on a steroid hormone-responsive
Thackray and Mellon • PR and AR Synergize with Smads
Endocrinology, March 2008, 149(3):1091–1102
1095
Cross-talk between gonadal steroid hormones and activin
requires steroid receptor binding to HREs in the FSH␤
promoter
FIG. 2. Full-length PRB is required for maximal synergy between
progesterone and activin. The ⫺1000FSH␤luc reporter plasmid was
transiently transfected into L␤T2 cells along with 200 ng mouse PRB
(A) or PRA (B). After overnight starvation in serum-free media, the
cells were treated for 24 h with vehicle (Veh), 10 ng/␮l activin (Act),
100 nM R5020, or activin and R5020, as indicated. Results represent
the mean ⫾ SEM of at least three independent experiments performed
in triplicate and are presented as fold induction of hormone treatment
relative to the vehicle control. *, Significant differences from the
vehicle-treated control; †, synergistic interaction as defined by a twoway ANOVA (P ⬍ 0.05).
mouse mammary tumor virus promoter linked to a luciferase
reporter gene (MMTV-luc). Treatment of the L␤T2 cells with
activin did not lead to an induction of the MMTV promoter,
whereas treatment with R5020 or R1881 resulted in a 4.5- and
6.5-fold induction, respectively (Fig. 3, C and D). There was
no detectable synergistic induction on the MMTV promoter
after treatment with both activin and R5020; cotreatment
with activin and R1881 actually resulted in a decrease in
transcription compared with R1881 alone. Finally, we determined whether synergy could be observed on a luciferase
reporter linked to 1.8 kb of the rat LH␤ promoter. Unlike the
previous two promoters, the LH␤ promoter has been shown
to be responsive to both activin and steroid hormones (13, 15,
34). Similar to our previous report, activin induced expression of the LH␤ promoter approximately 2-fold (Fig. 3, E and
F). No synergy was observed on the LH␤ promoter after
cotreatment with activin and either R5020 or R1881. Instead,
progestins decreased LH␤ gene expression both alone and in
combination with activin. Similar to the findings of Curtin et
al. (34), we also observed a decrease of LH␤ expression with
androgen treatment, although it was less striking than the
repressive effect we observed with progesterone. These experiments indicate that the synergy seen on the FSH␤ promoter after cotreatment of activin and steroid hormones is
not due to a global change in steroid hormone or activin
signaling in the gonadotrope.
To determine whether the synergy between progestins or
androgens and activin occurs directly at the level of the FSH␤
promoter, we first tested whether DNA-binding-deficient
steroid receptors would still elicit a synergistic hormonal
response. The PRC577A mutant is analogous to a C587A
mutation in the human PRB that prevents DNA binding (35),
and the AR C562G mutation has also been reported to inhibit
DNA binding (31). Figure 4 shows that whereas activin induced FSH␤ gene expression in the presence of both wildtype and mutant steroid receptors, the response to R5020
(Fig. 4A) and R1881 (Fig. 4B) was greatly diminished in the
presence of the mutant receptors. Additionally, use of the PR
C577A mutant did not result in synergy after cotreatment of
the cells with activin and R5020, in contrast to the synergy
observed with wild-type PR (Fig. 4A). Similar results were
obtained using the ARC562G mutant receptor (Fig. 4B), indicating that the DNA-binding domain (DBD) regions of PR
and AR are critical for the synergistic response between
activin and the gonadal steroid hormones.
To further test whether the synergy between activin and
progestins or androgens requires binding of PR or AR, respectively, to the FSH␤ promoter, we transfected L␤T2 cells
with a reporter plasmid containing a mutated HRE at ⫺381
of the FSH␤ promoter (⫺381 HRE). The ⫺381 HRE was
previously characterized as an element critical for steroid
hormone responsiveness on the murine FSH␤ promoter (15).
Activin induced FSH␤ gene expression 3- and 4-fold in the
presence of exogenous PR and AR, respectively (Fig. 4, C and
D), but the steroid hormone response was significantly reduced on the ⫺381 HRE mutant compared with the wildtype FSH␤ promoter. The synergy between progestins and
activin was also substantially decreased by 73% (Fig. 4C). The
remaining synergy is probably due to PR binding to other
HREs present in the FSH␤ promoter (15). In contrast, there
was no significant interaction between androgens and activin
on the ⫺381 HRE mutant promoter (Fig. 4D).
Smad-dependent signaling is critical for synergy between
steroid hormones and activin
The next set of experiments explored whether the classical
activin signaling pathway was required for synergy. First, we
tested whether the synergy between activin and progestins or
androgens would be abrogated by reducing the bioavailability
of activin with an inhibitor such as follistatin. Treatment of the
L␤T2 cells with follistatin resulted in diminished basal gene
expression as reported previously (24), probably due to follistatin inhibition of the actions of autocrine activin secreted by
the L␤T2 cells themselves (Fig. 5, A and B). Induction of FSH␤
gene expression by either R5020 (Fig. 5A) or R1881 (Fig. 5B) was
also reduced after treatment of the cells with follistatin. Furthermore, treatment with follistatin completely blocked FSH␤
gene expression induced by activin and reduced the synergy
between activin and the gonadal steroid hormones to the level
of induction seen with steroid hormone alone (Fig. 5).
Second, we tested whether the synergy between activin
and gonadal steroid hormones was due to activation of the
1096
Endocrinology, March 2008, 149(3):1091–1102
Thackray and Mellon • PR and AR Synergize with Smads
FIG. 3. Synergistic activation by progestins or androgens and activin is specific to the FSH␤ promoter. The
GRAS-tk-luc reporter gene was transiently transfected
into L␤T2 cells along with 200 ng PR (A) or AR (B). The
MMTV-luc reporter gene was transiently transfected
into the cells with PR (C) or AR (D). The LH␤-luc reporter gene was transiently transfected into the cells
with PR (E) or AR (F). After overnight starvation in
serum-free media, the cells were treated with vehicle
(Veh), 10 ng/␮l activin (Act), 100 nM R5020 (A, C, and E),
100 nM R1881 (B, D, and F), or both activin and the
relevant steroid hormone for 24 h, as indicated. *, Significant differences from the vehicle-treated control.
Smad signaling pathway using an inhibitory Smad protein.
Smad7 has been shown to act as an inhibitor of the activin
signaling pathway by binding to the activin receptors and
preventing the phosphorylation of Smad2 and Smad3 (36,
37). Transient transfection of the L␤T2 cells with the pRK5
empty vector did not affect synergy between activin and
progestins or androgens (Fig. 5, C and D). However, transfection of L␤T2 cells with 200 ng Smad7 abolished the activin
induction and the synergy between activin and the gonadal
steroid hormones without affecting the activation by steroid
hormones alone.
Finally, because Smad7 appears to have other cellular functions in addition to blocking the activation of Smad2/3 (38 – 40),
additional experiments were needed to confirm whether the
synergy required activation of the Smad-dependent signaling
pathway. Specifically, we determined whether pharmacological inhibitors of these signaling pathways could block the synergy. The inhibitor SB-431541 has been shown to specifically
block the phosphorylation of Smad2 and Smad3 (41), whereas
the SB-202190 compound prevents Smad-independent activation of p38 MAPK (42, 43). Treatment of the L␤T2 cells with
dimethylsulfoxide (the vehicle control for the inhibitors) had no
effect on the synergy between activin and progestins or androgens (Fig. 6). On the other hand, treatment with 2 ␮m SB-431541
blocked both the activin induction and the synergy between
activin and the steroid hormones. In contrast, the p38 MAPK
inhibitor SB-202190 significantly reduced FSH␤ gene expression after activin treatment compared with the vehicle control
(P ⬍ 0.05) but did not abolish synergy between activin and
progestins or androgens. These results indicate that Smad-dependent signaling is required for synergy between gonadal
steroid hormones and activin on the FSH␤ promoter.
Gonadal steroid hormone receptors and Smad proteins
physically interact
After demonstrating that steroid receptors and Smad-dependent signaling appear to be essential for the synergy
Thackray and Mellon • PR and AR Synergize with Smads
Endocrinology, March 2008, 149(3):1091–1102
1097
FIG. 4. DNA binding of PR or AR to the
proximal FSH␤ promoter is required for
the synergistic activation by steroids
and activin. A, The ⫺1000FSH␤luc reporter plasmid was transiently cotransfected with wild-type (WT) or mutant
PR (PRC577A). B, The ⫺1000FSH␤luc
reporter was transiently cotransfected
into L␤T2 cells with the wild-type or
mutant AR (ARC562G). C and D, The
wild-type ⫺1000FSH␤luc reporter or
the ⫺381 mutant was transiently cotransfected into L␤T2 cells with PR or
AR, respectively. After overnight starvation in serum-free media, cells were
treated with vehicle, 10 ng/␮l activin,
100 nM steroid, or both hormones for
24 h. *, Significant differences from the
vehicle-treated control; †, synergistic
interaction as defined by a two-way
ANOVA (P ⬍ 0.05).
between gonadal steroid hormones and activin, we then
tested whether PR and AR can interact with Smad proteins
because Smads can alter gene transcription by tethering to
other transcription factors as well as by direct DNA binding
(44 – 46). AR has been shown previously to interact with
Smad3 and Smad4 in vitro and in prostate cancer cells (47–
49). We tested whether PR and AR interact with Smad proteins by incubating these steroid receptors with GST-Smad
fusion proteins in pull-down experiments. Bacterially expressed GST-Smad2, -Smad3, and -Smad4 fusion proteins
interacted with in vitro-transcribed and -translated PR (Fig.
7). Both the full-length PRB and PRA bound to Smad2, Smad3,
and Smad4. As a positive control, we also showed that AR
interacts with Smad3 and Smad4, as previously reported, as
well as with Smad2. In contrast, there was minimal interaction between any of the GST-fusion Smad proteins and the
negative control, green fluorescent protein (GFP), or with
FIG. 5. The activin signaling pathway
is critical for cross-talk between activin
and progestins or androgens. The
⫺1000FSH␤luc reporter gene was transiently transfected into L␤T2 cells
along with PR (A) or AR (B). After overnight starvation in serum-free media,
cells were treated with vehicle, 10 ng/␮l
activin, 100 ng/␮l follistatin, 100 nM steroid, or combinations of hormones, as
indicated, for 24 h. The ⫺1000FSH␤luc
reporter gene was transiently transfected into L␤T2 cells along with PR (C)
or AR (D) and Smad7 or empty vector
control (pRK5) as indicated. After overnight starvation in serum-free media,
cells were treated with vehicle, 10 ng/␮l
activin, 100 nM R5020, or R1881, or both
activin and the relevant steroid hormone for 24 h. *, Significant differences
from the vehicle-treated control; †, synergistic interaction as defined by a twoway ANOVA (P ⬍ 0.05).
GST alone incubated with the transcribed and translated
proteins (Fig. 7).
Overexpression of Smad proteins and gonadal steroid
receptors is sufficient for the synergy
Because the synergy between progestins or androgens and
activin is dependent on the Smad signaling pathway and
Smad2/3/4 can interact with PR and AR, we then asked
whether overexpression of Smad proteins and ligand-bound
steroid receptors is sufficient for the synergy to occur. We
chose to focus on Smad3 because Smad2 is difficult to overexpress in L␤T2 cells (50). Transient transfection of the L␤T2
cells with an expression plasmid containing Smad3 resulted
in a significant increase in FSH␤ gene expression compared
with the empty vector (Fig. 8). L␤T2 cells containing Smad3
were also treated with the vehicle control or either 100 nm
1098
Endocrinology, March 2008, 149(3):1091–1102
FIG. 6. Smad-dependent signaling is required for the synergy between gonadal steroid hormones and activin. The ⫺1000FSH␤luc
reporter gene was transiently transfected into L␤T2 cells along with
PR (A) or AR (B). After overnight starvation in serum-free media, cells
were treated for 24 h with vehicle, 10 ng/␮l activin, 100 nM of either
R5020 or R1881, or both activin and steroid hormones in the presence
of dimethylsulfoxide or 2 ␮M of the Alk-4/5 or p38 MAPK inhibitors
SB-431542 or SB-202190, as indicated. *, Significant differences from
the vehicle-treated control; †, synergistic interaction as defined by a
two-way ANOVA (P ⬍ 0.05).
R5020 (Fig. 8A) or 100 nm R1881 (Fig. 8B). Treatment of cells
with Smad3 and steroid hormones resulted in a synergistic
induction compared with the steroid hormone alone, indicating that overexpression of Smad3 was sufficient to elicit
FIG. 7. PR and AR bind specifically to Smad proteins. GST interaction assays were performed using bacterially expressed GST-fusion
proteins (indicated above each lane) and 35S-labeled in vitro-transcribed and -translated AR, PRB, PRA, and GFP (indicated on the left
of the panels). GFP was used as a negative control. The GST-fusion
proteins included GST alone, GST-Smad2 (S2), GST-Smad3 (S3), and
GST-Smad4 (S4). One tenth of the protein used in the interaction
assay was loaded in the lane marked Input. The experiment was
repeated several times with the same results, and a representative
experiment is shown.
Thackray and Mellon • PR and AR Synergize with Smads
FIG. 8. Overexpression of Smads and steroid receptors is sufficient
for synergistic induction of the proximal FSH␤ promoter. The
⫺1000FSH␤luc reporter gene was transiently cotransfected into
L␤T2 cells with 200 ng PR (A) or AR (B). Cells were also transfected
with the pRK5 plasmid as the empty vector control or the Smad3
expression vector. After overnight starvation in serum-free media, the
cells were treated with the vehicle control and 100 nM R5020 or R1881
for 24 h, as indicated. *, Significant differences from the vehicletreated control; †, synergistic interaction as defined by a wo-way
ANOVA (P ⬍ 0.05).
cooperation between the steroid receptors and the Smaddependent signaling pathway.
Cooperation between gonadal steroid hormones and activin
requires binding of Smads to SBEs in the FSH␤ promoter
Because Smad proteins physically interact with PR and AR
(Fig. 7) and they are sufficient to elicit a synergistic response
with steroid receptors (Fig. 8), we asked whether Smad proteins bind to their cognate response elements or whether they
act through tethering to the steroid receptors. To address this
issue, we first transfected the L␤T2 cells with a Smad3 mutant (Smad3LC) lacking the amino-terminal DBD (MH1) but
containing the linker region and the carboxyl-terminal domain (MH2) necessary for interaction with Smad4 (51). The
MH1 domain of Smad3 was previously shown to be critical
for activin-mediated stimulation of the rat FSH␤ promoter
(52). Both progestins and androgens significantly induced
FSH␤ gene expression (Fig. 9). In contrast to the induction
observed in the presence of the wild-type Smad3, there was
no response to the mutant Smad3LC (Fig. 9, A and B). The
Smad3LC also did not elicit a synergistic response after treatment with R5020 (Fig. 9A) or R1881 (Fig. 9B), indicating that
the Smad DBD is critical for the synergistic interaction between gonadal steroid hormones and activin.
Second, we measured expression of a luciferase reporter
containing three mutated SBEs at ⫺267, ⫺153, and ⫺120 in
the proximal FSH␤ promoter (3xSBE). These elements have
been shown previously to play an essential role in activin
Thackray and Mellon • PR and AR Synergize with Smads
Endocrinology, March 2008, 149(3):1091–1102
1099
FIG. 9. Disruption of Smad binding to the FSH␤
promoter blocks cross-talk between activin and progestins or androgens. A and B, The ⫺1000FSH␤luc
reporter was transiently cotransfected into L␤T2
cells with PR or AR, as indicated. Cells were also
transfected with the full-length Smad3 (S3) expression vector or a truncation containing the linker and
carboxyl-terminal domain of Smad3 (S3LC). After
overnight starvation in serum-free media, the cells
were treated with vehicle (⫺) and 100 nM R5020 or
R1881 (⫹), as indicated. C and D, The wild-type
⫺1000FSH␤luc reporter or a 3xSBE mutant was
transiently transfected into L␤T2 cells along with
PR or AR. After overnight starvation in serum-free
media, cells were treated with vehicle, 10 ng/␮l activin, 100 nM R5020 or R1881, or both activin and
steroid hormones for 24 h. *, Significant differences
from the vehicle-treated control; †, synergistic interaction as defined by a two-way ANOVA (P ⬍ 0.05).
responsiveness on the FSH␤ promoter (29, 53, 54). Activin
treatment did not induce transcription of the 3xSBE mutant
(Fig. 9, C and D). Unlike activin, both progestins and androgens increased expression of the wild-type and mutant
FSH␤-luciferase reporter gene; the induction was greater on
the 3xSBE mutant than the wild-type promoter. Significantly,
there was no synergy observed after treatment of the cells
with both activin and the gonadal steroid hormones (Fig. 9,
C and D). We further confirmed the necessity of Smad proteins binding to activin-responsive elements in the FSH␤
promoter by testing whether overexpression of Smad3 could
induce a synergistic interaction on the mutant 3xSBE promoter after treatment of the cells with the relevant steroid
hormone. In the context of both ligand-bound PR and AR,
Smad3 was unable to promote synergy on the mutated FSH␤
promoter (data not shown).
Discussion
The experimental results presented herein provide strong
evidence of a cooperative interaction between gonadal steroid hormones and activin in gonadotrope cells. In particular, the synergy between progestin or androgen and activin
regulation of FSH␤ gene expression involves a direct proteinprotein interaction between PR or AR and Smad proteins
while also requiring DNA binding of both steroid receptors
and Smads to their cognate DNA-binding elements within
the FSH␤ promoter. Our results also complement recent
studies showing a synergistic interaction between activin
and testosterone on ovine FSH␤ gene expression (22) as well
as synergy between activin and glucocorticoids or GnRH on
rodent FSH␤ promoters (29, 55, 56).
There are several ways in which gonadal steroid hormones
could interact with activin to regulate FSH␤ gene expression.
One prevalent hypothesis is that testosterone interacts with
activin by reducing the amount of bioavailable activin or by
modifying components of the activin signaling pathway. If
activin signaling were globally altered in the gonadotrope by
gonadal steroid hormones, a change in the induction of any
activin-responsive promoter would be expected. However,
we did not observe any synergy between activin and progesterone or testosterone on a GRAS element derived from
the GnRH receptor promoter or the LH␤ promoter. This
indicates that the mechanism of synergy does not involve a
global modulation of activin signaling but instead points to
a direct interaction of the steroid and activin signaling pathways on the proximal FSH␤ promoter. We cannot rule out a
role for modulation of activin signaling by steroid hormones,
especially because testosterone appears to alter components
of activin signaling including the levels of follistatin mRNA
(17, 18). However, we propose that this regulation may be
more important in other pituitary cells, such as folliculostellate cells rather than in pituitary gonadotrope cells. Winters and Moore (57) have also suggested that the differences
in the pituitary cellular environment, especially in the levels
of follistatin and inhibin, may be responsible for the speciesspecific differences in FSH regulation by gonadal steroid
hormones among mammals. It should also be noted that
steroid receptor signaling was not generally affected because
progestin and androgen responsiveness of the MMTV promoter did not change after cotreatment with gonadal steroid
hormones and activin.
Because the synergistic interaction between gonadal steroid hormones and activin does not appear to be due to a
global response in gonadotrope cells, we examined whether
this cross-talk occurs at the level of transcription factor binding to the proximal FSH␤ promoter. We demonstrated that
a functional steroid receptor DBD was essential for the synergism. Because the DBD of steroid receptors has been reported to interact with other transcription factors such as
AP-1 (58 – 60), we also showed that when the ⫺381 HRE was
mutated in the FSH␤ promoter, the synergy between gonadal
hormones and activin disappeared, providing additional evidence that binding of PR and AR to the proximal FSH␤
promoter is crucial for synergy to occur.
In analyzing the role of the classical activin-signaling pathway in this synergy, we initially showed that follistatin can
block the synergy between gonadal steroid hormones and
activin by reducing the amount of bioavailable activin. Interestingly, follistatin also blunted the response to progesterone or androgen treatment on its own; probably due to the
presence of autocrine activin in the L␤T2 cells. However, in
contrast to our previous report on synergy between testos-
1100
Endocrinology, March 2008, 149(3):1091–1102
terone and activin on the ovine FSH␤ promoter (22), follistatin did not completely abrogate the gonadal steroid hormone
induction, indicating that the autocrine activin loop is not a
required component for progesterone and testosterone signaling. The fact that Smad7 and the pharmacological inhibitor SB-431542 blocked Smad-dependent signaling but not
the steroid hormone induction of FSH␤ also supports this
conclusion.
The next important issue that we addressed was whether
the activin signaling required for the synergy occurred
through a Smad-dependent or -independent mechanism.
TGF␤, a member of the activin family, can signal through
different pathways in multiple cell types (51). Activin has
been shown to regulate several kinases in gonadotrope cells
including PI3K/Akt, ERK1/2, MAPK kinase 1/2 (MEK), and
p38 MAPK. Inhibition of these pathways has been reported
to have no effect on FSH␤ gene expression in several studies
(55, 61), whereas in another study, TGF␤-activated kinase 1
signaling through p38 MAPK was suggested to play a role
in activin responsiveness on the ovine FSH␤ promoter (62).
We initially chose to address this question by showing that
Smad7 completely blocked the synergy between activin and
progestins or androgens. However, because Smad7 has been
reported to have additional cellular functions in addition to
preventing the phosphorylation of Smad2/3, we were cautious about interpreting our results. To further address
whether the synergy occurs through a Smad-dependent
mechanism, we used a pharmacological approach to inhibit
the kinase activity of the activin receptor. The inhibitor SB431542 completely blocked the synergy between gonadal
steroid hormones and activin, further supporting the hypothesis that the synergy occurs through Smad-dependent
signaling. In our experiments, the inhibitor SB-202190 (a
close analog of SB-203580) reduced but did not abolish the
cooperation interaction between activin and gonadal steroid
hormones, suggesting that although p38 MAPK signaling
may play a role in activin responsiveness, it is not required
for the synergism.
Having demonstrated that Smad-dependent signaling
was necessary for the synergy between gonadal steroid hormones and activin, we tested whether there was direct interaction between Smads and PR or AR. Using GST-interaction assays, we showed that Smad proteins can physically
interact with PR in addition to AR. Our data expand the list
of steroid and nuclear receptors that directly partner with
Smads and suggest that a steroid receptor-Smad complex
bound to DNA may be crucial for the synergy. We then
addressed whether Smad proteins are sufficient for the synergy. Overexpression of Smad3 elicited a cooperative response, in the presence of ligand-activated PR or AR. Finally,
we determined whether Smad proteins need to bind to the
FSH␤ promoter or whether they can be tethered to the promoter via protein-protein interactions with steroid receptors.
Using a Smad3 protein lacking the MH1 DBD and a FSH␤
promoter containing three mutated activin-responsive regions, we showed that binding of Smads to their cognate
DNA-binding elements is necessary for synergy. Altogether,
these results provide strong evidence for synergy between
gonadal steroid hormones and activin modulating FSH␤
gene expression that involves direct interaction of the steroid
Thackray and Mellon • PR and AR Synergize with Smads
receptors and Smad proteins at the level of the FSH␤
promoter.
These findings have important physiological implications
for the differential regulation of LH and FSH. During the
ovulatory cycle, GnRH levels peak right before ovulation,
and this surge is immediately followed by an increase in both
LH and FSH. There is also a secondary rise in FSH, independent of GnRH, that is not accompanied by an increase in
LH levels (63, 64). This differential regulation of LH and FSH
can also be seen at the transcriptional level of the LH and FSH
␤-subunits (65, 66). Several hypotheses have been put forth
to explain how the secondary FSH surge is regulated, for
example 1) a change in GnRH pulse frequency that favors
FSH␤ transcription (5), 2) a higher level of bioavailable activin due to a drop in follistatin and inhibin levels that selectively favor FSH␤ synthesis (67, 68), or 3) a rise in steroid
hormone levels, such as progestins and androgens, that induce FSH␤ expression but inhibit LH␤ (14, 15). Our results
support a combination of the second and third hypotheses
and show that they are not mutually exclusive but rather
complementary. Activin may act as a tonic hormone to maintain FSH␤ at basal levels, whereas gonadal steroid hormones
such as progesterone and testosterone synergistically cooperate with activin to induce FSH␤ mRNA levels and produce
the secondary FSH surge. A decrease of inhibitors like follistatin and inhibin mediated by gonadal steroid hormones
in folliculostellate cells in the pituitary may also play an
important role. Thus, it is unlikely that any one hormone is
responsible for generating the secondary FSH surge. Instead,
it is probably the interactions among multiple hormonal
signaling pathways in the pituitary gonadotrope that are
responsible for regulating FSH synthesis.
In summary, we have established that cross-talk between
gonadal steroid hormones and activin signaling pathways
can occur directly on the murine FSH␤ promoter at the level
of the gonadotrope. Moreover, our data refute the idea that
the synergy is due solely to steroid hormone modulation of
the activin autocrine loop. Rather, we demonstrate that this
cooperation cannot be accomplished without the binding of
both steroid receptors and Smad proteins to their HREs in the
FSH␤ promoter and suggest that a direct protein-protein
interaction between steroid receptors and Smads may also
play a role. Further examination of the mechanisms that the
two types of transcription factors employ in their synergistic
enhancement of FSH␤ gene expression will lead to a better
comprehension of the physiological role this interaction
plays in the maintenance of reproductive fitness.
Acknowledgments
We thank Djurdjica Coss, Shauna McGillivray, and other members of
the Mellon lab for helpful discussions and comments. We also thank
Scott Kelley for his suggestions and critical reading of the manuscript.
We thank Susan Mayo for technical assistance. We are grateful to Jorma
Palvimo, Benita Katzenellenbogen, Dean Edwards, and Rik Derynck for
providing plasmids. We also thank the UCSD Cancer Center DNA
Sequencing Shared Resource for dideoxynucleotide sequencing.
Received November 1, 2007. Accepted December 4, 2007.
Address all correspondence and requests for reprints to: Pamela L.
Mellon, Ph.D., Department of Reproductive Medicine, University of
Thackray and Mellon • PR and AR Synergize with Smads
California at San Diego, 9500 Gilman Drive, La Jolla, California 92093.
E-mail: pmellon@ucsd.edu.
This work was supported by National Institute of Child Health and
Human Development, National Institutes of Health (NIH) through a
cooperative agreement (U54 HD12303) as part of the Specialized Cooperative Centers Program in Reproduction Research (P.L.M.). This
work was also supported by NIH Grant R01 HD20377 (to P.L.M.). V.G.T.
was supported by NIH F32 DK065437 and NIH T32 HD07203.
Disclosure Statement: The authors have nothing to disclose.
Endocrinology, March 2008, 149(3):1091–1102
24.
25.
26.
27.
References
1. Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulating hormone is
required for ovarian follicle maturation but not male fertility. Nat Genet
15:201–204
2. Ma X, Dong Y, Matzuk MM, Kumar TR 2004 Targeted disruption of luteinizing hormone ␤-subunit leads to hypogonadism, defects in gonadal steroidogenesis, and infertility. Proc Natl Acad Sci USA 101:17294 –17299
3. Burns KH, Matzuk MM 2002 Minireview: genetic models for the study of
gonadotropin actions. Endocrinology 143:2823–2835
4. Pierce JG, Parsons TF 1981 Glycoprotein hormones: structure and function.
Annu Rev Biochem 50:465– 495
5. Kaiser UB, Jakubowiak A, Steinberger A, Chin WW 1997 Differential effects
of gonadotropin-releasing hormone (GnRH) pulse frequency on gonadotropin
subunit and GnRH receptor messenger ribonucleic acid levels in vitro. Endocrinology 138:1224 –1231
6. Papavasiliou SS, Zmeili S, Khoury S, Landefeld TD, Chin WW, Marshall JC
1986 Gonadotropin-releasing hormone differentially regulates expression of
the genes for luteinizing hormone ␣ and ␤ subunits in male rats. Proc Natl Acad
Sci USA 83:4026 – 4029
7. Vale W, Rivier C, Brown M 1977 Regulatory peptides of the hypothalamus.
Annu Rev Physiol 39:473–527
8. Ying SY 1988 Inhibins, activins, and follistatins: gonadal proteins modulating
the secretion of follicle-stimulating hormone. Endocr Rev 9:267–293
9. Carroll RS, Corrigan AZ, Gharib SD, Vale W, Chin WW 1989 Inhibin, activin,
and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Mol Endocrinol 3:1969 –1976
10. Attardi B, Miklos J 1990 Rapid stimulatory effect of activin-A on messenger
RNA encoding the follicle-stimulating hormone ␤-subunit in rat pituitary cell
cultures. Mol Endocrinol 4:721–726
11. Blumenfeld Z, Ritter M 2001 Inhibin, activin, and follistatin in human fetal
pituitary and gonadal physiology. Ann NY Acad Sci 943:34 – 48
12. Yamada Y, Yamamoto H, Yonehara T, Kanasaki H, Nakanishi H, Miyamoto
E, Miyazaki K 2004 Differential activation of the luteinizing hormone ␤-subunit promoter by activin and gonadotropin-releasing hormone: a role for the
mitogen-activated protein kinase signaling pathway in L␤T2 gonadotrophs.
Biol Reprod 70:236 –243
13. Coss D, Thackray VG, Deng CX, Mellon PL 2005 Activin regulates luteinizing
hormone ␤-subunit gene expression through smad-binding and homeobox
elements. Mol Endocrinol 19:2610 –2623
14. Burger LL, Haisenleder DJ, Dalkin AC, Marshall JC 2004 Regulation of
gonadotropin subunit gene transcription. J Mol Endocrinol 33:559 –584
15. Thackray VG, McGillivray SM, Mellon PL 2006 Androgens, progestins and
glucocorticoids induce follicle-stimulating hormone ␤-subunit gene expression at the level of the gonadotrope. Mol Endocrinol 20:2062–2079
16. Nakamura T, Takio K, Eto Y, Shibai H, Titani K, Sugino H 1990 Activinbinding protein from rat ovary is follistatin. Science 247:836 – 838
17. Bilezikjian LM, Corrigan AZ, Blount AL, Vale WW 1996 Pituitary follistatin
and inhibin subunit messenger ribonucleic acid levels are differentially regulated by local and hormonal factors. Endocrinology 137:4277– 4284
18. Burger LL, Haisenleder DJ, Aylor KW, Dalkin AC, Prendergast KA, Marshall
JC 2004 Regulation of luteinizing hormone-␤ and follicle-stimulating hormone
(FSH)-␤ gene transcription by androgens: testosterone directly stimulates
FSH-␤ transcription independent from its role on follistatin gene expression.
Endocrinology 145:71–78
19. Burger LL, Haisenleder DJ, Wotton GM, Aylor KW, Dalkin AC, Marshall JC
2007 The regulation of FSH␤ transcription by gonadal steroids: testosterone
and estradiol modulation of the activin intracellular signaling pathway. Am J
Physiol Endocrinol Metab 293:E277–E285
20. Leal AM, Blount AL, Donaldson CJ, Bilezikjian LM, Vale WW 2003 Regulation of follicle-stimulating hormone secretion by the interactions of activin-A,
dexamethasone and testosterone in anterior pituitary cell cultures of male rats.
Neuroendocrinology 77:298 –304
21. Bohnsack BL, Szabo M, Kilen SM, Tam DH, Schwartz NB 2000 Follistatin
suppresses steroid-enhanced follicle-stimulating hormone release in vitro in
rats. Biol Reprod 62:636 – 641
22. Spady TJ, Shayya R, Thackray VG, Ehrensberger L, Bailey JS, Mellon PL
2004 Androgen regulates FSH␤ gene expression in an activin-dependent manner in immortalized gonadotropes. Mol Endocrinol 18:925–940
23. Alarid ET, Windle JJ, Whyte DB, Mellon PL 1996 Immortalization of pituitary
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
1101
cells at discrete stages of development by directed oncogenesis in transgenic
mice. Development 122:3319 –3329
Pernasetti F, Vasilyev VV, Rosenberg SB, Bailey JS, Huang H-J, Miller WL,
Mellon PL 2001 Cell-specific transcriptional regulation of FSH␤ by activin and
GnRH in the L␤T2 pituitary gonadotrope cell model. Endocrinology 142:2284 –
2295
Graham KE, Nusser KD, Low MJ 1999 L␤T2 gonadotroph cells secrete follicle
stimulating hormone (FSH) in response to activin A. J Endocrinol 162:R1–R5
Lewis KA, Gray PC, Blount AL, MacConell LA, Wiater E, Bilezikjian LM,
Vale W 2000 Betaglycan binds inhibin and can mediate functional antagonism
of activin signalling. Nature 404:411– 414
Lawson MA, Li D, Glidewell-Kenney CA, Lopez FJ 2001 Androgen responsiveness of the pituitary gonadotrope cell line L␤T2. J Endocrinol 170:601– 607
Kawakami S, Fujii Y, Okada Y, Winters SJ 2002 Paracrine regulation of FSH
by follistatin in folliculostellate cell-enriched primate pituitary cell cultures.
Endocrinology 143:2250 –2258
McGillivray SM, Thackray VG, Coss D, Mellon PL 2007 Activin and glucocorticoids synergistically activate follicle-stimulating hormone ␤-subunit
gene expression in the immortalized L␤T2 gonadotrope cell line. Endocrinology 148:762–773
Duval DL, Nelson SE, Clay CM 1997 The tripartite basal enhancer of the
gonadotropin-releasing hormone (GnRH) receptor gene promoter regulates
cell-specific expression through a novel GnRH receptor activating sequence.
Mol Endocrinol 11:1814 –1821
Ikonen T, Palvimo JJ, Janne OA 1998 Heterodimerization is mainly responsible for the dominant negative activity of amino-terminally truncated rat
androgen receptor forms. FEBS Lett 430:393–396
Slinker BK 1998 The statistics of synergism. J Mol Cell Cardiol 30:723–731
Turgeon JL, Waring DW 2006 Differential expression and regulation of progesterone receptor isoforms in rat and mouse pituitary cells and L␤T2 gonadotropes. J Endocrinol 190:837– 846
Curtin D, Jenkins S, Farmer N, Anderson AC, Haisenleder DJ, Rissman E,
Wilson EM, Shupnik MA 2001 Androgen suppression of GnRH-stimulated
rat LH␤ gene transcription occurs through Sp1 sites in the distal GnRHresponsive promoter region. Mol Endocrinol 15:1906 –1917
Takimoto GS, Tasset DM, Eppert AC, Horwitz KB 1992 Hormone-induced
progesterone receptor phosphorylation consists of sequential DNA-independent and DNA-dependent stages: analysis with zinc finger mutants and the
progesterone antagonist ZK98299. Proc Natl Acad Sci USA 89:3050 –3054
Nakao A, Afrakhte M, Moren A, Nakayama T, Christian JL, Heuchel R, Itoh
S, Kawabata M, Heldin NE, Heldin CH, ten Dijke P 1997 Identification of
Smad7, a TGF␤-inducible antagonist of TGF-␤ signalling. Nature 389:631– 635
Souchelnytskyi S, Nakayama T, Nakao A, Moren A, Heldin CH, Christian
JL, ten Dijke P 1998 Physical and functional interaction of murine and Xenopus
Smad7 with bone morphogenetic protein receptors and transforming growth
factor-␤ receptors. J Biol Chem 273:25364 –25370
Landstrom M, Heldin NE, Bu S, Hermansson A, Itoh S, ten Dijke P, Heldin
CH 2000 Smad7 mediates apoptosis induced by transforming growth factor ␤
in prostatic carcinoma cells. Curr Biol 10:535–538
Edlund S, Bu S, Schuster N, Aspenstrom P, Heuchel R, Heldin NE, ten Dijke
P, Heldin CH, Landstrom M 2003 Transforming growth factor-␤1 (TGF-␤)induced apoptosis of prostate cancer cells involves Smad7-dependent activation of p38 by TGF-␤-activated kinase 1 and mitogen-activated protein kinase
kinase 3. Mol Biol Cell 14:529 –544
Bai S, Cao X 2002 A nuclear antagonistic mechanism of inhibitory Smads in
transforming growth factor-beta signaling. J Biol Chem 277:4176 – 4182
Inman GJ, Nicolas FJ, Callahan JF, Harling JD, Gaster LM, Reith AD, Laping
NJ, Hill CS 2002 SB-431542 is a potent and specific inhibitor of transforming
growth factor-␤ superfamily type I activin receptor-like kinase (ALK) receptors
ALK4, ALK5, and ALK7. Mol Pharmacol 62:65–74
Bakin AV, Rinehart C, Tomlinson AK, Arteaga CL 2002 p38 mitogen-activated protein kinase is required for TGF␤-mediated fibroblastic transdifferentiation and cell migration. J Cell Sci 115:3193–3206
Bakin AV, Tomlinson AK, Bhowmick NA, Moses HL, Arteaga CL 2000
Phosphatidylinositol 3-kinase function is required for transforming growth
factor ␤-mediated epithelial to mesenchymal transition and cell migration.
J Biol Chem 275:36803–36810
Zawel L, Dai JL, Buckhaults P, Shou S, Kinzler KW, Vogelstein B, Karn SE
1998 Human Smad3 and Smad 4 are sequence-specific transcription activators.
Mol Cell 1:611– 617
Zhang Y, Feng XH, Derynck R 1998 Smad3 and Smad4 cooperate with c-Jun/
c-Fos to mediate TGF-␤-induced transcription. Nature 394:909 –913
Hua X, Liu X, Ansari DO, Lodish HF 1998 Synergistic cooperation of TFE3 and
smad proteins in TGF-␤-induced transcription of the plasminogen activator
inhibitor-1 gene. Genes Dev 12:3084 –3095
Hayes SA, Zarnegar M, Sharma M, Yang F, Peehl DM, ten Dijke P, Sun Z
2001 SMAD3 represses androgen receptor-mediated transcription. Cancer Res
61:2112–2118
Kang HY, Huang KE, Chang SY, Ma WL, Lin WJ, Chang C 2002 Differential
modulation of androgen receptor-mediated transactivation by Smad3 and
tumor suppressor Smad4. J Biol Chem 277:43749 – 43756
Chipuk JE, Cornelius SC, Pultz NJ, Jorgensen JS, Bonham MJ, Kim SJ,
1102
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
Endocrinology, March 2008, 149(3):1091–1102
Danielpour D 2002 The androgen receptor represses transforming growth
factor-␤ signaling through interaction with Smad3. J Biol Chem 277:1240 –1248
Bernard DJ 2004 Both SMAD2 and SMAD3 mediate activin-stimulated expression of the follicle-stimulating hormone ␤-subunit in mouse gonadotrope
cells. Mol Endocrinol 18:606 – 623
Derynck R, Zhang YE 2003 Smad-dependent and Smad-independent pathways in TGF-␤ family signalling. Nature 425:577–584
Suszko MI, Balkin DM, Chen Y, Woodruff TK 2005 Smad3 mediates activininduced transcription of follicle-stimulating hormone ␤-subunit gene. Mol
Endocrinol 19:1849 –1858
Suszko MI, Lo DJ, Suh H, Camper SA, Woodruff TK 2003 Regulation of the
rat follicle-stimulating hormone ␤-subunit promoter by activin. Mol Endocrinol 17:318 –332
Bailey JS, Rave-Harel N, Coss D, McGillivray SM, Mellon PL 2004 Activin
regulation of the follicle-stimulating hormone ␤-subunit gene involves Smads
and the TALE homeodomain proteins Pbx1 and Prep1. Mol Endocrinol 18:
1158 –1170
Gregory SJ, Lacza CT, Detz AA, Xu S, Petrillo LA, Kaiser UB 2005 Synergy
between activin A and gonadotropin-releasing hormone in transcriptional
activation of the rat follicle-stimulating hormone-␤ gene. Mol Endocrinol 19:
237–254
Coss D, Hand CM, Yaphockun KK, Ely HA, Mellon PL 2007 p38 mitogenactivated kinase is critical for synergistic induction of the FSH␤ gene by
gonadotropin-releasing hormone and activin through augmentation of c-Fos
induction and Smad phosphorylation. Mol Endocrinol 21:3071–3086
Winters SJ, Moore JP 2004 Intra-pituitary regulation of gonadotrophs in male
rodents and primates. Reproduction 128:13–23
Heck S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P, Cato AC
1994 A distinct modulating domain in glucocorticoid receptor monomers in the
repression of activity of the transcription factor AP-1. EMBO J 13:4087– 4095
Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R,
Gass P, Schmid W, Herrlich P, Angel P, Schutz G 1998 DNA binding of the
glucocorticoid receptor is not essential for survival. Cell 93:531–541
Thackray and Mellon • PR and AR Synergize with Smads
60. Kallio PJ, Poukka H, Moilanen A, Janne OA, Palvimo JJ 1995 Androgen
receptor-mediated transcriptional regulation in the absence of direct interaction with a specific DNA element. Mol Endocrinol 9:1017–1028
61. Dupont J, McNeilly J, Vaiman A, Canepa S, Combarnous Y, Taragnat C 2003
Activin signaling pathways in ovine pituitary and L␤T2 gonadotrope cells. Biol
Reprod 68:1877–1887
62. Safwat N, Ninomiya-Tsuji J, Gore AJ, Miller WL 2005 Transforming growth
factor-␤ activated kinase1 (TAK1) is a key mediator of ovine follicle stimulating
hormone ␤-subunit expression. Endocrinology 146:4814 – 4824
63. Daane TA, Parlow AF 1971 Periovulatory patterns of rat serum follicle stimulating hormone and luteinizing hormone during the normal estrous cycle as
revealed by radioimmunoassays: effects of pentobarbital. Endocrinology 88:
653– 663
64. Gay VL, Midgley Jr AR, Niswender GD 1970 Patterns of gonadotrophin
secretion associated with ovulation. Fed Proc 29:1880 –1887
65. Ortolano GA, Haisenleder DJ, Dalkin AC, Iliff-Sizemore SA, Landefeld TD,
Maurer RA, Marshall JC 1988 Follicle-stimulating hormone ␤-subunit messenger ribonucleic acid concentrations during the rat estrous cycle. Endocrinology 123:2946 –2948
66. Zmeili SM, Papavasiliou SS, Thorner MO, Evans WS, Marshall JC, Landefeld TD 1986 Alpha and luteinizing hormone beta subunit messenger
ribonucleic acids during the rat estrous cycle. Endocrinology 119:1867–1869
67. Woodruff TK, Besecke LM, Groome N, Draper LB, Schwartz NB, Weiss J
1996 Inhibin A and inhibin B are inversely correlated to follicle-stimulating
hormone, yet are discordant during the follicular phase of the rat estrous cycle,
and inhibin A is expressed in a sexually dimorphic manner. Endocrinology
137:5463–5467
68. Besecke LM, Guendner MJ, Sluss PA, Polak AG, Woodruff TK, Jameson JL,
Bauer-Dantoin AC, Weiss J 1997 Pituitary follistatin regulates activin-mediated production of follicle-stimulating hormone during the rat estrous cycle.
Endocrinology 138:2841–2848
Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the
endocrine community.