Discovery and Characterization of Prions
in Saccharomyces cerevisiae
by
Randal A. Halfmann
B.S. Genetics
Texas A&M University, 2004
Submitted to the Department of Biology in partial fulfillment of the requirements for the
degree of
DOCTOR OF PHILOSOPHY IN BIOLOGY
at the
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
FEBRUARY 2011
© 2011 Randal A. Halfmann. All rights reserved.
The author hereby grants to MIT permission to reproduce and to distribute publicly paper
and electronic copies of this thesis document in whole or in part in any medium now known or
hereafter created
Signature of Author:_________________________________________________________________________________
Department of Biology
December 3, 2010
Certified by:___________________________________________________________________________________________
Susan L. Lindquist
Professor of Biology
Thesis Supervisor
Accepted by:__________________________________________________________________________________________
Stephen P. Bell
Professor of Biology
Co-Chair, Biology Graduate Committee
1
2
Discovery and Characterization of Prions
in Saccharomyces cerevisiae
by
Randal A. Halfmann
Submitted to the Department of Biology
in partial fulfillment of the requirements for the Degree of Doctor of Philosophy in Biology
ABSTRACT
Some protein aggregates can perpetuate themselves in a self-templating protein-misfolding
reaction. These aggregates, or prions, are the infectious agents behind diseases like Kuru and madcow disease. In yeast, however, prions act as epigenetic elements that confer heritable alternative
phenotypes. Prion-forming proteins create bistable molecular systems whose semi-stochastic
switching between functional states increases phenotypic diversity within cell populations. My
thesis work explores the idea that rather than being detrimental, prions may commonly act to their
host’s advantage.
To broaden the known range of prion phenomena in S. cerevisiae, I, together with a
postdoctoral fellow in our lab, systematically surveyed the yeast proteome for prion-forming
proteins. Using a combination of computational, cell biological, and biochemical approaches, we
ultimately identified 18 novel prion domains capable of driving phenotypic switching, and an
additional 6 domains that were highly positive for prion-like aggregation in other assays. These
results establish the critical importance of intrinsic amyloid-forming tendencies for prion behavior
by Q/N-rich proteins. We further confirmed that one of these proteins, the transcription factor
Mot3, forms a novel prion in its endogenous context.
An analysis of these findings revealed a strong and unexpected amino acid bias in
prionogenic proteins: prions were strongly enriched for asparagine (N), but not the chemically
related amino acid glutamine (Q). We validated this finding using molecular simulations and
experimental analyses of Q-to-N and N-to-Q variants of prion domains. N-rich sequences had an
intrinsic tendency to both nucleate and propagate amyloid conformers. Q-rich proteins tended
instead to make structurally non-constrained interactions leading to proteotoxic soluble and nonamyloid aggregated conformers.
The appendices include works in progress. Each explores a different aspect of prion biology.
Appendix A confirms a theoretical prediction that prions, if functional, should preferentially
regulate certain rapidly evolving genes. I demonstrate with the newly discovered prion protein,
Mot3, that prions accelerate the appearance of new phenotypes in important traits like mating
behavior and cell-adhesion. I further identify naturally occurring prion states of Mot3 and other
prion proteins in wild yeast isolates, and show that elimination of these prions has strong
phenotypic effects in these strains. Appendix B, work done in collaboration with another lab,
establishes that Nup100, a GLFG nucleoporin, is a prion. The conformational flexibility of GLFG
nucleoporins is critical for the function of the nuclear pore complex, a molecular sieve that
regulates all macromolecular transport between the nucleus and cytoplasm.
Thesis supervisor: Susan Lindquist
Title: Professor of Biology
3
4
Acknowledgements
I will fondly remember my time here at MIT, and the people who helped me make the most
of it. I am forever indebted to my advisor, Susan Lindquist. Quite simply, none of my work would
have been possible without her guidance, enthusiasm and support. I hope that at least a fraction of
the lessons I’ve learned with each trip to her office, whether to talk science or rewrite an abstract
for the 42nd time, stay with me as I leave the lab. I will be a much better scientist for it.
I want to thank my thesis committee members, Thomas Schwartz and Jonathan King, for
sticking with me from beginning to end. My other interactions with Jon, first as his student and later
as his teaching assistant, added valuable perspective to my research-driven graduate education.
Teaching, as he explained, ensures that the next generation can pick up where we leave off. Finally, I
thank Leona Samson and Eugene Shakhnovich for serving on my defense committee.
The Lindquist lab has been a very supportive environment full of genuinely friendly and
approachable people. Their extraordinary collective expertise, and willingness to share it with me,
ensured that I never had to go far to find someone who could help.
I want to especially thank Brooke Bevis for doing her job so well. She kept everything, and
every one, running smoothly. I could always count on her insightful psychoanalyses to make sense
of the few times when things did not go smoothly. I thank my baymate Ben Vincent for his quick
and entertaining wit. I thank Kent Matlack for saving me the hassle of having to use a real
thesaurus, and for showing me from time to time how to find beauty in the most unexpected places.
I thank Dubi Azubuine for a constant supply of media no matter how frequent or unusual my
requests.
I am very fortunate to have had many talented collaborators both inside and outside the lab.
Most importantly, I have to thank Simon Alberti. He has been a great friend and a valuable
intellectual resource. I also thank my first postdoc mentor, Pete Tessier, for his limitless patience
during my early and hectic days in the lab. Thanks to Oliver King, Charlie O’Donnell, and Alex
Lancaster for doing insightful and magical things with computers. Similarly, thanks to Rohit Pappu
and Nick Lyle for lending their expertise with molecular simulations. Finally, thanks to Jessica
Wright and Michael Rexach for their contributions to the never-ending Nup100 saga.
I want to thank the people who gave me my start. First, my parents for constant
encouragement and for providing a sounding board no matter how bored I know they must have
been. The lessons they’ve taught me from an early age, like the universal value of hard work, will
always serve me well. I also thank my undergraduate advisor, David Stelly, who took me under his
wing to get me started in research.
Finally, I can’t imagine where I would be without Megan. Her constant love and
companionship reminds me every day what is truly important.
5
6
Table of Contents
Abstract
3
Acknowledgements
5
Table of Contents
7
Chapter One: Prions, Protein Homeostasis, and Phenotypic Diversity
9
Chapter Two: A Systematic Survey Identifies Prions and Illuminates
Sequence Features of Prionogenic Proteins
Abstract
Introduction
Results
Discussion
Experimental Procedures
References
Figures
Chapter Three: Opposing Effects of Glutamine and Asparagine Dictate
Prion Formation by Intrinsically Disordered Proteins
Summary
Introduction
Results
Discussion
Experimental Procedures
Supplemental Results and Discussion
References
Figures
29
30
30
32
40
42
48
55
83
84
84
86
92
95
100
102
107
Chapter Four: Epigenetics in the Extreme: Prions and the Inheritance
of Environmentally Acquired Traits
125
Appendix A: Evolutionary Capacitance by Yeast Prions
Abstract
Introduction
Results
Discussion
Materials and Methods
References
Figures
135
136
136
138
142
144
145
147
Appendix B: Prion Formation by the GLFG Nucleoporin, Nup100
Abstract
Introduction
Results
Discussion
Materials and Methods
References
Figures
155
156
156
158
162
163
166
178
Appendix C: Specific Author Contributions
185
Appendix D: Curriculum Vitae
186
7
8
Chapter One
Prions, Protein Homeostasis, and Phenotypic
Diversity
This chapter was published previously: Halfmann, R., Alberti, S., and Lindquist, S. (2010). Trends in
Cell Biology 20, 125-33
9
Introduction
Prions are self-replicating protein entities that underlie the spread of a mammalian
neurodegenerative disease, variously known as Kuru, scrapie, and bovine spongiform
encephalopathy, in humans, sheep and cows, respectively (Aguzzi et al., 2008). However, most
prions have been discovered in lower organisms and in particular, the yeast Saccharomyces
cerevisiae. Despite assertions that these prions, too, are diseases (Wickner et al., 2007a) (Box 1),
many lines of evidence suggest that these mysterious elements are generally benign and, in fact, in
some cases beneficial. In fungi, prions act as epigenetic elements that increase phenotypic diversity
in a heritable way and can also increase survival in diverse environmental conditions (True and
Lindquist, 2000; True et al., 2004; Shorter and Lindquist, 2005; Alberti et al., 2009). In higher
organisms, prions may even be a mechanism to maintain long-term physiological states, as
suggested for the Aplysia californica (sea slug) neuronal isoform of CPEB, cytoplasmic
polyadenylation element binding protein. The prion form of this protein appears to be responsible
for creating stable synapses in the brain (Si et al., 2003). CPEB is the prominent first example of
what may be a large group of prion-like physiological switches, the potential scope of which cannot
be given adequate coverage here. Instead, this piece will focus on prions as protein-based genetic
elements – their ability to drive reversible switching in diverse phenotypes, and the way that such
switching can promote the evolution of phenotypic novelty.
The self-templating replicative state of most biochemically characterized prions is amyloid
(Glover et al., 1997; Alberti et al., 2009) (Figure 1), although other types of self-propagating protein
conformations may also give rise to prion phenomena (Wickner et al., 2007b; Brown and Lindquist,
2009). Amyloid is a highly ordered, fibrillar protein aggregate with a unique set of biophysical
characteristics that facilitate prion propagation: extreme stability, assembly by nucleated
polymerization, and a high degree of templating specificity. Prion propagation proceeds from a
single nucleating event that occurs within an otherwise stable intracellular population of non-prion
conformers. The nucleus is then elongated into a fibrillar species by templating the conformational
conversion of non-prion conformers (Serio et al., 2000; Tessier and Lindquist, 2009) (Figure 1).
Finally, the growing protein fiber fragments into smaller propagating entities, which are ultimately
disseminated to daughter cells (Shorter and Lindquist, 2005). Because the change in protein
conformation causes a change in function, these self-perpetuating conformational changes create
heritable phenotypes unique to the determinant protein and its genetic background (Figure 1). The
genetic properties that arise are distinct from those of most nuclear-encoded mutations: prion
10
phenotypes are dominant in genetic crosses and exhibit non-Mendelian inheritance patterns. Hence
prion-based genetic elements are denoted with capital letters and brackets – “[PRION]”.
Protein remodeling factors, chaperones, and other protein quality control mechanisms
interact with prions at every step in their propagation. Further, prion-driven phenotypic switches
are modulated by environmental conditions that perturb protein homeostasis (Tyedmers et al.,
2008) – the proteome-wide balance of protein synthesis, folding, trafficking, and degradation
processes (Balch et al., 2008). Prions could thereby constitute an intrinsic part of the biological
response to stress. We postulate that the relationship between prions and protein homeostasis, as
well as the dynamic nature of prion propagation, render prions into sophisticated evolutionary bethedging devices. Herein, we explore multiple intriguing features of prion biology that together
argue for a general role for prions in adaptation to new environments, and thereby the evolution of
new traits.
Prions as bet-hedging devices
Prions can allow simple organisms to switch spontaneously between distinct phenotypic
states (True and Lindquist, 2000). For this reason, prions can be regarded as bet-hedging devices.
Bet-hedging devices increase the reproductive fitness of organisms living in fluctuating
environments by creating variant subpopulations with distinct phenotypic states (Seger and
Brockmann, 1987) (Box 2).
The first prion protein proposed to increase survival in fluctuating environments is the
translation termination factor Sup35, which forms a prion state called [PSI+] (True and Lindquist,
2000). This prion reduces Sup35 activity relative to the non-prion, or [psi-] state, thereby creating a
variety of phenotypes related to alterations in translation fidelity (Liebman and Sherman, 1979;
Patino et al., 1996; True et al., 2004; Namy et al., 2008b). A surprisingly large fraction of the
phenotypes (~25% in one study (Tyedmers et al., 2008)) are advantageous under particular
growth conditions. While reduced translational fidelity cannot, in the long run, be advantageous for
growth, in the short run changes in gene expression brought about by [PSI+] can allow cells to grow
in the presence of antibiotics, metals and other toxic conditions, or with different carbon or
nitrogen sources, depending on the genetic background. Because cells spontaneously gain the prion
at an appreciable frequency (10-7 to 10-6) (Liu and Lindquist, 1999; Tank et al., 2007; Lancaster et
al., 2009), at any one time a sizable population of yeast cells will contain a few that have already
switched states. If the environment is such that [PSI+] is beneficial, these cells would then have a
greater chance to survive in that environment. Importantly, the prion state can be reversed by its
11
occasional loss during cell division (Cox et al., 1980) (with as yet undetermined frequencies),
resulting in progenitors with the original [psi-] phenotype. If after a period of growth, the
environment changes to a state where [PSI+] is not advantageous, those few cells that have
spontaneously lost the prion then have a survival advantage. From a gene-centric point of view, the
net effect of this phenotype switching is that the common genotype shared by both [PSI+] and [psi-]
cells survives through the strenuous series of environmental transitions. Even if the rare switches
to the [PSI+] state are commonly disadvantageous, [PSI+] could dramatically improve the long-term
fitness of a genotype if it is advantageous on occasion. Related phenotypic switching phenomena,
like the reversible appearance of antibiotic-resistant “persister” bacteria, appear to constitute
environmentally-optimized risk-reduction strategies (Kussell et al., 2005) (Box 2).
Other than Sup35, the best characterized yeast prion is the Ure2 nitrogen catabolite
repressor. Its prion state, [URE3], causes cells to constitutively utilize poor nitrogen sources
(Shorter and Lindquist, 2005). This same phenotype, when conferred by URE2 loss-of-function
mutants, has been shown to confer a proliferative advantage to cells in fermenting grape must
(Shorter and Lindquist, 2005), strongly suggesting that this prion, too, may have a functional role in
coping with yeast’s diverse ecological niches.
Until recently, the prion field has been confined to a small handful of proteins, and for this
reason, conjectures about their potential roles in adaptation and evolution have been limited.
However, a wave of recent discoveries in yeast has dramatically expanded the prion world as we
know it (Table 1). The newly discovered prions include functionally diverse proteins: multiple
chromatin remodeling and transcription factors (Du et al., 2008; Alberti et al., 2009; Patel et al.,
2009b), a metacaspase (Nemecek et al., 2009), and a range of additional prionogenic proteins
whose putative endogenous prion states are yet to be examined (Alberti et al., 2009). We suggest
that the existence of these prions and the phenotypic heterogeneity they produce contributes to a
general bet-hedging strategy that arms yeast populations against environmental fluctuations.
Recent analyses of some of these novel prions lend support to this idea (Alberti et al., 2009; Patel et
al., 2009b).
[MOT3+] is a prion formed by the transcription factor Mot3, an environmentally responsive
regulator of yeast cell wall composition and pheromone signaling (Grishin et al., 1998; Abramova et
al., 2001). In general, the cell surface of yeast determines the communication and interaction of
yeast cells with the environment, yet it is also involved in a host of morphological and behavioral
phenotypes, such as cell growth, cell division, mating, filamentation, and flocculation. Whether the
phenotypic variation introduced by [MOT3+] affects all of these processes remains to be explored,
12
but [MOT3+] does confer increased resistance to certain cell wall stressors (Alberti et al., 2009).
Therefore, the phenotypes produced by [MOT3+] should be advantageous in many microbial
environments. The biological significance of Mot3 prion formation is supported by its high
frequency of appearance – approximately 1 in 10,000 cells ((Alberti et al., 2009) and Halfmann and
Lindquist, in preparation).
[SWI+] and [OCT+] are formed by the globally acting transcriptional regulators, Swi1 and
Cyc8, respectively (Du et al., 2008; Patel et al., 2009b). [SWI+] cells are resistant to the microtubule
disruptor, benomyl (Alberti et al., 2009); and [OCT+] induces flocculation (Patel et al., 2009b), a
growth form that has been shown to protect cells from diverse stresses (Smukalla et al., 2008).
Given the large size and complexity of the gene networks regulated by each of these prion
transcription factors, it is likely that many more phenotypes are yet to be linked with prions.
Finally, for the well-characterized prions, it has been established that the presence of one
protein in its prion state can influence the prion switching of other proteins. The [RNQ+] prion, for
instance, strongly increases the rate of appearance of other prions (Shorter and Lindquist, 2005;
Alberti et al., 2009). Conversely, some prions destabilize each other when both exist in the same cell
(Bradley et al., 2002). Such prion cross-talk is influenced both by the sequence similarity between
the proteins and the degree to which they share common components of the cellular prionpropagating machinery (Schwimmer and Masison, 2002; Mathur et al., 2009). The likely existence
of over twenty interconnected prion switches (Alberti et al., 2009), all contributing to phenotypic
heterogeneity, would greatly increase a genetic lineage’s potential to explore phenotypic space.
Prions are being discovered at an increasingly rapid pace, suggesting that many exciting
possibilities remain to be discovered en route to a deeper understanding of the prevalence and
functionality of prions in biology.
Prions as evolutionary capacitors
In addition to “normal” bet-hedging, prions may have an even deeper and more
sophisticated role in microbial evolution. Specifically, prions have been proposed to be capable of
evolutionary capacitance (Shorter and Lindquist, 2005). An evolutionary capacitor is any entity that
normally hides the effects of genetic polymorphisms, allowing for their storage in a silent form, and
releases them in a sudden stepwise fashion (Masel and Siegal, 2009). The complex phenotypes
produced by the sudden expression of accumulated genetic variation on occasion will prove
beneficial to the organism. As the organism proliferates, further genetic and epigenetic variations
will accumulate that stabilize the beneficial phenotype. The extent to which evolutionary capacitors
13
impact the evolution of natural populations is highly debated, and even more so the notion that
capacitance itself can be subject to natural selection (Pigliucci, 2008).
However, the accumulated evidence that at least one prion protein, Sup35, acts in this
manner is exceedingly difficult to dismiss. Sup35 can act as an evolutionary capacitor by connecting
protein folding to the relationship between genotype and phenotype in a remarkable way. The
reduced translation fidelity brought about by Sup35’s prion state, [PSI+], results in the translation of
previously silent genetic information through a variety of mechanisms including stop-codon
readthrough and ribosome frameshifting (Liebman and Sherman, 1979; True et al., 2004; Wilson et
al., 2005; Namy et al., 2008a). Stop-codon readthrough can also affect genetic expression by
changing mRNA stabilities. Untranslated regions and cryptic RNA transcripts experience relaxed
selection under normal ([psi-]) conditions, and consequently, are free to accumulate genetic
variation. Upon the appearance of [PSI+], these polymorphisms become phenotypically expressed.
Because [PSI+] operates on genetic variation in a genome-wide fashion, it allows for the sudden
acquisition of heritable traits that are genetically complex (True et al., 2004). Such traits are initially
unlikely to become [PSI+]-independent because they involve multiple genetic loci and cells will
revert to their normal phenotype when they lose the prion. But if the environment that favors the
changes in gene expression brought about by [PSI+] occurs frequently or lasts for a very long time,
as the population expands, mutations will accumulate that allow cells to maintain the traits even
when they revert to normal translational fidelity through the spontaneous loss of [PSI+]. Arguing
that Sup35 is under selective pressure to maintain the ability to reveal such variation, Sup35
homologs from other yeasts have conserved prion-forming capabilities, despite their sequences
having diverged extensively over hundreds of millions of years (Chernoff et al., 2000; Kushnirov et
al., 2000; Nakayashiki et al., 2001). Mathematical modeling confirms that the complexity of [PSI+]-
revealed phenotypes can theoretically account for the evolution of its prion properties in yeast
(Griswold and Masel, 2009). Finally, a phylogenetic analysis of the incorporation of 3’ untranslated
regions (UTRs) into coding sequences provides compelling evidence for [PSI+]-mediated evolution
in natural yeast populations. When comparing yeast and mammalian genomes, yeast displayed a
strong bias for mutation events leading to in-frame, rather than out-of-frame incorporation of 3’
UTRs (Giacomelli et al., 2007). Thus, yeast 3’ UTRs are translated at a relatively high frequency,
consistent with the occasional appearance of [PSI+] in natural populations.
Buffering of phenotypic variation is an inherent property of regulatory networks, such that
the conditional reduction of network integrity may be a common mode of evolutionary capacitance
(Masel and Siegal, 2009). The distinction between this type of capacitance and prions is that the
14
latter are necessarily epigenetic, and therefore provide a mechanism for the persistence, and
ultimately, genetic assimilation, of the revealed phenotypes (Masel and Siegal, 2009). Prionassociated phenotypes can appear spontaneously and persist for multiple generations, whereas the
revelation of variant phenotypes by other capacitors is generally contingent on stress, and
consequently, relatively transient.
Is prion-driven evolutionary capacitance unique to Sup35, or might prion formation within
any number of proteins also promote the expression of hidden genetic variation? Intriguingly, many
of the newly identified prions are situated to function as genetic capacitors in their own right.
Conspicuously overrepresented among these prionogenic proteins are gene products that control
gene expression, cell signaling and the response to stimuli such as stress ((Alberti et al., 2009) and
Table 1). Many of them represent highly connected nodes in the yeast genetic network. The Swi1
chromatin remodeler, for instance, regulates the expression of 6% of the yeast genome (Du et al.,
2008). Likewise, Cyc8 represses 7% of the yeast gene complement (Green and Johnson, 2004). The
prion candidates Pub1, Ptr69 and Puf2 are members of a family of RNA-binding proteins that
regulate the stability of hundreds of mRNAs encoding functionally related proteins (Hogan et al.,
2008). The strong enrichment of putative prions among proteins that regulate and transact genetic
information suggests that prion-based switches evolve preferentially among proteins whose
functions
impinge
on
multiple
downstream
biological
processes.
Pre-existing
genetic
polymorphisms whose expression is altered by these prions would create different phenotypes in
different genetic backgrounds. Thus, many prions are quite likely to create strong and complex
phenotypes upon which natural selection can act.
Prion formation as an environmentally responsive adaptation
Many bet-hedging devices are environmentally responsive (Avery, 2006) (Box 2). That is, in
addition to entirely stochastic switches, organisms may also make what, in effect, amounts to
“educated guesses” by integrating environmental cues to modulate the frequency of phenotypic
switching. Indeed, the frequency of prion switching is affected by environmental factors. The
appearance of [PSI+] is strongly increased by diverse environmental stresses (Eaglestone et al.,
1999; Tyedmers et al., 2008). Incidentally, this property is necessary and sufficient for [PSI+]
formation to have been favored by natural selection for evolvability (Lancaster et al., 2009). Other
well-characterized prions are also known to be induced by prolonged refrigeration and/or deep
stationary phase (Chernoff, 2007). Because prions are a special type of protein misfolding process,
logically their induction is intrinsically tied to environmental stresses that perturb protein stability.
15
Many if not most polypeptides have a generic capacity to form amyloid (Chiti and Dobson, 2006).
Situations that alter native protein stability, like thermal stress, altered pH, or metal ion imbalances,
are therefore likely to facilitate polypeptides’ access to prion or prion-like amyloid conformations
(Chiti and Dobson, 2006) with the potential to perpetuate phenotypic changes even after the stress
subsides.
The connection to environmental stresses is much deeper than that, however. Protein
quality control machinery is ubiquitous throughout all kingdoms of life and is essential for both
normal protein folding and for coping with stress. Components of the ubiquitin-proteasome system
strongly impact prion formation (Chernoff, 2007). And prion propagation requires the actions of
members of the Hsp40, Hsp70, and Hsp110 chaperone families as well as the AAA+ protein
disaggregase Hsp104 (Chernoff, 2007; Sweeny and Shorter, 2008). Hsp104 is a member of
ClpA/ClpB family of chaperones whose members are found throughout bacteria, fungi, plants and
eukaryotic mitochondria. Hsp104 provides thermotolerance by resolubilizing stress-induced
protein aggregates, and also has the unique ability to sever amyloid fibers into new prion
propagons. This property has been conserved for hundreds of millions of years of fungal evolution
(Zenthon et al., 2006). On the other hand, the Hsp104 protein of fission yeast appears incapable of
propagating amyloid-based prions, despite maintaining its important ability to solubilize nonamyloid stress-induced protein aggregates (Senechal et al., 2009). We note that fission yeast also
has a relative paucity of computationally predicted prions (Harrison and Gerstein, 2003), consistent
with the suggestion that Hsp104’s amyloid shearing capability coevolved with prions to promote
their propagation. Indeed, at least 25 of the 26 known amyloidogenic yeast prion domains require
Hsp104 for their propagation as prions (Osherovich and Weissman, 2001; Alberti et al., 2009;
Nemecek et al., 2009).
Perhaps the dominant force, then, for stress-induced prion formation involves
perturbations in the interactions of prion proteins with chaperones and the cellular environment.
The distribution of proteins between soluble and aggregated states is exquisitely sensitive to the
status of the protein homeostasis network, which comprises protein synthesis, folding, sorting, and
degradation machinery (Morimoto, 2008). Chaperones are highly connected in protein interaction
networks and serve an important role as transducers of the stress response (Morimoto, 2008).
Prion proteins, in turn, are highly connected to chaperones and thus to the protein homeostasis
network at large. Prion conformational switching may therefore respond to stress indirectly
through, for example, alterations in the abundance, availability, and connectivity of chaperones like
Hsp104 and Hsp70s (Shorter and Lindquist, 2008). The induction of prions by diverse proteostatic
16
stresses, and their dependence on chaperones for propagation, may reflect the long history of
chaperone involvement in the relationship between environment and phenotype.
Phenotypic diversity further enhanced by prion conformational and temporal diversity
The morphological adaptive radiation of organisms appears to result predominantly from
genetic changes that have quantitative rather than qualitative effects (Stern and Orgogozo, 2009).
In yeast and other microbes, social behaviors like mating, flocculation, and colony formation are
subject to frequent stochastic changes in the expression of extracellular adhesins, leading to the
rapid divergence of variant subpopulations (Verstrepen and Fink, 2009). These changes facilitate
their expansion into diverse and highly dynamic ecological niches. The mechanisms for such
changes are both genetic and epigenetic in nature (Masel and Siegal, 2009; Verstrepen and Fink,
2009), and include nucleotide repeat expansions and contractions, chromatin remodeling, and as
recently discovered, prion formation (Patel et al., 2009b). Importantly, all of these mechanisms tend
to modulate the activity levels, rather than the functional nature of, the affected gene products.
The ability of organisms to explore such modulations of gene activity, either as individuals
(e.g. phenotypic plasticity), or as members of a genetic lineage (e.g. bet-hedging), enhances their
survival under adverse conditions and is thought to facilitate the subsequent genetic assimilation of
beneficial phenotypic variations (Masel and Siegal, 2009). Molecular mechanisms that allow for the
rapid stabilization or amplification of initially non-genetic adaptive phenotypes within a lineage
could greatly accelerate this process. Indeed, epigenetic processes are likely to play an important
role in adaptive diversification (Bossdorf et al., 2008). As examined below, prions may represent an
ideal epigenetic mechanism for the heritable modulation of gene activity.
Prions have a unique capacity to stratify protein functionality into multiple semi-stable
levels, which greatly increases the phenotypic diversity created by prion-driven switches. It derives
from the unusual and variable way in which prion conformers nucleate and propagate, and has both
static and temporal components. For a given prion, multiple distinct yet related protein
conformations can each self-perpetuate (Figure 2a). These prion “strains” differ in phenotypic
strength and heritability. Strain multiplicity has been observed with both mammalian and yeast
prions (Tessier and Lindquist, 2009), and is a common feature of diverse amyloids when
polymerized in vitro (Pedersen and Otzen, 2008). The nature of the conformational differences
between strains is still poorly understood, although progress has been made in elucidating how
physical differences between amyloid strains – such as the extent of sequence involved with the
fibril core of the amyloid – translate into differences in amyloid growth and division rates, and in
17
turn the phenotypic strength of the prion (Tessier and Lindquist, 2009). Importantly for the bethedging aspect of prion biology, the conformational plasticity of the prion nucleation process
further increases the phenotypic “coding potential” of a single prion gene.
Several observations also demonstrate a temporal component to the strength and stability
of prion phenotypes. For example, the mitotic stability of newly induced prion states increases with
repeated cell passaging (Chernoff et al., 2000; Derkatch et al., 2000; Fernandez-Bellot et al., 2000;
Santoso et al., 2000; Taneja et al., 2007). Additionally, selection for incipient prions using mild
selective conditions creates a much larger population of strong prion states than would be expected
from the numbers obtained by immediate stringent selection (Brachmann et al., 2005; Brachmann
et al., 2006; Edskes et al., 2006; Tyedmers et al., 2008). Recent observations that even “non-prion”
amyloids, such as polyglutamine-based aggregates, can become mitotically stable (Alexandrov et al.,
2008), suggest that a capacity for the maturation of propagating states may be a generic feature of
amyloid-like aggregates. The rate of prion maturation is strongly influenced by Hsp104 activity
(Alexandrov et al., 2008), indicating an additional mode by which the protein homeostasis network
connects the environment to epigenetic changes.
Multiple mechanisms for generating prion diversity temporally can be envisioned (Figure
2), including amyloid strain-like conformational transitions (Alexandrov et al., 2008), the mass-
action population dynamics of prion particles, the variable association of prion particles with
specific cellular structures, and the participation in early stages of prion propagation by an array of
oligomeric species that have been increasingly observed en route to amyloid fibrillation (Serio et
al., 2000; Kodali and Wetzel, 2007; Tessier and Lindquist, 2009). It is plausible that some preamyloid species have rudimentary self-propagating activities themselves.
Regardless of the mechanisms involved, what is clear is that incipient prion states represent
dynamic molecular populations, a view that challenges the prevailing assumption that prions
increase phenotypic heterogeneity solely by acting as simple binary switches. Prion nucleation
allows for a single protein species to create a dynamic continuum of semi-stable phenotypes
(Figure 2c) that do not require genetic, expression-level, or posttranslational regulatory changes to
that protein. For each prion protein, natural selection could operate at any point in this continuum
to favor prion-containing cells, resulting in their clonal expansion relative to other cells and acting
to shift the distribution of phenotypes within the continuum. Stress-induced formation of prions
followed by their iterative maturation offers a rapid route to tunable, advantageous phenotypes.
Ultimately, the beneficial phenotypes conferred by prions can become hard-wired by the
accumulation of genetic and further epigenetic modifications (True and Lindquist, 2000). In this
18
way, semi-stable phenotypic heterogeneity conferred by the diversity of prion conformations and
maturation states would greatly improve the odds of organismal survival in unpredictable or
fluctuating environments, and thereby facilitate subsequent adaptive genetic changes.
Concluding remarks
The ability of prions to create heritable phenotypic diversity that is inducible by stress,
coupled with the conformational and temporal diversity of prion states, suggests a prominent role
for prions in allowing microorganisms to survive in fluctuating environments. However, broader
validation is needed, and many questions remain (Box 3). The field of prion biology is now poised
to answer these questions, and in so doing, make important contributions to our understanding of
evolutionary processes. In particular, we may more fully realize that organisms have specific
mechanisms to enhance the evolution of phenotypic novelty.
References
Abramova, N., Sertil, O., Mehta, S., and Lowry, C.V. (2001). Reciprocal regulation of anaerobic and
aerobic cell wall mannoprotein gene expression in Saccharomyces cerevisiae. Journal of
bacteriology 183, 2881-2887.
Aguzzi, A., Baumann, F., and Bremer, J. (2008). The prion's elusive reason for being. Annual review
of neuroscience 31, 439-477.
Alberti, S., Halfmann, R., King, O., Kapila, A., and Lindquist, S. (2009). A systematic survey identifies
prions and illuminates sequence features of prionogenic proteins. Cell 137, 146-158.
Alexandrov, I.M., Vishnevskaya, A.B., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2008). Appearance
and propagation of polyglutamine-based amyloids in yeast: tyrosine residues enable polymer
fragmentation. J Biol Chem 283, 15185-15192.
Avery, S.V. (2006). Microbial cell individuality and the underlying sources of heterogeneity. Nature
reviews 4, 577-587.
Balch, W.E., Morimoto, R.I., Dillin, A., and Kelly, J.W. (2008). Adapting proteostasis for disease
intervention. Science 319, 916-919.
Bossdorf, O., Richards, C.L., and Pigliucci, M. (2008). Epigenetics for ecologists. Ecol Lett 11, 106115.
Brachmann, A., Baxa, U., and Wickner, R.B. (2005). Prion generation in vitro: amyloid of Ure2p is
infectious. Embo J 24, 3082-3092.
Brachmann, A., Toombs, J.A., and Ross, E.D. (2006). Reporter assay systems for [URE3] detection
and analysis. Methods (San Diego, Calif 39, 35-42.
Bradley, M.E., Edskes, H.K., Hong, J.Y., Wickner, R.B., and Liebman, S.W. (2002). Interactions among
prions and prion "strains" in yeast. Proc Natl Acad Sci U S A 99 Suppl 4, 16392-16399.
Brown, J.C., and Lindquist, S. (2009). A heritable switch in carbon source utilization driven by an
unusual yeast prion. Genes Dev 23, 2320-2332.
Chernoff, Y.O. (2007). Stress and prions: lessons from the yeast model. FEBS Lett 581, 3695-3701.
Chernoff, Y.O., Galkin, A.P., Lewitin, E., Chernova, T.A., Newnam, G.P., and Belenkiy, S.M. (2000).
Evolutionary conservation of prion-forming abilities of the yeast Sup35 protein. Mol Microbiol 35,
865-876.
19
Chiti, F., and Dobson, C.M. (2006). Protein misfolding, functional amyloid, and human disease. Annu
Rev Biochem 75, 333-366.
Cox, B.S., Tuite, M.F., and Mundy, C.J. (1980). Reversion from suppression to nonsuppression in
SUQ5 [psi+] strains of yeast: the classificaion of mutations. Genetics 95, 589-609.
Derkatch, I.L., Bradley, M.E., Masse, S.V., Zadorsky, S.P., Polozkov, G.V., Inge-Vechtomov, S.G., and
Liebman, S.W. (2000). Dependence and independence of [PSI(+)] and [PIN(+)]: a two-prion system
in yeast? Embo J 19, 1942-1952.
Du, Z., Park, K.W., Yu, H., Fan, Q., and Li, L. (2008). Newly identified prion linked to the chromatinremodeling factor Swi1 in Saccharomyces cerevisiae. Nat Genet 40, 460-465.
Eaglestone, S.S., Cox, B.S., and Tuite, M.F. (1999). Translation termination efficiency can be
regulated in Saccharomyces cerevisiae by environmental stress through a prion-mediated
mechanism. Embo J 18, 1974-1981.
Edskes, H.K., Naglieri, B.M., and Wickner, R.B. (2006). Nitrogen source and the retrograde signalling
pathway affect detection, not generation, of the [URE3] prion. Yeast (Chichester, England) 23, 833840.
Fernandez-Bellot, E., Guillemet, E., and Cullin, C. (2000). The yeast prion [URE3] can be greatly
induced by a functional mutated URE2 allele. The EMBO journal 19, 3215-3222.
Giacomelli, M.G., Hancock, A.S., and Masel, J. (2007). The conversion of 3' UTRs into coding regions.
Mol Biol Evol 24, 457-464.
Glover, J.R., Kowal, A.S., Schirmer, E.C., Patino, M.M., Liu, J.J., and Lindquist, S. (1997). Self-seeded
fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S.
cerevisiae. Cell 89, 811-819.
Green, S.R., and Johnson, A.D. (2004). Promoter-dependent roles for the Srb10 cyclin-dependent
kinase and the Hda1 deacetylase in Tup1-mediated repression in Saccharomyces cerevisiae.
Molecular biology of the cell 15, 4191-4202.
Grishin, A.V., Rothenberg, M., Downs, M.A., and Blumer, K.J. (1998). Mot3, a Zn finger transcription
factor that modulates gene expression and attenuates mating pheromone signaling in
Saccharomyces cerevisiae. Genetics 149, 879-892.
Griswold, C.K., and Masel, J. (2009). Complex adaptations can drive the evolution of the capacitor
[PSI], even with realistic rates of yeast sex. PLoS Genet 5, e1000517.
Harrison, P.M., and Gerstein, M. (2003). A method to assess compositional bias in biological
sequences and its application to prion-like glutamine/asparagine-rich domains in eukaryotic
proteomes. Genome Biol 4, R40.
Hogan, D.J., Riordan, D.P., Gerber, A.P., Herschlag, D., and Brown, P.O. (2008). Diverse RNA-binding
proteins interact with functionally related sets of RNAs, suggesting an extensive regulatory system.
PLoS biology 6, e255.
Kodali, R., and Wetzel, R. (2007). Polymorphism in the intermediates and products of amyloid
assembly. Curr Opin Struct Biol 17, 48-57.
Kushnirov, V.V., Kochneva-Pervukhova, N.V., Chechenova, M.B., Frolova, N.S., and Ter-Avanesyan,
M.D. (2000). Prion properties of the Sup35 protein of yeast Pichia methanolica. The EMBO journal
19, 324-331.
Kussell, E., Kishony, R., Balaban, N.Q., and Leibler, S. (2005). Bacterial persistence: a model of
survival in changing environments. Genetics 169, 1807-1814.
Lancaster, A.K., Bardill, J.P., True, H.L., and Masel, J. (2009). The Spontaneous Appearance Rate of
the Yeast Prion [PSI+] and Its Implications For the Evolution of the Evolvability Properties of the
[PSI+] System. Genetics, DOI: 10.1534/genetics.1109.110213 (http://www.genetics.org).
Liebman, S.W., and Sherman, F. (1979). Extrachromosomal psi+ determinant suppresses nonsense
mutations in yeast. J Bacteriol 139, 1068-1071.
Liu, J.J., and Lindquist, S. (1999). Oligopeptide-repeat expansions modulate 'protein-only'
inheritance in yeast. Nature 400, 573-576.
20
Masel, J., and Siegal, M.L. (2009). Robustness: mechanisms and consequences. Trends Genet 25,
395-403.
Mathur, V., Hong, J.Y., and Liebman, S.W. (2009). Ssa1 overexpression and [PIN(+)] variants cure
[PSI(+)] by dilution of aggregates. Journal of molecular biology 390, 155-167.
Morimoto, R.I. (2008). Proteotoxic stress and inducible chaperone networks in neurodegenerative
disease and aging. Genes & development 22, 1427-1438.
Nakayashiki, T., Ebihara, K., Bannai, H., and Nakamura, Y. (2001). Yeast [PSI+] "prions" that are
crosstransmissible and susceptible beyond a species barrier through a quasi-prion state. Molecular
cell 7, 1121-1130.
Namy, O., Galopier, A., Martini, C., Matsufuji, S., Fabret, C., and Rousset, J.P. (2008a). Epigenetic
control of polyamines by the prion [PSI(+)]. Nat Cell Biol.
Namy, O., Galopier, A., Martini, C., Matsufuji, S., Fabret, C., and Rousset, J.P. (2008b). Epigenetic
control of polyamines by the prion [PSI+]. Nat Cell Biol 10, 1069-1075.
Nemecek, J., Nakayashiki, T., and Wickner, R.B. (2009). A prion of yeast metacaspase homolog
(Mca1p) detected by a genetic screen. Proceedings of the National Academy of Sciences of the
United States of America 106, 1892-1896.
Osherovich, L.Z., and Weissman, J.S. (2001). Multiple Gln/Asn-rich prion domains confer
susceptibility to induction of the yeast [PSI(+)] prion. Cell 106, 183-194.
Patel, B.K., Gavin-Smyth, J., and Liebman, S.W. (2009). The yeast global transcriptional co-repressor
protein Cyc8 can propagate as a prion. Nature cell biology 11, 344-349.
Patino, M.M., Liu, J.J., Glover, J.R., and Lindquist, S. (1996). Support for the prion hypothesis for
inheritance of a phenotypic trait in yeast. Science 273, 622-626.
Pedersen, J.S., and Otzen, D.E. (2008). Amyloid-a state in many guises: survival of the fittest fibril
fold. Protein Sci 17, 2-10.
Pigliucci, M. (2008). Is evolvability evolvable? Nat Rev Genet 9, 75-82.
Santoso, A., Chien, P., Osherovich, L.Z., and Weissman, J.S. (2000). Molecular basis of a yeast prion
species barrier. Cell 100, 277-288.
Schwimmer, C., and Masison, D.C. (2002). Antagonistic interactions between yeast [PSI(+)] and
[URE3] prions and curing of [URE3] by Hsp70 protein chaperone Ssa1p but not by Ssa2p. Molecular
and cellular biology 22, 3590-3598.
Seger, J., and Brockmann, H.J. (1987). What is bet-hedging? Oxford Surv Evol Biol 4, 192-211.
Senechal, P., Arseneault, G., Leroux, A., Lindquist, S., and Rokeach, L.A. (2009). The
Schizosaccharomyces pombe Hsp104 disaggregase is unable to propagate the [PSI] prion. PLoS One
4, e6939.
Serio, T.R., Cashikar, A.G., Kowal, A.S., Sawicki, G.J., Moslehi, J.J., Serpell, L., Arnsdorf, M.F., and
Lindquist, S.L. (2000). Nucleated conformational conversion and the replication of conformational
information by a prion determinant. Science (New York, NY 289, 1317-1321.
Shorter, J., and Lindquist, S. (2005). Prions as adaptive conduits of memory and inheritance. Nat Rev
Genet 6, 435-450.
Shorter, J., and Lindquist, S. (2008). Hsp104, Hsp70 and Hsp40 interplay regulates formation,
growth and elimination of Sup35 prions. The EMBO journal 27, 2712-2724.
Si, K., Lindquist, S., and Kandel, E.R. (2003). A neuronal isoform of the aplysia CPEB has prion-like
properties. Cell 115, 879-891.
Smukalla, S., Caldara, M., Pochet, N., Beauvais, A., Guadagnini, S., Yan, C., Vinces, M.D., Jansen, A.,
Prevost, M.C., Latge, J.P., et al. (2008). FLO1 is a variable green beard gene that drives biofilm-like
cooperation in budding yeast. Cell 135, 726-737.
Stern, D.L., and Orgogozo, V. (2009). Is genetic evolution predictable? Science 323, 746-751.
Sweeny, E.A., and Shorter, J. (2008). Prion proteostasis: Hsp104 meets its supporting cast. Prion 2,
135-140.
21
Taneja, V., Maddelein, M.L., Talarek, N., Saupe, S.J., and Liebman, S.W. (2007). A non-Q/N-rich prion
domain of a foreign prion, [Het-s], can propagate as a prion in yeast. Molecular cell 27, 67-77.
Tank, E.M., Harris, D.A., Desai, A.A., and True, H.L. (2007). Prion protein repeat expansion results in
increased aggregation and reveals phenotypic variability. Molecular and cellular biology 27, 54455455.
Tessier, P.M., and Lindquist, S. (2009). Unraveling infectious structures, strain variants and species
barriers for the yeast prion [PSI+]. Nat Struct Mol Biol 16, 598-605.
True, H.L., Berlin, I., and Lindquist, S.L. (2004). Epigenetic regulation of translation reveals hidden
genetic variation to produce complex traits. Nature 431, 184-187.
True, H.L., and Lindquist, S.L. (2000). A yeast prion provides a mechanism for genetic variation and
phenotypic diversity. Nature 407, 477-483.
Tyedmers, J., Madariaga, M.L., and Lindquist, S. (2008). Prion switching in response to
environmental stress. PLoS biology 6, e294.
Verstrepen, K.J., and Fink, G.R. (2009). Genetic and epigenetic mechanisms underlying cell-surface
variability in protozoa and fungi. Annu Rev Genet 43, 1-24.
Wickner, R.B., Edskes, H.K., Shewmaker, F., and Nakayashiki, T. (2007a). Prions of fungi: inherited
structures and biological roles. Nature reviews 5, 611-618.
Wickner, R.B., Edskes, H.K., Shewmaker, F., Nakayashiki, T., Engel, A., McCann, L., and Kryndushkin,
D. (2007b). Yeast prions: evolution of the prion concept. Prion 1, 94-100.
Wilson, M.A., Meaux, S., Parker, R., and van Hoof, A. (2005). Genetic interactions between [PSI+] and
nonstop mRNA decay affect phenotypic variation. Proc Natl Acad Sci U S A 102, 10244-10249.
Zenthon, J.F., Ness, F., Cox, B., and Tuite, M.F. (2006). The [PSI+] prion of Saccharomyces cerevisiae
can be propagated by an Hsp104 orthologue from Candida albicans. Eukaryot Cell 5, 217-225.
22
Figure 1: Prions as self-templating aggregates
(a) Prions of S. cerevisiae cause heritable changes in phenotype. In this particular genetic background,
the prion [PSI+] can be observed by white coloration and adenine prototrophy due to translational
readthrough of a nonsense mutation in the ADE1 gene. However, the cryptic genetic variation that
can be revealed by [PSI+] is inherently polymorphic resulting in a wide variety of strain-specific [PSI+]
phenotypes (True et al., 2004).
(b) Prion phenotypes are generally caused by a reduction of the prion protein’s normal cellular activity.
In vivo, the aggregation and partial loss-of-function of the prion protein , can be observed by the
presence of Sup35-GFP foci in [PSI+] cells. These foci are composed of self-templating prion
aggregates that are cytoplasmically transmitted during cell division.
(c) Nucleated aggregation of a prion protein. Purified prion protein populates a soluble state for an
extended period of time, then polymerizes exponentially after the appearance of amyloid nuclei (blue
trace). The lag phase can be eliminated by the addition of small quantities of preformed aggregates
(red trace), demonstrating the biochemical property underlying the self-propagating prion state
(Serio et al., 2000).
(d) The self-propagating prion conformation is amyloid-like, as seen by the highly ordered, fibrillar
appearance of prion domain aggregates visualized by transmission electron microscopy. Amyloid is a
one-dimensional protein polymer. Its free ends template a protein folding reaction that incorporate
new subunits while regenerating the active template with each addition.
23
24
Figure 2: Conformational and temporal diversity of prion states
(a) Prions create multiple stable phenotypic states, or “strains”. [PSI+] strains differ by their levels of
nonsense suppression, with stronger strains having less functional Sup35 available to fulfill its role in
translation termination, giving rise to a whiter coloration in a particular genetic background (top). At
the molecular level, strains are determined by amyloid conformational variants (bottom) that arise
during nucleation but then stably propagate themselves.
(b) Along with the conformational diversity apparent in the end products of amyloid formation, multiple
conformational variants are also transiently populated during the early stages of amyloid assembly,
and may constitute integral on-pathway species (Chiti and Dobson, 2006). These oligomeric
intermediates likely have limited self-templating capacity, but nevertheless may contribute to the
weak phenotypes associated with incipient prion states.
(c) Incipient prion states acquire progressively stronger phenotypes and stabilities, possibly via massaction population dynamics of prion particles. A number of elegant studies have correlated the
phenotypic strength of the prion state with the intracellular number of prion particles (Cox et al.,
2003; Tanaka et al., 2006). Upon de novo nucleation within a prion-free cell, prion polymerization
onto limiting fiber ends proceeds during the “maturation” phase under pre-steady state conditions.
Upon each cell division, prion particles are distributed passively and asymmetrically to daughter cells
(Cox et al., 1980). Progeny that inherit more particles will have faster total prion polymerization
rates and correspondingly stronger phenotypes, and will tend to accumulate more prion particles
that will in turn strengthen the prion phenotype in subsequent generations (light pink and white
cells). Conversely, cells that inherit fewer particles will have slower polymerization rates and weaker
phenotypes (red and pink prion-containing cells), and themselves will tend to accumulate fewer
particles to pass on to their progeny. Such noise in prion distribution may allow prions to stratify
protein functionality along a continuum of semi-stable phenotypes (e.g. red cells, pink cells, and
white cells) within a small number of cell generations.
25
26
Table 1: Known and candidate prions
27
28
Chapter Two
A Systematic Survey Identifies Prions and
Illuminates Sequence Features of Prionogenic
Proteins
This chapter was published previously: Alberti, S.*, Halfmann, R.*, King, O., Kapila, A., and
Lindquist, S. (2009). Cell 137(1), 136-158
*equal authorship
29
ABSTRACT
The prion hypothesis posits that biological information can be replicated solely through self-
propagating conformations of proteins. Though it was initially conceived to explain baffling
neurodegenerative diseases in mammals (Griffith, 1967; Prusiner, 1982), it has since grown to
encompass a number of non-Mendelian traits in fungi (Ross et al., 2005b; Shorter and Lindquist,
2005; Shkundina and Ter-Avanesyan, 2007). All known prions, except for the initially discovered
disease-causing prion PrP, are benign, and in some cases can confer selectable advantages (Saupe et
al., 2000; True and Lindquist, 2000; True et al., 2004). The self-templating property of prions makes
them both conformationally and epigenetically dominant, and positions prion-forming proteins as
metastable cellular switches of protein function.
INTRODUCTION
The realization that protein conformational switches could provide a means for inheritance
of phenotypes dates back 15 years (Wickner, 1994), yet only a few proteins with this capacity have
been discovered (Shorter and Lindquist, 2005; Du et al., 2008). Most of these have been found in
the yeast S. cerevisiae, with the [PSI+] element being the best understood.
[PSI+] is caused by an amyloid-like aggregated state of the translation-termination factor
Sup35p. In the prion state, the majority of Sup35p molecules are inactive, resulting in increased
levels of nonsense suppression (Liebman and Sherman, 1979; Patino et al., 1996) and programmed
frameshifting (Namy et al., 2008a). This gives rise to RNA stability changes and functionally altered
polypeptides and consequently to phenotypes that can be advantageous under diverse conditions
(Eaglestone et al., 1999; True et al., 2004). Remarkably, the ability of Sup35p to switch into a prion
conformation, and the regulation of that switch by the protein remodeling factor Hsp104p, have
been conserved for over 800 million years of fungal evolution (Chernoff et al., 2000; Zenthon et al.,
2006).
Three other amyloid-based prions, formed by the functionally diverse proteins Ure2p,
Rnq1p, and Swi1p, have been described in S. cerevisiae. Ure2p regulates nitrogen catabolism; its
prion state, [URE3], attenuates this activity resulting in the constitutive utilization of poor nitrogen
sources (Aigle and Lacroute, 1975; Wickner, 1994). The Rnq1p protein in its prion state, [RNQ+]
(also called [PIN+]), enhances the inducibility of other prions (Derkatch et al., 2000; Bradley et al.,
2002). [SWI+], the most recently discovered prion, is caused by an inactive state of the chromatin
remodeling factor Swi1p (Du et al., 2008). Intriguingly, [SWI+] represents the first established link
between chromatin-based and prion-based epigenetics, although a biological relevance of this
30
connection remains to be elucidated. Indeed, for all of these prion proteins, the putative
functionality of their prion forms is highly debated (Nakayashiki et al., 2005).
The conformational duality of amyloid-based prions resides in structurally independent
prion-forming domains (PrDs) (Edskes et al., 1999; Li and Lindquist, 2000; Santoso et al., 2000;
Sondheimer and Lindquist, 2000). These PrDs are modular and can be transferred to other proteins
to create novel prions (Li and Lindquist, 2000). They have a very unusual amino acid composition:
enriched for polar residues such as glutamine (Q) and asparagine (N) and depleted of hydrophobic
and charged residues. This composition promotes a disordered molten-globule-like conformational
ensemble, within which amyloid-nucleating contacts can be made (Serio et al., 2000; Wang et al.,
2006; Mukhopadhyay et al., 2007).
The ability of prions to propagate is afforded by the inherent and extremely efficient self-
templating capacity of amyloid, a highly ordered β-sheet-rich protein aggregate. The amyloid-like
prion state nucleates in cells at a low frequency de novo, but once formed, efficiently propagates this
change to soluble conformers (Patino et al., 1996; Glover et al., 1997). Prion domains also form self-
propagating amyloid in vitro under physiological conditions (Glover et al., 1997; Taylor et al., 1999),
and remarkably, the resulting fibers alone can transform cells to the corresponding prion state
(Sparrer et al., 2000; Maddelein et al., 2002; Brachmann et al., 2005; Patel and Liebman, 2007),
firmly establishing the protein-only nature of prion inheritance.
However, the relationship between amyloid polymerization and prion propagation is still
poorly understood. In fact, most known amyloid-forming proteins are not prions, and even
amyloids of prion proteins are not always transmissible (Diaz-Avalos et al., 2005; Salnikova et al.,
2005; Baskakov and Breydo, 2007; Sabate et al., 2007). While specific sequence elements ultimately
determine the intrinsic amyloidogenic properties of polypeptides (Liu and Lindquist, 1999; Lopez
de la Paz and Serrano, 2004; Alexandrov et al., 2008), there are multiple trans-acting factors within
the cell, including molecular chaperones, the cytoskeletal machinery, and nucleating factors such as
[PIN+], that interact with amyloid prions at every stage of propagation (Chernoff, 2007; Perrett and
Jones, 2008). These observations, and our lack of knowledge of the pervasiveness of amyloid-based
biological phenomena, create a need to elucidate the amyloid-prion relationship on a
comprehensive, genome-wide level.
Such a genome-wide analysis could also reveal new prion-based phenotypes, which would
support the idea that prion-mediated phenotypic variation is functionally significant. Prion-like
Q/N-rich proteins are abundant in the proteomes of lower eukaryotes, with 100 to 170 such
sequences in S. cerevisiae (Michelitsch and Weissman, 2000; Harrison and Gerstein, 2003).
31
However, the experimental tools needed to determine the prion properties of these proteins in a
systematic manner have been lacking. Consequently, other than the four aforementioned prions,
only one additional yeast protein, New1p, has been shown to harbor a domain capable of forming a
prion, albeit in an artificial context (Osherovich and Weissman, 2001).
We bioinformatically scanned the yeast genome for proteins with prion-like character. We
then subjected the highest-scoring candidates to genetic, cell biological, and biochemical assays to
discern their prion-forming capacity, ultimately determining that at least 24 yeast proteins contain
a prion-forming domain. We further evaluated one of these, Mot3p, confirming that it is a bona fide
prion with a phenotype that is likely to be advantageous under certain environmental conditions.
RESULTS
A bioinformatics screen reveals multiple prion candidates in yeast
We developed a hidden Markov Model (HMM)-based approach for predicting prions, using
the experimentally determined prion domains (PrDs) of Sup35p, Ure2p and Rnq1p, and the prion
candidate New1p as positive training examples (at the time, Swi1p had not yet been shown to be a
prion). We did not incorporate the other known fungal prion protein, HET-s, nor the mammalian
prion protein, PrP, into our model because these proteins have unique sequences that are dissimilar
in amino acid composition from the other prion proteins and thus would decrease the predictive
power of the model. We acknowledge that our approach is thus necessarily biased towards a
particular class of prions, but is nevertheless merited by the large number of Q/N-rich yeast
proteins with unknown prion potential. All yeast protein sequences were parsed into prion-like
regions and non-prion (background) regions. Proteins with prion-like regions at least 60 amino
acids long (denoted “cores”) were considered to be prion candidates, based on the lower size limit
of previously characterized yeast prion domains (Masison and Wickner, 1995; King and Diaz-
Avalos, 2004). These proteins were then ranked by their core scores. Figure 1A shows an example
of the output format of our prediction for the PrD of Sup35p.
Our query revealed ~ 200 proteins that have candidate PrDs (cPrDs) in the S. cerevisiae
genome (see Table S1 for the complete set of predictions). The list of candidate prions includes
Sup35p and Rnq1p as well as the prion candidate New1p in the group of the top 20 candidates.
Although the recently discovered Swi1p prion (Du et al., 2008) was not used for training of the
algorithm, it ranks at position 21, indicating that our prediction is a valuable tool to uncover new
32
prions. To evaluate these candidates, we tested the amyloid and prion-forming properties of the
100 highest-scoring cPrDs (Figure 1).
Many cPrDs form foci in the cytosol
As a first step to experimentally characterize the cPrDs, we investigated their propensity to
form foci in living yeast cells by transiently expressing them as chimeras with yellow fluorescent
protein (cPrD-EYFP). Several studies have described two morphologically distinct forms of protein
aggregation in the yeast cytosol (Derkatch et al., 2001; Ganusova et al., 2006; Taneja et al., 2007).
One of these structures has a ring- or ribbon-like appearance and is localized around the vacuole
and/or adjacent to the plasma membrane, whereas the other is more punctate and preferentially
resides close to the vacuole. We performed pilot experiments with known prions and
amyloidogenic proteins to gain a better understanding of the aggregation structures that can be
visualized by fluorescence microscopy. We transiently expressed these proteins as EYFP fusions
using a galactose-regulatable promoter (Figure 2A). The PrDs of Sup35p and Ure2p proceeded
through a characteristic maturation pathway that included an early stage with ribbon-like
aggregation patterns and a later stage with puncta (Tyedmers and Lindquist, manuscript in
preparation; Derkatch et al., 2001; Ganusova et al., 2006). In contrast, the PrD of Rnq1p and an
expanded Q-rich region of the huntingtin protein almost exclusively formed puncta, when
expressed from the same promoter.
We transiently expressed the cPrD-EYFP fusions in yeast cells using a galactose-regulatable
plasmid. Despite the intrinsically unfolded nature of the cPrDs, the expression levels of most of the
fusions were robust, with a few outliers that expressed at only low levels (Figure S1). A large
fraction (69%) of the cPrD-EYFP fusions formed fluorescent foci (Figure 2B and S2). The proteins
produced a surprising diversity of patterns with a large variety of ribbon-like structures and
punctate foci. Overall, punctate patterns were much more abundant than ribbon structures and
ranged from one large focus to multiple small foci distributed all over the cytoplasm. Since foci
formation is also a feature of many non-prion proteins, we conducted additional experiments to
assess the biochemical properties of the cPrDs.
Multiple cPrDs form highly stable aggregates
Protein aggregates can differ substantially in terms of detergent stability and can adopt
either highly ordered (amyloid fibril) or disordered (amorphous) superstructures. To determine
whether the cPrDs formed aggregates, and if so, whether they formed prion-like structures, we
33
used semi-denaturing detergent-agarose gel electrophoresis (SDD-AGE). SDD-AGE allows for the
resolution of a wide size-range of SDS-resistant (amyloid-like) aggregates, ranging from oligomeric
species to polymers assembled from hundreds of individual polypeptides (Bagriantsev et al., 2006;
Halfmann and Lindquist, 2008).
Lysates from cells expressing cPrD-EYFP chimeras were analyzed by SDD-AGE after 24
hours of expression (Figure 2C). Remarkably, about one third of the cPrD-EYFP fusions had the
SDS-resistance properties of known amyloidogenic proteins (the N and NM domains of Sup35p and
the 72Q and 103Q fragments of huntingtin), including all four experimentally verified prions and
the prion candidate New1p.
Since amyloid formation is time- and concentration-dependent, we increased the time of
transient expression to 48 hours. Despite only modest increases in the cellular levels of the cPrDs
(~ 2-3 fold), additional proteins became SDS-resistant, now including almost half the set of
investigated cPrDs, with an enrichment for those that scored highly in our algorithm. The ratio of
aggregated to soluble protein differed in a time-dependent manner for each candidate and was
strongly reproducible. Some cPrD-EYFP fusions were completely aggregated after 24 hours,
whereas others initially exhibited a small fraction of aggregated protein that increased after 48
hours of expression (see Table S2 for a classification). In addition, we observed substantial
variation in the range of particle sizes, and again these were reproducible for individual cPrDs.
Multiple cPrDs form amyloid in vitro
Purified PrDs of known prions form amyloid in vitro. To assess amyloid propensities of our
candidate prion domains in the absence of cellular factors, we purified bacterially expressed cPrDs
under denaturing conditions, and then analyzed amyloid formation following dilution into a
physiological buffer containing thioflavin-T (ThT). ThT is a dye that does not interfere with amyloid
assembly, but changes its fluorescence properties upon amyloid binding (LeVine, 1993, 1997).
Overall, the cPrDs displayed tremendous diversity in amyloid propensities (Figure 3). Many,
including the four known prions, largely completed amyloid formation within 12 hours. Others did
not acquire ThT fluorescence until well over 24 hours after dilution from denaturant (e.g. Pan1p
and Yap1801p). Most positive samples initially had very little fluorescence, consistent with
nucleated polymerization that is a hallmark of amyloid assembly. Finally, roughly half of the
proteins were unable to nucleate within the time-frame examined.
PrDs can follow both amyloid and non-amyloid aggregation pathways (Liu et al., 2002;
Vitrenko et al., 2007; Douglas et al., 2008), and some non-amyloid β-sheet structures can alter ThT
34
fluorescence (LeVine, 1993). As an additional characterization, we therefore assayed the SDS-
resistance of samples after 72 hours using a filter retardation assay (Scherzinger et al., 1999). In
this assay, a non-binding membrane is used to detect protein aggregates, which, due to their size,
are specifically retained on the membrane surface. Treating the impeded aggregates with SDS then
distinguishes amyloid from non-amyloid, since non-amyloid aggregates become solubilized and
flow through.
We found remarkable agreement between the ThT and filter retardation amyloid assays
(Figure 3). Acquisition of moderate to strong ThT fluorescence (>100 AFU) coincided with SDS-
stable aggregation in every case. Several cPrDs (e.g. those of Snf5p and Nab3p) formed aggregates
that were retained by the filter in non-denaturing conditions (0.1% Tween 20) but were eliminated
by SDS. Interestingly, this type of aggregate was only observed when ThT fluorescence was absent
or greatly delayed, and only with proteins that were more enriched for glutamines than
asparagines. In total, the amyloid propensities of isolated cPrDs were in good agreement with the
aggregation of these cPrDs in vivo (see Figure S3 and Table S2 for a comparison).
A Sup35p-based prion assay identifies phenotypic switching behavior
To determine whether the cPrDs can confer a heritable switch in the function of the protein
to which they are attached, we employed an assay based on the well-characterized prion
phenotypes of the translation termination factor Sup35p. The Sup35p protein consists of an N-
terminal PrD (N), a highly charged middle domain (M) and C-terminal domain (C), which provides
the translation termination function. The PrDs of Sup35p and other prions are modular and can be
transferred to non-prion proteins, thereby creating new protein-based elements of inheritance (Li
and Lindquist, 2000). This property allowed us to generate cPrD-SUP35C chimeras (under the
control of the constitutive ADH1 promoter) that could be tested for their ability to generate [PSI+]-
like states, as previously reported for Rnq1p and New1p (Sondheimer and Lindquist, 2000;
Osherovich and Weissman, 2001).
Because Sup35p is an essential protein, we first generated a strain in which a deletion of the
chromosomal SUP35 was covered by a Sup35p-expressing plasmid (Figure S4). When these cells
were transformed with cPrD-SUP35C expression plasmids, a URA3 marker on the covering SUP35
plasmid allowed it to be selected against in 5-FOA-containing medium (plasmid shuffle). The
resulting strains contained cPrD-Sup35C fusions as their only source of functional Sup35p. Each
was tested for the ability to form a heritable [PSI+] state, using an ADE1 allele with a premature
stop codon. Read-through of this allele in [PSI+] cells creates two easily monitored phenotypes, the
35
ability to growth on adenine-deficient medium, and on complete medium, a white colony color, due
to the restoration of the adenine biosynthesis pathway, which prevents accumulation of the red
byproduct in [psi-] cells.
We obtained 90 viable cPrD-SUP35C strains upon loss of the covering SUP35 plasmid (see
Figures S5, S6 and S7 and Supplemental Discussion). Interestingly, several strains spontaneously
switched to a white colony color at a high frequency (e.g. New1p, Lsm4p and Nrp1p in Figure S5).
Switching rates of prions can be as low as 10-6 to 10-7 (Lund and Cox, 1981; Liu and Lindquist, 1999;
Tuite and Cox, 2003). Therefore, in cases where spontaneous switching was not observed, we took
advantage of a characteristic of all known prions to induce switching: increased expression of the
PrD increases the likelihood of conformational conversion to the prion state. Therefore, we
introduced an additional plasmid with a cPrD-EYFP fusion under the control of a galactose-
inducible promoter. We identified 22 cPrD-SUP35C strains that showed increased growth on
adenine-deficient medium after transient expression of cPrD-EYFP (Figure 4 and S8, see Table S2
for a list of positive cPrDs).
A hallmark of prion proteins is that once the conformational conversion has occurred it is
self-sustaining. Thus, transient over-expression of the protein is sufficient to induce a heritable
change in phenotype. We tested the ability of the Ade+ colonies to maintain that state on nonselective medium after loss of the overexpression plasmid. Indeed, on complete medium all of the
22 cPrD-SUP35C strains displayed a colony color change from red to white or pink that was
maintained over several rounds of re-streaking (Figure S9).
Sequence features that drive prionogenesis – asparagines vs. glutamines
To gain a better understanding of PrD-mediated prion formation, we compared the
sequences of the cPrDs that scored positive in each of our assays with those that scored negative
(Table S5 and Figure S11). Aggregation prone cPrDs were strongly enriched for asparagines,
whereas glutamines, charged residues and prolines were more abundant in non-aggregating cPrDs.
This difference was observed in all four assays: foci-formation, SDD-AGE, in vitro amyloid
formation, and cPrD-SUP35C switching. The striking difference in the distribution of Qs and Ns was
unexpected, as these have largely been considered to be functionally equivalent drivers of
prionogenesis (Michelitsch and Weissman, 2000).
Our analysis on these prionogenic sequences also shows that the spacing of “amyloid
breaking” prolines and charges (Lopez de la Paz and Serrano, 2004) is an important contribution to
prion formation (Figure S11). Other studies have argued that prionogenesis is independent of the
36
polypeptide sequence, provided that amino acid composition is unchanged (Ross et al., 2004; Ross
et al., 2005a). Our findings call for a reinterpretation of this conclusion. Together, the composition
and sequence biases we have delineated will strongly improve future predictions of amyloid and
prion proteins.
Phenotype switches involve an Hsp104p-dependent conformational change
We used SDD-AGE analysis to examine cell lysates of prion-positive and prion-negative
strains for changes in the aggregation state of the cPrD-Sup35C fusions (Figure 5A and S10A). In
accordance with standard nomenclature, these are hereafter designated [PrD-C+] and [prd-c-], with
brackets designating the non-Mendelian character of prion inheritance and capital letters signifying
genetic dominance of the trait. All 22 fusions showed a high amount of SDS-resistant aggregation in
the [PrD-C+] strains, whereas aggregation was lower or not detectable in the [prd-c-] strains.
All known fungal prions are dependent on chaperones to induce and maintain a prion state.
Prions vary in their dependence on different classes of chaperones, but all amyloid-based fungal
prions are critically dependent on the protein remodeling factor Hsp104p. Therefore, yeast cells
can be cured of prions by genetic manipulations that ablate HSP104 gene function or chemical
inhibition of Hsp104p activity (Shkundina and Ter-Avanesyan, 2007). Indeed, passaging of the
[PrD-C+] strains on plates containing 5 mM of the Hsp104p inhibitor guanidine hydrochloride
(GdnHCl) eliminated the prion in all but one case, New1p (Figure 5B and S10B and Supplemental
Discussion).
The prion state of the Rnq1p protein enhances the induction of other yeast prions, most
likely by providing an imperfect template on which other aggregation-prone proteins can nucleate
(Salnikova et al., 2005). We investigated the role of Rnq1p in prion induction by applying our
Sup35p-based system in strains cured of [RNQ+] and in strains carrying a deletion of the gene
encoding Rnq1p. In all 10 cases examined (data not shown) we observed a strong reduction in the
number of Ade+ colonies, indicating that the de novo formation of [PrD-C+] strains requires the
presence of the [RNQ+] prion.
The prion state is transferable to the endogenous protein
To investigate whether the [PrD-C+] states can propagate to the corresponding endogenous
protein, we inserted a C-terminal tag at the chromosomal genetic locus. We limited our analysis to
the subset of 9 candidates that tolerated C-terminal tagging and whose PrDs were N-terminal or
internal. The cell lysates of the resulting [prd-c-] and [PrD-C+] strains were analyzed by SDD-AGE
37
and probed for both the endogenously tagged and chimeric versions of each protein. We detected
simultaneous aggregation of cPrD-Sup35C chimeras and the corresponding endogenous proteins in
all cases (Figure 5C). The fact that we observed co-aggregation strongly supports the modularity
concept of PrDs and the sequence-specific templating of prions. These observations suggest that the
endogenous proteins can switch to a prion state, with phenotypic consequences that could impact
the survival and adaptation of yeast cells.
[MOT3+], a newly discovered prion conferred by Mot3p
Preliminary studies of the refined list of 29 cPrDs (candidates highlighted in red in Table
S2) indicated that several of the full-length candidate prion proteins are capable of self-sustained
prion aggregation (data not shown). To rigorously establish that one of these candidates operates
as a prion in a physiologically relevant manner, we focused on one, Mot3p, for which robust prion-
selective assays could be readily predicted. Mot3p is a globally acting transcription factor that
modulates a variety of processes, including mating, carbon metabolism, and stress response
(Grishin et al., 1998).
Mot3p tightly represses anaerobic genes, including ANB1 and DAN1, during aerobic growth.
To facilitate analysis of Mot3 transcriptional activity, we created Mot3p-controlled auxotrophies by
replacing the ANB1 or DAN1 ORFs with URA3. The resulting strains normally could not grow
without supplemental uracil. URA3 expression, and uracil-free growth, should be restored upon
reduction of Mot3p activity, as with MOT3 deletion (Figure 6A) or, potentially, sequestration of
Mot3p by prion formation. We transiently overexpressed Mot3PrD-EYFP for 24 hours, via a
galactose-inducible promoter, and plated the cells onto glucose media lacking uracil. We found that
even this transient elevation of intracellular Mot3PrD levels increased the number of Ura+
dan1::URA3 cells by two to three orders of magnitude (Figure 6D). We observed similar results
using the anb1::URA3 reporter, and in both S288C and W303 strain backgrounds (data not shown).
The phenotype persisted even after the inducing plasmid had been lost (after multiple passages on
non-selective media; Figure 6B). As expected for a prion-based phenotype, uracil auxotrophy was
dominant in matings to ura- cells (data not shown). We then analyzed diploid ura- and Ura+
dan1::URA3 strains by SDD-AGE, taking advantage of a naturally occurring 6xHis motif in Mot3p
that allowed for its immunodetection. The Ura+ state, but not the ura- state, corresponded to the
presence of SDS-resistant aggregates of Mot3p (Figure 6C). We hereafter refer to this heritable state
of Mot3p as “[MOT3+]”, using standard prion nomenclature, to reflect its causal determinant.
38
The strongest evidence that a phenotype is prion-based is the ability to induce it in prion-
free cells by transformation with recombinant prion amyloid generated in vitro (Sparrer et al.,
2000; Maddelein et al., 2002; Brachmann et al., 2005; Patel and Liebman, 2007). We produced
Mot3PrD amyloid fibers from bacterially-expressed recombinant protein in vitro. These fibers
strongly stimulated amyloid assembly of soluble Mot3PrD protein in vitro (Figure 7A). In both the
W303 and S288C strain backgrounds, transformation with Mot3PrD fibers increased the frequency
of Ura+ colonies by ~50 fold relative to control transformations with soluble Mot3PrD (Figure 7B
and data not shown). These experiments prove not only that [MOT3+] is a protein-only heritable
phenotype, but also that intracellular Mot3p readily engages in self-perpetuating prion aggregation.
Does this newly identified prion share other characteristics with well-known yeast prions?
Well-characterized yeast prions rely, at least partially, on the presence of other prions like [RNQ+]
for their efficient appearance. We compared [MOT3+] induction by transient Mot3PrD-EYFP
expression in [RNQ+] and GdnHCl-treated, [rnq-] strains. Surprisingly, the appearance of Ura+
colonies was essentially unaffected by the prion status of Rnq1p (Figure 6F). The [RNQ+]independence of [MOT3+] is unique among characterized yeast prions and suggests that [MOT3+]
may appear frequently in diverse yeast strains. The ability of Mot3p to bypass a common regulatory
barrier to prion nucleation also indicates that [MOT3+] induction may have elevated sensitivity to
environmental stresses.
Amyloid-based yeast prions also rely on Hsp104p, the only known cellular factor capable of
shearing amyloid fibers, in order to propagate efficiently. We tested if inactivation of Hsp104p
eliminated [MOT3+], using GdnHCl treatment. We found that passaging otherwise stable [MOT3+]
strains on medium containing 5 mM GdnHCl restored them to the original [mot3-] state (Figure 6E).
We further confirmed that the Hsp104p-dependence of [MOT3+] was not unique to this particular
isolate, by assaying the de novo inducibility of [MOT3+] in the absence of HSP104. In these cells, the
appearance of Ura+ colonies was severely diminished (Figure 6D). This effect was observed both
for over expression-induced and spontaneously-appearing Ura+ colonies (the latter arise among
mock-induced cells after extended incubation times). These results indicate not only that [MOT3+],
like all other known yeast prions, critically requires Hsp104p-mediated fiber shearing for
inheritance, but also that [MOT3+] naturally appears at a detectable frequency.
Mot3p regulates a complex cell-wall remodeling program during adaptation to
anaerobiosis, through predominantly gene-repressive activities (Grishin et al., 1998; Abramova et
al., 2001; Hongay et al., 2002). We reasoned that a prion state of Mot3p would likely perturb this
activity, giving rise to cell wall-related [MOT3+] phenotypes. Accordingly, we treated [mot3-] and
39
[MOT3+] cells with the commonly used cell wall stressors, calcofluor white and congo red.
Hypersensitivity to these agents is indicative of cell wall defects (Ram et al., 1994; Mrsa et al.,
1999). We found that [MOT3+] isolates were relatively resistant to these agents (Figure 7C),
consistent with a modified cell wall resulting from derepression of Mot3p-repressed cell wall
proteins.
Do other candidates behave as prions? During the course of our studies, Du and coworkers
presented strong genetic evidence for Swi1p as a prion protein (Du et al., 2008). Swi1p was one of
eleven Q/N-rich proteins reported to allow for [PSI+]-induction when overexpressed (Derkatch et
al., 2001). We used the [PSI+] co-induction methodology (Du et al., 2008) to confirm these findings
for Swi1p. Previous studies speculated that the prion-like properties of Swi1p are based on amyloid
aggregation, but direct biochemical evidence had been lacking (Derkatch et al., 2001; Du et al.,
2008). We tested the physical status of the endogenous full-length Swi1 protein on SDD-AGE gels. It
formed SDS-resistant aggregates in [SWI+] cells but not in [swi-] cells (Figure 7D). Finally, we asked
if the [SWI+] state might have beneficial consequences under some circumstances by subjecting
cells to a condition previously shown to interact synthetically with mutations in SWI1 – exposure to
the microtubule-inhibiting fungicide benomyl (Hillenmeyer et al., 2008). Indeed, [SWI+] cells
exhibited strong resistance (Figure 7E).
DISCUSSION
We conducted the first comprehensive study of prion-like Q/N-rich domains in yeast, using
three different criteria to investigate their ability (1) to form amyloid in vivo under physiological
conditions; (2) to self-assemble in vitro in the absence of other factors; and (3) to replicate
indefinitely in cells as self-perpetuating epigenetic elements. We identified 24 protein domains that
satisfied the stringent third criterion for prion behavior. This group includes the known prions
Ure2p, Sup35p, Rnq1p, and Swi1p, the previously identified prion candidate New1p, and a
functionally diverse set of 19 new candidates.
All but one prion candidate (New1p, see Supplemental Discussion) were strictly dependent
on the protein remodeling factor Hsp104p. Interestingly, most proteins that satisfied the stringent
third criterion also passed criteria one and two (Figure S3), underscoring the importance of
amyloid’s distinctive self-templating properties for prion phenomena. In addition, the in vitro
aggregation results compare extremely well with the aggregation of these cPrDs in vivo, a
remarkable finding given the absence in vitro of the prion regulators [RNQ+] and Hsp104p. Q/Nrich sequences, despite having overtly similar amino acid compositions, have biochemical
40
differences that give rise to a range of amyloid propensities. These differences affect
amyloidogenesis intrinsically, rather than simply by controlling interactions with intracellular
prion-promoting factors. Thus, prion-forming proteins are predisposed to form amyloid even in the
absence of factors that govern prionogenesis in vivo. The implication is, then, that factors like
[RNQ+] and Hsp104p may have evolved, in part, to regulate the frequency of spontaneous prion
appearance and to promote the stable propagation of prions once they appear. The dependence of
prions on these factors as well as their interaction with other chaperones and stress proteins links
them intricately with cellular stress pathways (Chernoff, 2007; Shorter and Lindquist, 2008; Tuite
et al., 2008) and makes them likely to respond to environmental changes that create even minor
perturbances in protein homeostasis (Tyedmers et al., 2008).
Interestingly, the number of cPrDs forming fluorescent foci was higher than the number of
cPrDs forming SDS-resistant aggregates in vivo. This finding, in combination with our detection of
SDS-sensitive aggregates in vitro, indicates that some cPrDs are able to generate non-amyloid
aggregates, with a low structural stability that prevents detection by SDD-AGE. A sequence analysis
of our candidates suggests one explanation for these different behaviors. Highly amyloidogenic
proteins were generally more N-rich, whereas non-amyloidogenic proteins were more Q-rich. A
direct analysis of the distinct contributions of each of these residues to prion formation is
underway and will be reported elsewhere.
The refined set of candidate yeast prions is strongly enriched for proteins involved in gene
expression such as transcription factors (p = 5.3 x 10-5) and RNA-binding proteins (p = 5.1 x 10-4), a
finding that supports the idea that PrDs function as epigenetic switches influencing important
cellular pathways. The discoveries of [SWI+] (Du et al., 2008) and [MOT3+] lend further support to
the idea that prion-based phenomena are biologically significant. The causal agents of these prions
are each global transcription factors; consequently their prion states are likely to have far-reaching
phenotypic effects. Our in depth analysis of one of these prions, [MOT3+], reveals a very appreciable
spontaneous induction frequency (~10-4, Figure 6 and data not shown) that is further dramatically
enhanced by overexpression or the introduction of preformed amyloid seeds. We speculate that the
prion domain, and expression level, of Mot3p are partial products of selection for prion bistability.
The prion properties of these transcription factors may generate an optimized phenotypic
heterogeneity that buffers yeast populations against diverse environmental insults.
The role of prions has expanded considerably since their public inception as agents of
disease. Prions in yeast and filamentous fungi drive heritable switches that increase phenotypic
diversity. Conversely, higher organisms may have harnessed prion-like conformational templating
41
to initiate stable switches involved in, for instance, neuronal synapse activation (Si et al., 2003). The
regulation and frequency of prion switching may have been honed by selective pressures unique to
each protein. Self-perpetuating prion and prion-like processes that serve an adaptive role may
generally undergo increased switching under stressful conditions that perturb protein homeostasis,
as has been established for the [PSI+] prion (Tyedmers et al., 2008). We suspect that many of our
confirmed prion domains, in their endogenous contexts, will have switching rates that similarly
respond to homeostatic cues. The heterogeneity theoretically possible with over twenty different
prion switches amplifies the phenotype space of a single proteome, creating an advantageous
scenario for any isogenic population under duress. Further, since prions are uniquely self-
perpetuating yet metastable, any beneficial phenotype they produce can be easily maintained or
lost in subsequent generations depending on selective pressures. This differs fundamentally both
from genetic mutations, which are relatively permanent, and from non-heritable phenotypic
changes, such as those arising from transcriptional noise.
Self-templating aggregates like yeast prions constitute a paradigm-shifting mechanism for
the replication of biological information. Prion-based biological information arises spontaneously
yet specifically within select proteins, is metastable, and is intricately linked to stress-response
pathways. These features position prions as ideal bet-hedging devices (King and Masel, 2007)
capable of responding to environmental stimuli. Our studies provide the tools for future genome-
wide investigations of protein-based self-perpetuating changes in diverse organisms. We predict
that these studies will profoundly impact our future understanding of phenotypic variation and will
help to unravel the complex relationship between genotype and phenotype.
EXPERIMENTAL PROCEDURES
Computational prion prediction
A hidden Markov Model (HMM) was used for identifying candidate prion domains. The
HMM had two hidden states, PrD and background, and the output symbols were the 20 amino acids
(AAs). The output probabilities for the PrD state were constructed based on the AA frequencies in
the PrDs of Sup35p, Rnq1p, Ure2p, and New1p (Masison and Wickner, 1995; Edskes et al., 1999; Li
and Lindquist, 2000; Santoso et al., 2000; Sondheimer and Lindquist, 2000; Osherovich and
Weissman, 2001; King and Diaz-Avalos, 2004; Osherovich et al., 2004), each normalized to have 100
AA counts total (so that the longer PrDs would not have a disproportionate influence), along with 1
pseudocount for each AA. The output probabilities for the background state were the AA
42
frequencies for the entire S. cerevisiae proteome. The transition probability from PrD to background
was set to 0.02 and the transition probability from background to PrD state was set to 0.001. Initial
probabilities for PrD and background were set to 0.05 and 0.95, respectively.
Each S. cerevisiae protein was parsed using the Viterbi algorithm, and regions of at least 60
consecutive AAs classified in the cPrD state were considered as candidate prion domains. For each
candidate prion domains we identified a core of 60 consecutive AAs for which the ratio of the
probability of the sequence under the PrD AA frequencies relative to the “background” AA
frequencies was maximized; we ordered the candidate prion domains according to this ratio of
probabilities.
Cloning procedures and vector construction
We recently generated a set of Gateway® System cloning vectors that are derived from the
commonly used pRS yeast shuttle vectors (see Alberti et al., 2007 and http://www.addgene.org/).
These pAG vectors have a Gateway® chloramphenicol/ccdB resistance cassette inserted into the
single SmaI restriction site of each of the 24 pRS plasmids (Mumberg et al., 1995). The basic pAG
vector set was modified to allow for the use of different promoters and C-terminal SUP35 fusion
tags. The coding sequences for the tags and the SUP35 promoter were amplified from genomic
S288C DNA using the primers listed in Table S3. The TEF2 and ADH1 promoter were derived from
the pRS4xx series of plasmids (Mumberg et al., 1995). To generate pAG4xxADH-ccdB, pAG4xxTEFccdB and pAG4xxSUP-ccdB (please see Alberti et al., 2007, for nomenclature), the GPD promoter
sequence of pAG4xxGPD-ccdB was deleted through digestion with SpeI and SacI, followed by the
insertion of the TEF2, ADH1 and SUP35 promoter sequences. A PCR product (see Table S3 for
oligonucleotide sequences) coding for the Sup35C domain (amino acids 234-685) was cloned
between the HindIII and XhoI sites producing pAG4xxADH-ccdB-SUP35C, pAG4xxGPD-ccdB-
SUP35C, pAG4xx-TEF-ccdB-SUP35C and pAG4xxSUP-ccdB-SUP35C. The 5' oligonucleotides used for
generating the SUP35C-tagging vectors contained a linker that translates into the sequence
GGPGGG. This sequence was included to increase the flexibility and reduce any adverse effects of
the PrDs on the translation termination function of Sup35C.
Multiple Gateway® compatible destination vectors were generated for expression of His-
tag fusions in E. coli. pRH1 was generated from pAED4-SCNM-his7 (Osherovich et al., 2004) as
follows. The NM ORF was cut out with HpaI and NdeI and replaced with the Gateway® cassette RfB
(Invitrogen, CA). Quick-Change mutagenesis was then applied to remove the Shine-Dalgarno site
and add a codon for tryptophan (Trp) prior to the 7xHis sequence, to allow for spectrophotometric
43
quantitation of purified proteins. To create pRH2, an NdeI site was added to pRH1 just prior to the
Trp codon, into which the M domain (amino acids 125 - 320 of Sup35p) was inserted. Finally, the
NdeI sites were deleted. For N-terminal His-tagged proteins, pRH3 was generated by inserting the
M domain into the NdeI site of pDest17 (Invitrogen, CA), followed by deletion of the resulting 3'
NdeI site. All vector modifications were verified by sequencing.
Candidate PrDs and other amyloidogenic gene fragments, such as the N and NM domains of
Sup35p and the Q25, Q72 and Q103 length variants of huntingtin were amplified using a two step
PCR with overlapping primer sets (see Table S3 for a list of the oligonucleotides used). A two step
PCR was chosen as a cost-effective alternative that avoids the synthesis of very long
oligonucleotides. In the first PCR, gene-specific primers were used to amplify the region of interest
from genomic DNA of the yeast strain S288C or plasmid DNA. Universal primers (Table S3) were
then used in the second round to attach the recombinogenic attB1 and attB2 sites at the 5' and 3'
ends of the primary PCR product, respectively. Proof-reading Platinum Pfx DNA polymerase
(Invitrogen, CA) was used in both reactions to guarantee accurate DNA synthesis. The correct
amplification and integration of the DNA sequences into pDONR221 (Invitrogen, CA) was confirmed
by sequencing. Several cPrDs contained a single cysteine at the N or C terminus to allow the
incorporation of dyes in follow-up experiments. In addition, we added an N terminal serine residue
to internal PrDs to increase PrD stability. Below is an illustration of the sequence features that were
incorporated into the oligonucleotides to allow Gateway® recombination and dual expression in
bacteria and yeast (the sequences overlapping in the gene-specific and the universal primers is
underlined):
attB1 site
Shine-Dalgarno
Kozak
ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AAC AAA ATG -attB2 site
AC CAC TTT GTA CAA GAA AGC TGG GTT -Yeast strains and media
The yeast strains used in this study were derived from YJW509 (MATα, leu2-3,112; his3-
11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [pin-]) and YJW584 (MATa, leu2-3,112; his3-11,15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]) (see Osherovich et al. (2004) for details on
strain generation). A detailed list of the strains generated in this study is shown in Table S4. The
media used were complete standard synthetic media or media lacking particular amino acids
44
containing either 2 % D-glucose (SD), 2 % D-galactose (SGal), 2 % D-raffinose (SRaf) or a mix of
raffinose and galactose (SRafGal, 1 % each). Plates used for prion curing contained 5 mM guanidine
hydrochloride (GdnHCl). For determining drug-resistance prion phenotypes, the indicated
concentrations of drugs were added to YPD media after autoclaving, prior to solidification.
A PCR-generated (Baudin et al., 1993; Wach et al., 1994; Goldstein and McCusker, 1999)
deletion strategy was used to systematically replace a yeast open reading frame from its start to
stop codon with a kanMX4 or hphMX4 module. 64 bp forward and 67 bp reverse primers were used
to amplify the kanMX4 gene from pFA6-kanMX4 or the hphMX4 gene from pAG32 DNA. These
primers consisted of 45 bp gene-specific sequences and sequences that recognize regions in the
kanMX and hphMX4 modules - a 19 bp sequence (CAGCTGAAGCTTCGTACGC) for the forward
primer and a 22 bp sequence (GCATAGGCCACTAGTGGATCTG) for the reverse primer. A standard
lithium-acetate transformation protocol (Gietz et al., 1992; Gietz et al., 1995) was used to introduce
the gene disruption cassettes into yeast cells followed by selection of colonies on G418 (200 μg/ml)
or Hygromycin (300 μg/ml) containing agar plates. The knockouts were confirmed using the KanB
primer (Wach et al., 1994) which binds in the kanMX4 cassette and individual 20-22 bp primers
several 100 bp upstream of the start codons of the candidate genes.
A
PCR-based
tagging
strategy
(for
details
see
Wach
et
al.,
1997
and
http://depts.washington.edu/yeastrc/pages/plasmids.html) was used to integrate the coding
sequences for Cerulean at the 3' end of genes. 60 bp primers were used to amplify a CeruleanhphMX4 cassette from pBS10 DNA. The oligonucleotides consisted of a 40 bp homology to the gene
of
interest and the sequence
GGTCGACGGATCCCCGGG for the
ATCGATGAATTCGAGCTCG for the reverse primer.
forward primer and
The dan1::URA3 strain for studies of [MOT3+] was constructed as follows. A URA3-HIS5
cassette was amplified from a modified pUG27 (Gueldener et al., 2002) plasmid (bearing URA3 (160 to +78 from pRS306) inserted between the HindIII and SalI sites), a kind gift from Sherwin
Chan and Gerald Fink, Whitehead Institute for Biomedical Research, Cambridge, MA. Forward and
reverse primers for amplification of the cassette contained 44 and 49 bp, respectively of homology
to the immediate upstream and downstream sequence at the DAN1 ORF. The PCR product was gel-
purified and transformed using the methodology described above, followed by selection on SD-his
media and confirmation of correct integration using primers dan1upseq and URA3-1-3, which
amplify across the 5' integration junction.
45
Fluorescence microscopy
The library of 94 cPrDs was cloned into the vector pAG424GAL-ccdB-EYFP. Each of the
resulting constructs was then introduced into the YJW584 strain. The cells were grown for 24 hours
in galactose-containing medium and subjected to fluorescence microscopy using an Axiovert 200M
microscope (Carl Zeiss, Jena, Germany). Fluorescence and DIC images were acquired and processed
using Axiovision (Carl Zeiss, Jena, Germany) image analysis software. To evaluate the expression
levels of the cPrD-EYFP fusions, cell lysates were prepared after 24 hours of expression and
analyzed by Western blotting and detection with a GFP-specific antibody (Figure S1).
In vitro aggregation assays
In pilot experiments, we found that many cPrDs expressed with only a His-tag (without any
additional solubilizing features) could not be completely solubilized prior to the assembly
experiments. This was likely due to the absence of solubilizing elements normally found in the
native full-length proteins. Prion proteins are able to switch between two states because of a
balance between insolubility – driven by the prion domain – and solubility – driven by non-prion
domains. In the case of Sup35, this latter activity is largely provided by a highly charged, natively
unfolded middle region, M, which is located adjacent to the prion domain. Thus, to more accurately
mimic the solubility of the native proteins while still avoiding the necessity of a renaturing step
after purification, we incorporated the M region between the cPrD and poly-His coding sequences.
Most were purified with M and a poly-Histidine tag at the C-terminus, with a few exceptions, as
explained below, due to expression difficulties. We successfully purified 91 of the 94 cPrDs under
fully denaturing conditions, as have been employed for previously characterized prions.
Candidate PrDs were recombined into pRH2 and transformed into BL21AI (Invitrogen, CA),
an E. coli strain optimized for toxic protein expression. Some cPrDs (Ksp1p, Wwm1p, Nup49p,
Nup100p, and Med2p) were coexpressed with pRARE2 (EMD Biosciences, NJ) to increase
expression levels. The Swi1p and Nup100p cPrDs were expressed in pRH1. Cbk1p, Def1p, and
Psp2p PrDs were expressed in pRH3. 300 ml 2 x YT cultures were induced with 1 mM IPTG at an
OD of ~ 0.4. After 3 hours, cells were sedimented and resuspended in lysis buffer (7 M GndHCl; 100
mM K2HPO4, pH 8.0; 5 mM imidazole; 300 mM NaCl; 5 mM 2-mercaptoethanol) buffer for 1 hr at RT.
Lysates were then cleared for 20 min at 20,000 rcf and loaded onto a BioRobot8000 (Qiagen, CA)
for purification using TALON® Superflow resin (Clontech, CA), according to the manufacturers’
instructions. Proteins were eluted (8 M urea; 100 mM NaOAc/HOAc, pH 4; 5 mM β-
mecaptoethanol) and precipitated with 5 volumes of methanol.
46
For assembly reactions, methanol-precipitated proteins were resuspended in 10-50 µl of
resuspension buffer (7 M GndHCl; 100 mM K2HPO4, pH 5.0; 300 mM NaCl, 5 mM EDTA, 5 mM
TCEP). Protein concentrations were determined by measuring absorption at 280 nm using
calculated extinction coefficients. Protein stocks were heated for 5 min at 95°C before being diluted
to 20 µM in assembly buffer (5 mM K2HPO4, pH 6.6; 150 mM NaCl; 5 mM EDTA; 2 mM TCEP) plus
0.5 mM ThT. Assembly reactions were performed in black nonbinding microplates (Corning, NY)
with 100 µl per well, with 1400 rpm agitation at 30°C in an iEMS incubator/shaker (Thermo
Scientific). Fluorescence measurements (450 nm excitation, 482 nm emission) were made at the
indicated time points using a Sapphire II plate reader (Tecan, NC).
After the final fluorescence time point, reactions were applied to nitrocellulose and
cellulose acetate membranes as described by Boye-Harnasch and Cullin (Boye-Harnasch and Cullin,
2006). Ponceau S was used to detect immobilized proteins.
Semi-denaturing detergent-agarose gel electrophoresis (SDD-AGE)
A library of pAG424GAL-cPrD-EYFP constructs in YJW584 was used to investigate the
amyloid propensities of cPrDs in vivo. The cPrD-EYFP proteins were expressed for 24 or 48 hours
and then processed for SDD-AGE analysis. Cells were harvested by centrifugation and resuspended
in buffer A (50 mM Hepes, pH 7.5; 150 mM NaCl; 2.5 mM EDTA; 1 % (v/v) Triton X-100) containing
30 mM NEM, 1 mM PMSF and 1 x Complete Protease Inhibitor (Roche). Cells were lysed using glass
beads and were briefly spun at 3,000 rcf to sediment cell debris. The protein concentrations of the
cell lysate were adjusted and mixed with 4 x sample buffer (2 x TAE; 20 % (v/v) glycerol; 4 % (w/v)
SDS; bromophenol blue). The samples were incubated at room temperature for 15 minutes and
loaded onto a 1.8 % agarose gel containing 1 x TAE and 0.1 % SDS. The gel was run in running
buffer (1 x TAE, 0.1 % SDS) at 50 V, followed by blotting onto Hybond-C membrane (Amersham
Biosciences), as described in Halfmann and Lindquist (2008).
SUP35-based prion assay
We used SUP35C or SUP35MC tagging plasmids (see section 'cloning procedures and vector
construction' for details) to generate an array of cPrD-Sup35C or cPrD-Sup35MC-expressing strains
(see table S4 for a list of the strains). First, the strain YSR100 was transformed with a cPrD-SUP35C
or a cPrD-SUP35MC expression plasmid. Then, a plasmid shuffle was performed by plating the
transformants on 5-FOA. This produced a strain that expressed a particular cPrD-Sup35C/MC
fusion protein as the only source of functional Sup35p. All strains were examined by Western
47
blotting and SDD-AGE to evaluate expression and aggregation levels of the fusion proteins (see
Figure S4, S6 and S7).
To induce the prion state, the cPrD-SUP35C strains were transformed with a corresponding
pAG424GAL-cPrD-EYFP expression plasmid. The transformants were grown in SRafGal-Trp
medium for 24 hours and then plated on YPD and SD-Ade plates with a cell number of 200 and
50,000 per plate, respectively. The same strains grown in SRaf-Trp served as a control. We
compared the number of Ade+ colonies on plates with cells grown in raffinose/galactose-containing
medium to plates with cells grown in raffinose. A greater number of colonies under inducing
conditions suggested that expression of cPrD-EYFP induced a prion switch. In these cases Ade+
colonies were re-streaked on YPD plates and analyzed by SDD-AGE and curing on GdnHCl plates.
Fiber transformation
Stock Mot3PrD protein (from expression of MOT3 cPrD in pRH2) in resuspension buffer
was diluted to 10 µM in 1 ml assembly buffer and rotated end-to-end at 20 rpm for 3 days. The
protein was confirmed to have converted to SDS-resistant aggregates by SDS-PAGE analysis of
samples incubated for ten minutes in sample buffer at either 23°C or 95°C, and further confirmed to
have a fibrillar appearance by transmission electron microscopy. Transformation of dan1::URA3
yeast strains was performed according to (Tanaka and Weissman, 2006), except that DNA was
omitted and URA+ ([MOT3+]) spheroplasts were selected directly on SD-ura plates containing 1 M
sorbitol.
REFERENCES
Abramova, N., Sertil, O., Mehta, S., and Lowry, C.V. (2001). Reciprocal regulation of anaerobic and
aerobic cell wall mannoprotein gene expression in Saccharomyces cerevisiae. Journal of
bacteriology 183, 2881-2887.
Aguzzi, A., Baumann, F., and Bremer, J. (2008). The prion's elusive reason for being. Annual review
of neuroscience 31, 439-477.
Aigle, M., and Lacroute, F. (1975). Genetical aspects of [URE3], a non-mitochondrial, cytoplasmically
inherited mutation in yeast. Mol Gen Genet 136, 327-335.
Alberti, S., Halfmann, R., King, O., Kapila, A., and Lindquist, S. (2009). A systematic survey identifies
prions and illuminates sequence features of prionogenic proteins. Cell 137, 146-158.
Alexandrov, I.M., Vishnevskaya, A.B., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2008). Appearance
and propagation of polyglutamine-based amyloids in yeast: tyrosine residues enable polymer
fragmentation. J Biol Chem 283, 15185-15192.
Avery, S.V. (2006). Microbial cell individuality and the underlying sources of heterogeneity. Nature
reviews 4, 577-587.
Bagriantsev, S.N., Kushnirov, V.V., and Liebman, S.W. (2006). Analysis of amyloid aggregates using
agarose gel electrophoresis. Methods Enzymol 412, 33-48.
48
Balch, W.E., Morimoto, R.I., Dillin, A., and Kelly, J.W. (2008). Adapting proteostasis for disease
intervention. Science 319, 916-919.
Baskakov, I.V., and Breydo, L. (2007). Converting the prion protein: what makes the protein
infectious. Biochim Biophys Acta 1772, 692-703.
Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F., and Cullin, C. (1993). A simple and
efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21, 33293330.
Bossdorf, O., Richards, C.L., and Pigliucci, M. (2008). Epigenetics for ecologists. Ecol Lett 11, 106115.
Boye-Harnasch, M., and Cullin, C. (2006). A novel in vitro filter trap assay identifies tannic acid as an
amyloid aggregation inducer for HET-s. J Biotechnol 125, 222-230.
Brachmann, A., Baxa, U., and Wickner, R.B. (2005). Prion generation in vitro: amyloid of Ure2p is
infectious. Embo J 24, 3082-3092.
Brachmann, A., Toombs, J.A., and Ross, E.D. (2006). Reporter assay systems for [URE3] detection
and analysis. Methods (San Diego, Calif 39, 35-42.
Bradley, M.E., Edskes, H.K., Hong, J.Y., Wickner, R.B., and Liebman, S.W. (2002). Interactions among
prions and prion "strains" in yeast. Proc Natl Acad Sci U S A 99 Suppl 4, 16392-16399.
Brown, J.C., and Lindquist, S. (2009). A heritable switch in carbon source utilization driven by an
unusual yeast prion. Genes Dev 23, 2320-2332.
Chernoff, Y.O. (2007). Stress and prions: lessons from the yeast model. FEBS Lett 581, 3695-3701.
Chernoff, Y.O., Galkin, A.P., Lewitin, E., Chernova, T.A., Newnam, G.P., and Belenkiy, S.M. (2000).
Evolutionary conservation of prion-forming abilities of the yeast Sup35 protein. Mol Microbiol 35,
865-876.
Chiti, F., and Dobson, C.M. (2006). Protein misfolding, functional amyloid, and human disease. Annu
Rev Biochem 75, 333-366.
Cox, B., Ness, F., and Tuite, M. (2003). Analysis of the generation and segregation of propagons:
entities that propagate the [PSI+] prion in yeast. Genetics 165, 23-33.
Cox, B.S., Tuite, M.F., and Mundy, C.J. (1980). Reversion from suppression to nonsuppression in
SUQ5 [psi+] strains of yeast: the classificaion of mutations. Genetics 95, 589-609.
Derkatch, I.L., Bradley, M.E., Hong, J.Y., and Liebman, S.W. (2001). Prions affect the appearance of
other prions: the story of [PIN(+)]. Cell 106, 171-182.
Derkatch, I.L., Bradley, M.E., Masse, S.V., Zadorsky, S.P., Polozkov, G.V., Inge-Vechtomov, S.G., and
Liebman, S.W. (2000). Dependence and independence of [PSI(+)] and [PIN(+)]: a two-prion system
in yeast? Embo J 19, 1942-1952.
Diaz-Avalos, R., King, C.Y., Wall, J., Simon, M., and Caspar, D.L. (2005). Strain-specific morphologies
of yeast prion amyloid fibrils. Proc Natl Acad Sci U S A 102, 10165-10170.
Douglas, P.M., Treusch, S., Ren, H.Y., Halfmann, R., Duennwald, M.L., Lindquist, S., and Cyr, D.M.
(2008). Chaperone-dependent amyloid assembly protects cells from prion toxicity. Proc Natl Acad
Sci U S A 105, 7206-7211.
Du, Z., Park, K.W., Yu, H., Fan, Q., and Li, L. (2008). Newly identified prion linked to the chromatinremodeling factor Swi1 in Saccharomyces cerevisiae. Nat Genet 40, 460-465.
Eaglestone, S.S., Cox, B.S., and Tuite, M.F. (1999). Translation termination efficiency can be
regulated in Saccharomyces cerevisiae by environmental stress through a prion-mediated
mechanism. Embo J 18, 1974-1981.
Edskes, H.K., Gray, V.T., and Wickner, R.B. (1999). The [URE3] prion is an aggregated form of Ure2p
that can be cured by overexpression of Ure2p fragments. Proc Natl Acad Sci U S A 96, 1498-1503.
Edskes, H.K., Naglieri, B.M., and Wickner, R.B. (2006). Nitrogen source and the retrograde signalling
pathway affect detection, not generation, of the [URE3] prion. Yeast (Chichester, England) 23, 833840.
49
Fernandez-Bellot, E., Guillemet, E., and Cullin, C. (2000). The yeast prion [URE3] can be greatly
induced by a functional mutated URE2 allele. The EMBO journal 19, 3215-3222.
Ganusova, E.E., Ozolins, L.N., Bhagat, S., Newnam, G.P., Wegrzyn, R.D., Sherman, M.Y., and Chernoff,
Y.O. (2006). Modulation of prion formation, aggregation, and toxicity by the actin cytoskeleton in
yeast. Mol Cell Biol 26, 617-629.
Giacomelli, M.G., Hancock, A.S., and Masel, J. (2007). The conversion of 3' UTRs into coding regions.
Mol Biol Evol 24, 457-464.
Gietz, D., St Jean, A., Woods, R.A., and Schiestl, R.H. (1992). Improved method for high efficiency
transformation of intact yeast cells. Nucleic Acids Res 20, 1425.
Gietz, R.D., Schiestl, R.H., Willems, A.R., and Woods, R.A. (1995). Studies on the transformation of
intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11, 355-360.
Glover, J.R., Kowal, A.S., Schirmer, E.C., Patino, M.M., Liu, J.J., and Lindquist, S. (1997). Self-seeded
fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S.
cerevisiae. Cell 89, 811-819.
Goldstein, A.L., and McCusker, J.H. (1999). Three new dominant drug resistance cassettes for gene
disruption in Saccharomyces cerevisiae. Yeast 15, 1541-1553.
Green, S.R., and Johnson, A.D. (2004). Promoter-dependent roles for the Srb10 cyclin-dependent
kinase and the Hda1 deacetylase in Tup1-mediated repression in Saccharomyces cerevisiae.
Molecular biology of the cell 15, 4191-4202.
Griffith, J.S. (1967). Self-replication and scrapie. Nature 215, 1043-1044.
Grishin, A.V., Rothenberg, M., Downs, M.A., and Blumer, K.J. (1998). Mot3, a Zn finger transcription
factor that modulates gene expression and attenuates mating pheromone signaling in
Saccharomyces cerevisiae. Genetics 149, 879-892.
Griswold, C.K., and Masel, J. (2009). Complex adaptations can drive the evolution of the capacitor
[PSI], even with realistic rates of yeast sex. PLoS Genet 5, e1000517.
Gueldener, U., Heinisch, J., Koehler, G.J., Voss, D., and Hegemann, J.H. (2002). A second set of loxP
marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res 30,
e23.
Halfmann, R., and Lindquist, S. (2008). Screening for amyloid aggregation by semi-denaturing
detergent-agarose gel electrophoresis. J Vis Exp.
Harrison, P.M., and Gerstein, M. (2003). A method to assess compositional bias in biological
sequences and its application to prion-like glutamine/asparagine-rich domains in eukaryotic
proteomes. Genome Biol 4, R40.
Hillenmeyer, M.E., Fung, E., Wildenhain, J., Pierce, S.E., Hoon, S., Lee, W., Proctor, M., St Onge, R.P.,
Tyers, M., Koller, D., et al. (2008). The chemical genomic portrait of yeast: uncovering a phenotype
for all genes. Science 320, 362-365.
Hogan, D.J., Riordan, D.P., Gerber, A.P., Herschlag, D., and Brown, P.O. (2008). Diverse RNA-binding
proteins interact with functionally related sets of RNAs, suggesting an extensive regulatory system.
PLoS biology 6, e255.
Hongay, C., Jia, N., Bard, M., and Winston, F. (2002). Mot3 is a transcriptional repressor of ergosterol
biosynthetic genes and is required for normal vacuolar function in Saccharomyces cerevisiae. Embo
J 21, 4114-4124.
King, C.Y., and Diaz-Avalos, R. (2004). Protein-only transmission of three yeast prion strains. Nature
428, 319-323.
King, O.D., and Masel, J. (2007). The evolution of bet-hedging adaptations to rare scenarios. Theor
Popul Biol 72, 560-575.
Kodali, R., and Wetzel, R. (2007). Polymorphism in the intermediates and products of amyloid
assembly. Curr Opin Struct Biol 17, 48-57.
50
Kushnirov, V.V., Kochneva-Pervukhova, N.V., Chechenova, M.B., Frolova, N.S., and Ter-Avanesyan,
M.D. (2000). Prion properties of the Sup35 protein of yeast Pichia methanolica. The EMBO journal
19, 324-331.
Kussell, E., Kishony, R., Balaban, N.Q., and Leibler, S. (2005). Bacterial persistence: a model of
survival in changing environments. Genetics 169, 1807-1814.
Kyte, J., and Doolittle, R.F. (1982). A simple method for displaying the hydropathic character of a
protein. J Mol Biol 157, 105-132.
Lancaster, A.K., Bardill, J.P., True, H.L., and Masel, J. (2009). The Spontaneous Appearance Rate of
the Yeast Prion [PSI+] and Its Implications For the Evolution of the Evolvability Properties of the
[PSI+] System. Genetics, DOI: 10.1534/genetics.1109.110213 (http://www.genetics.org).
LeVine, H., 3rd (1993). Thioflavine T interaction with synthetic Alzheimer's disease beta-amyloid
peptides: detection of amyloid aggregation in solution. Protein Sci 2, 404-410.
LeVine, H., 3rd (1997). Stopped-flow kinetics reveal multiple phases of thioflavin T binding to
Alzheimer beta (1-40) amyloid fibrils. Arch Biochem Biophys 342, 306-316.
Li, L., and Lindquist, S. (2000). Creating a protein-based element of inheritance. Science 287, 661664.
Liebman, S.W., and Sherman, F. (1979). Extrachromosomal psi+ determinant suppresses nonsense
mutations in yeast. Journal of bacteriology 139, 1068-1071.
Liu, J.J., and Lindquist, S. (1999). Oligopeptide-repeat expansions modulate 'protein-only'
inheritance in yeast. Nature 400, 573-576.
Liu, J.J., Sondheimer, N., and Lindquist, S.L. (2002). Changes in the middle region of Sup35
profoundly alter the nature of epigenetic inheritance for the yeast prion [PSI+]. Proc Natl Acad Sci U
S A 99 Suppl 4, 16446-16453.
Lopez de la Paz, M., and Serrano, L. (2004). Sequence determinants of amyloid fibril formation. Proc
Natl Acad Sci U S A 101, 87-92.
Lund, P.M., and Cox, B.S. (1981). Reversion analysis of [psi-] mutations in Saccharomyces cerevisiae.
Genet Res 37, 173-182.
Maddelein, M.L., Dos Reis, S., Duvezin-Caubet, S., Coulary-Salin, B., and Saupe, S.J. (2002). Amyloid
aggregates of the HET-s prion protein are infectious. Proc Natl Acad Sci U S A 99, 7402-7407.
Masel, J., and Siegal, M.L. (2009). Robustness: mechanisms and consequences. Trends Genet 25,
395-403.
Masison, D.C., and Wickner, R.B. (1995). Prion-inducing domain of yeast Ure2p and protease
resistance of Ure2p in prion-containing cells. Science 270, 93-95.
Mathur, V., Hong, J.Y., and Liebman, S.W. (2009). Ssa1 overexpression and [PIN(+)] variants cure
[PSI(+)] by dilution of aggregates. Journal of molecular biology 390, 155-167.
Michelitsch, M.D., and Weissman, J.S. (2000). A census of glutamine/asparagine-rich regions:
implications for their conserved function and the prediction of novel prions. Proc Natl Acad Sci U S
A 97, 11910-11915.
Morimoto, R.I. (2008). Proteotoxic stress and inducible chaperone networks in neurodegenerative
disease and aging. Genes & development 22, 1427-1438.
Mrsa, V., Ecker, M., Strahl-Bolsinger, S., Nimtz, M., Lehle, L., and Tanner, W. (1999). Deletion of new
covalently linked cell wall glycoproteins alters the electrophoretic mobility of phosphorylated wall
components of Saccharomyces cerevisiae. Journal of bacteriology 181, 3076-3086.
Mukhopadhyay, S., Krishnan, R., Lemke, E.A., Lindquist, S., and Deniz, A.A. (2007). A natively
unfolded yeast prion monomer adopts an ensemble of collapsed and rapidly fluctuating structures.
Proc Natl Acad Sci U S A 104, 2649-2654.
Mumberg, D., Muller, R., and Funk, M. (1995). Yeast vectors for the controlled expression of
heterologous proteins in different genetic backgrounds. Gene 156, 119-122.
51
Nakayashiki, T., Ebihara, K., Bannai, H., and Nakamura, Y. (2001). Yeast [PSI+] "prions" that are
crosstransmissible and susceptible beyond a species barrier through a quasi-prion state. Molecular
cell 7, 1121-1130.
Nakayashiki, T., Kurtzman, C.P., Edskes, H.K., and Wickner, R.B. (2005). Yeast prions [URE3] and
[PSI+] are diseases. Proc Natl Acad Sci U S A 102, 10575-10580.
Namy, O., Galopier, A., Martini, C., Matsufuji, S., Fabret, C., and Rousset, J.P. (2008a). Epigenetic
control of polyamines by the prion [PSI(+)]. Nat Cell Biol.
Namy, O., Galopier, A., Martini, C., Matsufuji, S., Fabret, C., and Rousset, J.P. (2008b). Epigenetic
control of polyamines by the prion [PSI+]. Nat Cell Biol 10, 1069-1075.
Nemecek, J., Nakayashiki, T., and Wickner, R.B. (2009). A prion of yeast metacaspase homolog
(Mca1p) detected by a genetic screen. Proceedings of the National Academy of Sciences of the
United States of America 106, 1892-1896.
Osherovich, L.Z., Cox, B.S., Tuite, M.F., and Weissman, J.S. (2004). Dissection and design of yeast
prions. PLoS Biol 2, E86.
Osherovich, L.Z., and Weissman, J.S. (2001). Multiple Gln/Asn-rich prion domains confer
susceptibility to induction of the yeast [PSI(+)] prion. Cell 106, 183-194.
Patel, B.K., Gavin-Smyth, J., and Liebman, S.W. (2009). The yeast global transcriptional co-repressor
protein Cyc8 can propagate as a prion. Nature cell biology 11, 344-349.
Patel, B.K., and Liebman, S.W. (2007). "Prion-proof" for [PIN+]: infection with in vitro-made amyloid
aggregates of Rnq1p-(132-405) induces [PIN+]. J Mol Biol 365, 773-782.
Patino, M.M., Liu, J.J., Glover, J.R., and Lindquist, S. (1996). Support for the prion hypothesis for
inheritance of a phenotypic trait in yeast. Science 273, 622-626.
Pedersen, J.S., and Otzen, D.E. (2008). Amyloid-a state in many guises: survival of the fittest fibril
fold. Protein Sci 17, 2-10.
Perrett, S., and Jones, G.W. (2008). Insights into the mechanism of prion propagation. Curr Opin
Struct Biol 18, 52-59.
Pigliucci, M. (2008). Is evolvability evolvable? Nat Rev Genet 9, 75-82.
Prilusky, J., Felder, C.E., Zeev-Ben-Mordehai, T., Rydberg, E.H., Man, O., Beckmann, J.S., Silman, I., and
Sussman, J.L. (2005). FoldIndex: a simple tool to predict whether a given protein sequence is
intrinsically unfolded. Bioinformatics 21, 3435-3438.
Prusiner, S.B. (1982). Novel proteinaceous infectious particles cause scrapie. Science 216, 136-144.
Ram, A.F., Wolters, A., Ten Hoopen, R., and Klis, F.M. (1994). A new approach for isolating cell wall
mutants in Saccharomyces cerevisiae by screening for hypersensitivity to calcofluor white. Yeast
(Chichester, England) 10, 1019-1030.
Ross, E.D., Baxa, U., and Wickner, R.B. (2004). Scrambled prion domains form prions and amyloid.
Mol Cell Biol 24, 7206-7213.
Ross, E.D., Edskes, H.K., Terry, M.J., and Wickner, R.B. (2005a). Primary sequence independence for
prion formation. Proc Natl Acad Sci U S A 102, 12825-12830.
Ross, E.D., Minton, A., and Wickner, R.B. (2005b). Prion domains: sequences, structures and
interactions. Nature cell biology 7, 1039-1044.
Sabate, R., Baxa, U., Benkemoun, L., Sanchez de Groot, N., Coulary-Salin, B., Maddelein, M.L., Malato,
L., Ventura, S., Steven, A.C., and Saupe, S.J. (2007). Prion and non-prion amyloids of the HET-s prion
forming domain. Journal of molecular biology 370, 768-783.
Salnikova, A.B., Kryndushkin, D.S., Smirnov, V.N., Kushnirov, V.V., and Ter-Avanesyan, M.D. (2005).
Nonsense suppression in yeast cells overproducing Sup35 (eRF3) is caused by its non-heritable
amyloids. J Biol Chem 280, 8808-8812.
Santoso, A., Chien, P., Osherovich, L.Z., and Weissman, J.S. (2000). Molecular basis of a yeast prion
species barrier. Cell 100, 277-288.
Saupe, S.J., Clave, C., and Begueret, J. (2000). Vegetative incompatibility in filamentous fungi:
Podospora and Neurospora provide some clues. Current opinion in microbiology 3, 608-612.
52
Scherzinger, E., Sittler, A., Schweiger, K., Heiser, V., Lurz, R., Hasenbank, R., Bates, G.P., Lehrach, H.,
and Wanker, E.E. (1999). Self-assembly of polyglutamine-containing huntingtin fragments into
amyloid-like fibrils: implications for Huntington's disease pathology. Proceedings of the National
Academy of Sciences of the United States of America 96, 4604-4609.
Schwimmer, C., and Masison, D.C. (2002). Antagonistic interactions between yeast [PSI(+)] and
[URE3] prions and curing of [URE3] by Hsp70 protein chaperone Ssa1p but not by Ssa2p. Molecular
and cellular biology 22, 3590-3598.
Seger, J., and Brockmann, H.J. (1987). What is bet-hedging? Oxford Surv Evol Biol 4, 192-211.
Senechal, P., Arseneault, G., Leroux, A., Lindquist, S., and Rokeach, L.A. (2009). The
Schizosaccharomyces pombe Hsp104 disaggregase is unable to propagate the [PSI] prion. PLoS One
4, e6939.
Serio, T.R., Cashikar, A.G., Kowal, A.S., Sawicki, G.J., Moslehi, J.J., Serpell, L., Arnsdorf, M.F., and
Lindquist, S.L. (2000). Nucleated conformational conversion and the replication of conformational
information by a prion determinant. Science (New York, NY 289, 1317-1321.
Shkundina, I.S., and Ter-Avanesyan, M.D. (2007). Prions. Biochemistry (Mosc) 72, 1519-1536.
Shorter, J., and Lindquist, S. (2005). Prions as adaptive conduits of memory and inheritance. Nat Rev
Genet 6, 435-450.
Shorter, J., and Lindquist, S. (2008). Hsp104, Hsp70 and Hsp40 interplay regulates formation,
growth and elimination of Sup35 prions. The EMBO journal 27, 2712-2724.
Si, K., Lindquist, S., and Kandel, E.R. (2003). A neuronal isoform of the aplysia CPEB has prion-like
properties. Cell 115, 879-891.
Smukalla, S., Caldara, M., Pochet, N., Beauvais, A., Guadagnini, S., Yan, C., Vinces, M.D., Jansen, A.,
Prevost, M.C., Latge, J.P., et al. (2008). FLO1 is a variable green beard gene that drives biofilm-like
cooperation in budding yeast. Cell 135, 726-737.
Sondheimer, N., and Lindquist, S. (2000). Rnq1: an epigenetic modifier of protein function in yeast.
Molecular cell 5, 163-172.
Sparrer, H.E., Santoso, A., Szoka, F.C., Jr., and Weissman, J.S. (2000). Evidence for the prion
hypothesis: induction of the yeast [PSI+] factor by in vitro- converted Sup35 protein. Science (New
York, NY 289, 595-599.
Stern, D.L., and Orgogozo, V. (2009). Is genetic evolution predictable? Science 323, 746-751.
Sweeny, E.A., and Shorter, J. (2008). Prion proteostasis: Hsp104 meets its supporting cast. Prion 2,
135-140.
Tanaka, M., Collins, S.R., Toyama, B.H., and Weissman, J.S. (2006). The physical basis of how prion
conformations determine strain phenotypes. Nature 442, 585-589.
Tanaka, M., and Weissman, J.S. (2006). An efficient protein transformation protocol for introducing
prions into yeast. Methods in enzymology 412, 185-200.
Taneja, V., Maddelein, M.L., Talarek, N., Saupe, S.J., and Liebman, S.W. (2007). A non-Q/N-rich prion
domain of a foreign prion, [Het-s], can propagate as a prion in yeast. Molecular cell 27, 67-77.
Tank, E.M., Harris, D.A., Desai, A.A., and True, H.L. (2007). Prion protein repeat expansion results in
increased aggregation and reveals phenotypic variability. Molecular and cellular biology 27, 54455455.
Taylor, K.L., Cheng, N., Williams, R.W., Steven, A.C., and Wickner, R.B. (1999). Prion domain
initiation of amyloid formation in vitro from native Ure2p. Science (New York, NY 283, 1339-1343.
Tessier, P.M., and Lindquist, S. (2009). Unraveling infectious structures, strain variants and species
barriers for the yeast prion [PSI+]. Nat Struct Mol Biol 16, 598-605.
True, H.L., Berlin, I., and Lindquist, S.L. (2004). Epigenetic regulation of translation reveals hidden
genetic variation to produce complex traits. Nature 431, 184-187.
True, H.L., and Lindquist, S.L. (2000). A yeast prion provides a mechanism for genetic variation and
phenotypic diversity. Nature 407, 477-483.
53
Tuite, M., Stojanovski, K., Ness, F., Merritt, G., and Koloteva-Levine, N. (2008). Cellular factors
important for the de novo formation of yeast prions. Biochem Soc Trans 36, 1083-1087.
Tuite, M.F., and Cox, B.S. (2003). Propagation of yeast prions. Nat Rev Mol Cell Biol 4, 878-890.
Tyedmers, J., Madariaga, M.L., and Lindquist, S. (2008). Prion switching in response to
environmental stress. PLoS biology 6, e294.
Verstrepen, K.J., and Fink, G.R. (2009). Genetic and epigenetic mechanisms underlying cell-surface
variability in protozoa and fungi. Annu Rev Genet 43, 1-24.
Vitrenko, Y.A., Gracheva, E.O., Richmond, J.E., and Liebman, S.W. (2007). Visualization of aggregation
of the Rnq1 prion domain and cross-seeding interactions with Sup35NM. J Biol Chem 282, 17791787.
Wach, A., Brachat, A., Pohlmann, R., and Philippsen, P. (1994). New heterologous modules for
classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793-1808.
Wang, X., Vitalis, A., Wyczalkowski, M.A., and Pappu, R.V. (2006). Characterizing the conformational
ensemble of monomeric polyglutamine. Proteins 63, 297-311.
Wickner, R.B. (1994). [URE3] as an altered URE2 protein: evidence for a prion analog in
Saccharomyces cerevisiae. Science (New York, NY 264, 566-569.
Wickner, R.B., Edskes, H.K., Shewmaker, F., and Nakayashiki, T. (2007a). Prions of fungi: inherited
structures and biological roles. Nature reviews 5, 611-618.
Wickner, R.B., Edskes, H.K., Shewmaker, F., Nakayashiki, T., Engel, A., McCann, L., and Kryndushkin,
D. (2007b). Yeast prions: evolution of the prion concept. Prion 1, 94-100.
Wilson, M.A., Meaux, S., Parker, R., and van Hoof, A. (2005). Genetic interactions between [PSI+] and
nonstop mRNA decay affect phenotypic variation. Proc Natl Acad Sci U S A 102, 10244-10249.
Zenthon, J.F., Ness, F., Cox, B., and Tuite, M.F. (2006). The [PSI+] prion of Saccharomyces cerevisiae
can be propagated by an Hsp104 orthologue from Candida albicans. Eukaryot Cell 5, 217-225.
54
Figure 1. Computational prediction and outline of the prion screen
(A) Output format of the cPrD prediction algorithm for SUP35p. The amino acid sequence of the SUP35p
protein is shown at the bottom in single letter code. The core region of the cPrD is highlighted in orange and
the additional predicted region in pink. The top panel shows the probability of each residue belonging to the
HMM state “cPrD” (red) and “background” (black); the tracks “MAP” and “Vit” illustrate the Maximum a
Posteriori and the Viterbi parses of the protein into these two states. The lower panel shows sliding averages
over a window of width 60 of net charge (pink), hydropathy (blue), and predicted disorder (gray) as in
FoldIndex (Prilusky et al., 2005), along with a sliding average based on cPrD amino acid propensities (red).
(B) Overview of the experimental procedures employed to screen for new Q/N-rich prions in yeast. Based on
our computational prediction, we generated a cPrD library that was shuttled into a panel of expression
vectors for analysis. Experiments were performed with cPrDs expressed in bacteria and yeast and included
biochemical assays, cell biological assays and different aggregate visualization techniques.
55
Figure 2. Prion domains form intracellular aggregates detectable by microscopy and SDD-AGE
(A) Expression of amyloidogenic proteins in the yeast cytosol leads to the formation of ribbon and dot-like
structures. cPrD-EYFP fusion proteins were expressed from a galactose-regulatable plasmid in yeast cells
containing the [RNQ+] prion. The yeast cells were subjected to fluorescence microscopy after 24 h of
expression. Representative fluorescence microscopy images are shown together with DIC images (insets).
Arrows point to aggregates in the yeast cytosol.
(B) A selected set of cPrD candidates forming fluorescent foci after 24 h of expression. Conditions were as
described in (A).
(C) Detection of SDS-resistant aggregates by SDD-AGE in cell lysates of yeast strains expressing cPrD-EYFP
fusions. Expression of the proteins was induced for 24 h (top gels) or 48 h (bottom gels). Control proteins
(highlighted in blue) were the N or NM domains of Sup35p (top left) and the huntingtin protein length
variants Q25, Q72 and Q103 (bottom right). Proteins were detected with a GFP-specific antibody. Previously
identified prions and the prion candidate New1p are highlighted in red.
56
Figure 3. Prion domains have diverse amyloid propensities
Amyloid formation of cPrD-M-His proteins was followed by ThT fluorescence (arbitrary units) measured at
the indicated time points. Shown are means of three replicate assemblies (coefficients of variation were
generally < 30; exceptions were Pan1, Nup116, and Yap1802, which each had highly variable lag phases).
After the final measurement, reactions were analyzed for detergent-resistant aggregation. Aliquots from one
experiment were spotted directly onto nitrocellulose (“total”), or treated with either 0.1% Tween 20 or 2%
SDS and filtered through a non-binding membrane. Retained protein was visualized with Ponceau S. *These
cPrDs were purified with a polyHis-tag only (no M). **These cPrDs were purified with the M-His tag at their
N-terminus. Red labels indicate known prion proteins.
57
Figure 4. A SUP35-based prion assay is used to detect switching behavior
(A) A schematic overview of the genetic manipulations deployed to identify cPrDs with prion properties (top)
and an example of the used selection procedure (bottom). In the bottom half, the prion state was induced by
expressing NM-EYFP for 24 h and the cells were subsequently plated on complete (YPD) and adeninedeficient medium (SD-ade). The same strain grown under non-inducing conditions served as a control. Note
that the number of cells plated on SD-ade plates was 200 times the number on YPD plates. Arrows point to
colonies that switched to a white colony color. See text and Experimental Procedures for details.
(B) A selected set of positive candidates identified with the SUP35C-based prion assay. Conditions were as
described in (A).
58
Figure 5. The phenotypic switches of cPrD-Sup35C chimeras involve amyloid and are curable
(A) Cells lysates were prepared from [prd-c-] and [PrD-C+] strains and analyzed by SDD-AGE. The cPrDSup35C fusion proteins were detected by using a C domain-specific anti-Sup35p antibody. Corresponding
[prd-c-] and [PrD-C+] strains growing on YPD are displayed above the SDD-AGE Western blots.
(B) [PrD-C+] strains were passaged three times on YPD plates containing 5 mM GdnHCl and then spotted onto
YPD plates (“cured”). The [prd-c-] and [PrD-C+] strains are shown for comparison.
(C) cPrD-SUP35C strains with a coding sequence for Cerulean integrated at the 3' end of the corresponding
chromosomal gene were subjected to an SDD-AGE analysis in the respective [prd-c-] and [PrD-C+] states.
cPrD-Sup35C particles were detected with a C domain-specific anti-Sup35p antibody and the particles
containing Cerulean-tagged endogenous protein were detected with an anti-GFP antibody.
59
Figure 6. The transcription factor Mot3p is a prion
(A) A Mot3p-reporter strain is Ura+ when Mot3p is inactive. A dan1::URA3/DAN1 mot3::KanMX4/MOT3
diploid was sporulated and tetrads dissected. Shown are five-fold serial dilutions of four spores from a
tetratype tetrad, plated onto SD-CSM and SD-ura. Spore genotypes are as indicated.
(B) 5-fold serial dilutions of [mot3-] and [MOT3+] dan1::URA3 cells were spotted onto YPD and SD-ura.
(C) Lysates of diploid [mot3-] and [MOT3+] cells were investigated by SDD-AGE and Western blotting. Mot3p
was detected via its naturally occurring 6xHis motif using an anti-His antibody.
(D) Wildtype HSP104 yeast cells and HSP104-deleted yeast cells, each carrying plasmids for galactoseinducible expression of either Mot3PrD-EYFP or control protein EYFP, were compared for [MOT3+] induction.
Two transformants each were grown over night in galactose media, washed once in water, then plated at five
fold serial dilutions to SD-CSM or SD-ura plates.
(E) A [MOT3+] isolate was passaged three times on YPD plates or YPD plates containing GdnHCl, and then
grown over night in liquid YPD prior to spotting onto SD-ura plates.
(F) A [RNQ+] dan1::URA3 strain was converted to [rnq-] by four passages on GdnHCl-containing plates. The
[RNQ+] and [rnq-] strains were transformed with a Mot3PrD-EYFP plasmid and assessed for [MOT3+]
induction as in (D).
60
Figure 7. Mot3p and Swi1p form amyloid-based prions that can be beneficial
(A) Mot3PrD amyloid fibers used for fiber transformation experiments were added at 1% or 10% (w/w) to
fresh 20 µM Mot3PrD amyloid assembly experiments and monitored for acquisition of ThT fluorescence.
Shown are means of three replicates.
(B) Mot3PrD-M-His protein was polymerized and examined for a fibrillar amyloid morphology by
transmission electron microscopy (bar = 100 nm). [mot3-] spheroplasts were transformed with either soluble
(freshly diluted) or amyloid Mot3PrD-M-His protein and plated directly onto SD-ura plates containing 1 M
sorbitol.
(C) [MOT3+] and [mot3-] isolates were grown over night in YPD, then spotted (serial 5 fold dilutions) to SDura, YPD, or YPD containing calcofluor white (50 µg/ml) or congo red (500 µg/ml).
(D) Lysates of diploid [swi-] and [SWI+] cells carrying an integration of the coding sequence for EGFP at one of
the two chromosomal loci of the SWI1 gene were investigated by SDD-AGE and Western blotting. Swi1p-EGFP
fusion proteins were detected using an anti-GFP antibody.
(E) 5-fold serial dilutions of [swi-] and [SWI+] cells were spotted on YPD and YPD containing benomyl (5
mg/l).
61
Figure S1. Comparison of cPrD-EYFP expression levels
Yeast cells carrying expression plasmids for cPrD-EYFP fusion proteins were grown under inducing
conditions for 24 h. Subsequently, cell lysates were prepared and analyzed by Western blotting using an antiGFP antibody. Asterisks denote cPrDs with low expression levels that could only be detected with longer
exposure times (data not shown). Endogenous Rnq1p was detected with a Rnq1p-specific antibody and
served as a loading control.
62
Figure S2. Fluorescence microscopy of cPrD-EYFP proteins
cPrD-EYFP fusion proteins were expressed from a galactose-regulatable expression plasmid in yeast cells
containing the [RNQ+] prion. Cells were subjected to fluorescence microscopy after 24 hours. The
fluorescence of representative cells was recorded. Fluorescence images are shown together with DIC pictures
(insets). Arrows point to aggregates in the yeast cytosol. Expression levels of EYFP fusion proteins after 24 h
were assessed by Western blotting (Figure S1).
63
Figure S3. Most candidates tested positively in multiple assays
A Venn diagram is shown to illustrate the degree of overlap between the different assays employed in this
study. The blue circle represents the number of candidates that tested positively in the in vitro assembly
assay, the green circle represents the Sup35C prion assay data, the grey circle the microscopy data and the
red circle the SDD-AGE in vivo aggregation data after 48 h of expression.
64
Figure S4. Using Sup35p for prion detection
(A) Wild-type yeast cells were compared to SUP35-deleted yeast cells carrying a plasmid for expression of
Sup35p or NM-Sup35C from the SUP35 promoter. All three strains maintained the red colony color of the [psi] state and the white colony color of the [PSI+] state in a stable manner. This indicates that translation
termination is fully functional in the [psi-] state and that the [PSI+] prion can be stably propagated, despite
plasmid-based expression and the presence of a linker between the NM and C domains.
(B) NM-Sup35C or (C) N-Sup35C fusion proteins were expressed from plasmids carrying different promoters
(SUP35, ADH1, TEF2 and GPD) to determine optimal conditions for the Sup35p-based prion assay. Expression
of the fusion proteins was determined by Western blotting and detection with an anti-Sup35p antibody. The
blot was stripped and reprobed with an anti-Rnq1p antibody to confirm equal loading. Colony colors of the
corresponding strains are shown for comparison.
65
Figure S5. Candidate PrD-SUP35C strains display a variety of colony colors
Colonies of 90 cPrD-Sup35C-expressing strains growing on YPD plates (see Supplemental Experimental
Procedures for details of strain construction). [psi-] and [PSI+] cells are shown for comparison (upper left
corner). Some cPrDs, such as Nrp1p, New1p, Lsm4p and Nsp1p showed colony color switching under these
non-inducing conditions. The low basal activity of the cPrD-Sup35C fusions of Def1p, Nup116p, Psp2p,
Nup100p, Ddr48p and Rbs1p (indicated by the white colony color) prevented their subsequent use in prioninduction and selection assays.
66
Figure S6. Comparison of cPrD-Sup35C expression levels
Candidate PrD-SUP35C strains (Figure S5) were grown to mid-log phase and analyzed for the expression of
cPrD-Sup35C fusion proteins by Western Blotting and probing with a Sup35p-specific antibody. Endogenous
Rnq1p was detected with an anti-Rnq1p-antibody and served as a loading control. Colony colors of the
corresponding strains growing on YPD are shown for comparison.
67
Figure S7. SDD-AGE of cPrD-SUP35C strains
Candidate PrD-SUP35C strains (Figure S5) were grown to mid-log phase and analyzed by SDD-AGE and
Western blotting with a Sup35p-specific antibody. Colony colors of the corresponding strains growing on YPD
are shown for comparison. Only the cPrDs of Rnq1p, Lsm4p, Nup100p and Nsp1p showed detectable SDSresistant aggregation under these conditions. The aggregation of Rnq1p was by far the strongest, consistent
with it being the only pre-exising prion in this strain background. Lysates from wild-type [psi-] and [PSI+]
cells are shown for comparison.
68
Figure S8. Induction of the prion state in cPrD-SUP35C strains
Yeast strains expressing cPrD-Sup35C fusion proteins were transformed with galactose-regulatable plasmids
coding for corresponding cPrD-EYFP protein chimeras. The transformants were grown in galactosecontaining medium for 24 hours and were then plated on adenine-deficient medium (↑). The same strain
grown under non-inducing conditions (raffinose-containing medium) served as a control. The candidates
highlighted in red showed a detectable increase in the number of Ade+ colonies under inducing conditions.
69
Figure S9. Comparison of [prd-c-] and [PrD-C+] strains on YPD
Ade+ colonies from prion induction experiments (Figure S8) were re-streaked on YPD (bottom half of the
plates). [prd-c-] cells (top half of the plates) and wild-type [psi-] and [PSI+] strains (plate in the top left
corner) are shown for comparison.
70
Figure S10. SDD-AGE and GdnHCl curing of additional [PrD-C+] strains
(A) Cells lysates were prepared from [prd-c-] and [PrD-C+] strains and analyzed by SDD-AGE and Western
Blotting. The cPrD-Sup35C fusion proteins were detected using an anti-Sup35p antibody. Colony colors of the
corresponding [prd-c-] and [PrD-C+] strains growing on YPD are displayed above the SDD-AGE Western blots.
(B) [PrD-C+] strains were passaged three times on plates containing 5 mM GdnHCl and then spotted onto YPD
plates ('cured'). The corresponding [prd-c-] and [PrD-C+] strains are shown for comparison.
71
72
Figure S11. Plots of amino acid biases in core (A) and full-length (B) cPrDs
For each candidate the results from all four assays (see Table S2) were combined into a cumulative score.
Only candidates that could be tested in all four assays were used for analysis. For the fluorescence
microscopy and Sup35 prion assay results, positive candidates received 2 points and 0 points if they were
negative. Results from SDD-AGE (48 hours of induction) and in vitro assembly were treated as follows: All
candidates received points according to the scheme used in Table S2 (- = 0 points, + = 1 point, ++ = 2 points,
+++ = 3 points). Therefore, the maximum combined score is: 2 + 2 + 3 + 3 = 10. The combined score (x-axis)
was plotted against several other parameters on the y-axis. Parameters investigated were the relative
frequencies of single amino acids or combinations of amino acids (percent X or percent XY), length of the
cPrD, the number of occurrences of amphiphilicity patterns (count PHPH,HPHP, PHPHP and HPHPH, where H
stands for a hydrophobic amino acid and P for a polar amino acid according to the Kyte-Doolittle hydropathy
index (Kyte and Doolittle, 1982)). The graphs of the form log2(HP/eHP) show the log of the actual counts of
HP patterns divided by the expected counts given the amino acid composition and length (0.01 was added to
the numerator and denominator to avoid infinities). The graphs "non P" and "mask P" examine the influence
of proline abundance and spacing: "non P" shows the number of residues other than proline, and "mask P"
shows the number or residues remaining when prolines and any intervening sequences of length <5 are
removed. Spearman rank-correlations were computed using R, and p-values were computed by randomly
permuting the gene labels 10000 times. For 95% of these random permutations, none of the 35 associated pvalues was <0.002, so p-values <0.002 remain significant at the 0.05 level after accounting for the testing of
multiplenon-independent hypotheses.
73
Table S1. Prediction of cPrDs in the yeast proteome
Example of the output format of the cPrD prediction algorithm, here for Sup35p. The amino acid sequence of
the candidate proteins are shown at the bottom in single letter code. The core region of the cPrDs is
highlighted in orange and the extended region in pink. The top panel shows the probability of each residue
belonging to the HMM state “cPrD” (red) and “background” (black); the tracks “MAP” and “Vit” illustrate the
Maximum a Posteriori and the Viterbi parses of the protein into these two states. The lower panel shows
sliding averages over a window of width 60 of net charge (pink), hydropathy (blue), and predicted disorder
(gray) as in FoldIndex, along with a sliding average based on cPrD amino acid propensities (red).
74
75
Table S2. Comparison of different aggregation and prion assays
Prion candidates are ranked according to their highest scoring core cPrDs (left column). Data from
fluorescence microscopy, SDD-AGE analysis (after 48 hours of expression), Sup35C prion assay and in vitro
assembly assay are shown to allow comparison of the results. N/A (not applicable) indicates that these
experiments were not conducted for the following reasons: the cPrD could not be cloned (candidates shown
in grey), were recalcitrant to purification (in vitro aggregation), expression levels were too low (microscopy
and SDD-AGE) or the basal activity of the cPrD-Sup35C fusion protein was too low for selection. We used a
simple scheme (-, +, ++, +++) to categorize cPrDs depending on the extent and kinetics of aggregation.
Candidates in red are considered to be most promising for further characterization (they either showed
switching behavior or strong amyloid formation). Known prions are underlined.
76
Table S3. Gene-specific oligonucleotides for cPrD amplification
GeneID
YBR289W
GeneName
SNF5
Forward primer
AGGAGATAACAAAATGAATAATCAGCCGCAGGGTAC
YMR164C
MSS11
YBR112C
YBR016W
YLR206W
YNL161W
YDR172W
YMR043W
YGL122C
CYC8
YBR016W
ENT2
CBK1
SUP35
MCM1
NAB2
AGGAGATAACAAAATGTCTCAATCACCAGCACAGCCCC
AGGAGATAACAAAATGTCTCAACCTAATGATCAAGGAAATCCTTTGAACA
C
AGGAGATAACAAAATGTCTGCTAACGATTACTACGGC
AGGAGATAACAAAATGTGTAATTCTCAGGGTACAGGCTACAAACAG
AGGAGATAACAAAATGTATAATAGCAGCACCAATCATCATGAGG
AGGAGATAACAAAATGTCGGATTCAAACCAAGGCAAC
AGGAGATAACAAAATGTGTGGTAATGATATGCAACGCCAGC
AGGAGATAACAAAATGTCTAATGCGCAAAGCTTGGGAC
YKL054C
DEF1
AGGAGATAACAAAATGTGTCAAGCTAATACTGTACCTCAACCACAAC
YIL130W
YCL028W
YKL032C
YIL130W
RNQ1
IXR1
YDL035C
YOL051W
YIR006C
YPL226W
YPR042C
GPR1
GAL11
PAN1
NEW1
PUF2
AGGAGATAACAAAATGTCTAGCAATGCATCAAATAACTCCAACCC
AGGAGATAACAAAATGTGTAGTGGTTCTGGCGGCG
AGGAGATAACAAAATGAACACCGGTATCTCGCC
AGGAGATAACAAAATGTCTAACAACAACAATAACGATAACGATAACGATA
ACAATAATAG
AGGAGATAACAAAATGTCTCAACAACAGCAAATGGCAAACAAC
AGGAGATAACAAAATGTATAACCCGTACCAGCAACAGG
AGGAGATAACAAAATGTCTGGTAGTAATAACGCTTCCAAAAAAAGTAGC
AGGAGATAACAAAATGTGTAATTCCTACTTCAACAATCAACAAGTGGTG
YMR047C
NUP116
YDL167C
NRP1
YPL016W
SWI1
YEL007W
YBR108W
YMR263W
YOR197W
YDR145W
YDR213W
YDL012C
YGL181W
YPR022C
YHR135C
YEL007W
YBR108W
SAP30
MCA1
TAF12
UPC2
YDL012C
GTS1
YPR022C
YCK1
YDL005C
YIL105C
YGL025C
MED2
SLM1
PGD1
AGGAGATAACAAAATGTCTCAAGATTACCAAGCTGGTAGAAAATTCGG
AGGAGATAACAAAATGTCTTCGGGAAATAATAATATAGCCCCAAATTATC
G
AGGAGATAACAAAATGGATTTCTTTAATTTGAATAATAATAATAATAATAAT
AATAC
AGGAGATAACAAAATGTCTAATAATAACAATAATAATAGTAATAACAGTAG
TAATAG
AGGAGATAACAAAATGTCTGGACAAAAAACTTATACAGGACAACAGC
AGGAGATAACAAAATGTCTCAGGGTGGTGGTTACGCAAG
AGGAGATAACAAAATGTCTTATCCAGGTAGTGGACGTTACACC
AGGAGATAACAAAATGTCTCAAGAAAGCACTCAACAGCAACG
AGGAGATAACAAAATGTCTTCTGGAAATATGGGTGCGTTCC
AGGAGATAACAAAATGTCAGCTCAAGATTATTACGGAAACTC
AGGAGATAACAAAATGTGTCAGCAGCAATACGCCATGG
AGGAGATAACAAAATGTCTCAACAGGCTCAACAACCTCAACAG
AGGAGATAACAAAATGTCTAACAAACAGCTCCAAATGCAACAG
AGGAGATAACAAAATGTCTAACAACATAAATAATAATATCAATAGCACCAA
GAACGG
AGGAGATAACAAAATGTCTTCACAGCAACAGCTAAATCTTCAGC
AGGAGATAACAAAATGTCTCAAGCTCAGGCTCAAGCGC
YHR161C
YAP1801
AGGAGATAACAAAATGTGTAATCAAACGCAACAGATCGCAAATAAC
YPL089C
RLM1
YML017W
YKL068W
YOR048C
PSP2
NUP100
RAT1
YER112W
LSM4
AGGAGATAACAAAATGTCTGGACCCAACAGTGCCAAGC
AGGAGATAACAAAATGTGTTATAACGGAAACCATAATAACAATAATGGCA
ATTTTAGAG
AGGAGATAACAAAATGTTTGGCAACAATAGACCAATGTTTG
AGGAGATAACAAAATGTGTAATAATGTCCAACCCGCCCAC
AGGAGATAACAAAATGTGTCAGCAAATTAACTCCAACAATAACTCTAATAG
TAACG
YPL190C
YDL161W
YOR329C
YBL081W
NAB3
ENT1
SCD5
YBL081W
YGL066W
SGF73
YNL016W
PUB1
YOL123W
YNL208W
YMR016C
HRP1
YNL208W
SOK2
YPL184C
YNR052C
YPR154W
YMR070W
YBR059C
YGL014W
YDR228C
YHR149C
YPL184C
POP2
PIN3
MOT3
AKL1
PUF4
PCF11
SKG6
YHR082C
YLR191W
KSP1
PEX13
YMR173W
YFL024C
YGL049C
DDR48
EPL1
TIF4632
YNL298W
YPL204W
YOR290C
CLA4
HRR25
SNF2
AGGAGATAACAAAATGTCTGGGTTTTCCAACAACAACAATAAACAGTAC
AGGAGATAACAAAATGTCTTACGGTAATAGCAATTATGGGATACCCTATG
AGGAGATAACAAAATGTGTCAACAATTTTCTAATACCTCTATAAATGACAA
CGACTC
AGGAGATAACAAAATGTGTCAACATTTACAACAGCAACAACAACAGC
AGGAGATAACAAAATGACTGACCAAAGAGGTCCACC
AGGAGATAACAAAATGTCTCAAAATGTTCCCAACCAACAATATCCTAAGAT
G
AGGAGATAACAAAATGTGTCAACAGCAGCCGCAGC
AGGAGATAACAAAATGTCTCAATTTGCTGCCAAGCAGCG
YLR187W
YGL172W
YFL010C
YKL038W
YDL088C
SKG3
NUP49
WWM1
RGT1
ASM4
AGGAGATAACAAAATGTCTAACTTAAACCAGCTTACTTCGAATGGAG
AGGAGATAACAAAATGTTTGGATTAAATAAAGCATCTTCGACACC
AGGAGATAACAAAATGTCTCAACAGGCAGACCAGGCTC
AGGAGATAACAAAATGTCTGGTGGCCAGCCTCAGC
AGGAGATAACAAAATGTTTGGAATACGTTCAGGCAATAATAACG
YGL013C
YNL229C
YGR162W
YBL007C
YHR030C
PDR1
URE2
TIF4631
SLA1
SLT2
YGL215W
YNL243W
CLG1
SLA2
AGGAGATAACAAAATGTCTTACGCGCAACCAACAAATGG
AGGAGATAACAAAATGATGAATAACAACGGCAACCAAGTG
AGGAGATAACAAAATGTCTCAGCAGGAATCTCAGCAACAACG
AGGAGATAACAAAATGTGTGGAGGTGCGCAATTCCCG
AGGAGATAACAAAATGTCTCAAAGGCAATTACAATTACAGCAGCAG
AGGAGATAACAAAATGTCTTCTTATCAGAGTAACTCAAGGTCTGAATTTTC
TAG
AGGAGATAACAAAATGTCTCAGGCGACGGCACAAATG
AGGAGATAACAAAATGTGTCAGCAAAACATATATGGCGCTCC
AGGAGATAACAAAATGTCTCAAAGAATGCAACAACAGCAAGGC
AGGAGATAACAAAATGTGTCAGGCGCAATTTACGAACCAATC
AGGAGATAACAAAATGTCTCAGTCCAGTAATTCCTTCCAGTCTCAC
AGGAGATAACAAAATGTGTAACCAAAACCTCAATCCGAAACAAATACAAA
G
AGGAGATAACAAAATGTCTAACAATAACAATAATAATTATCAACAGCGTCG
TAACTAC
AGGAGATAACAAAATGTGTCAACAAAAATCATCAAACAATGGTGGTAACA
ATG
AGGAGATAACAAAATGTGTCAACAAGAGCAATACGGCAACTC
AGGAGATAACAAAATGTCTGGCCAGTCCACCCAACAG
AGGAGATAACAAAATGGTGGTTTCTTATAACAATAATAATAACAATAACAA
TAAC
AGGAGATAACAAAATGCAATCTATGAATGTACAACCGAGG
AGGAGATAACAAAATGTCTTCTGGGTCTAACGGTCCATCC
AGGAGATAACAAAATGAATGCGGACCATCACCTG
AGGAGATAACAAAATGTCTCAACAGCAAGGCCAGAGATATCAG
AGGAGATAACAAAATGTCTCAAAATCATATGCCGTTAATGAATAGCGC
AGGAGATAACAAAATGTCTCAAGTTCAAATGCAACTAAGGCAGG
AGGAGATAACAAAATGTCTCAGCCGTTGAATTATCAGGATCAATATCAAC
Reverse primer
CAAGAAAGCTGGGTCACATTGAGGAAGTTGGCCAATAGTGG
CAAGAAAGCTGGGTCACAATTGTTACGTGTATTAGATTGATAATTTTGATTTCC
AAG
CAAGAAAGCTGGGTCACAGTTCTGTTCCACGTTATGCTGGATTAAAG
CAAGAAAGCTGGGTCACAGTTACCCCTCTGGGGTGGTTG
CAAGAAAGCTGGGTCAAGATCAATTAAGCTTACACCTTGGTCAG
CAAGAAAGCTGGGTCACAACCATTATTAAAGCCGCTCTGAACG
CAAGAAAGCTGGGTCACACTGCTTTTGTTGCTTTTGAAAGTCGTTC
CAAGAAAGCTGGGTCGTATTGGCCTTGTTGCGGTTCTTG
CAAGAAAGCTGGGTCACAGGAATTATTGTTGCGTCCTCCACG
CAAGAAAGCTGGGTCGTAGAAACCTCTTGAATTTTTAGAATTGTAATCATAAC
CG
CAAGAAAGCTGGGTCACAATTATTATTTTTATTATTGTTATTATTGTTATTATTA
TTAC
CAAGAAAGCTGGGTCGTAGCGGTTCTGGTTGCCG
CAAGAAAGCTGGGTCACACTGTTGTTGCTGCTGTTGCTG
CAAGAAAGCTGGGTCTTGTTTGTAGGTTTGGGCTTGGAAATG
CAAGAAAGCTGGGTCACAATTGTTACCGGGTGCATTAGCC
CAAGAAAGCTGGGTCACATTGGTTTTGCGGTTGAAGGTAAAATC
CAAGAAAGCTGGGTCACATCCACTTTGGTTGGGCGTC
CAAGAAAGCTGGGTCATATCCGTATGACCTGTAGCGGTACAAAC
CAAGAAAGCTGGGTCACAATTAGTACCGTAGGGATTGTTATTCTGAATTTGTA
ATC
CAAGAAAGCTGGGTCGTTGGAGCCACATCCTCCC
CAAGAAAGCTGGGTCACATTGTTGTTGCTGCCGTTGAC
CAAGAAAGCTGGGTCACATTGGTGCTGGTGTTGATACATAGAC
CAAGAAAGCTGGGTCGTTTCCCTGTTGCATTGGTTGC
CAAGAAAGCTGGGTCGTACTGCTGTTGTGCAGCTG
CAAGAAAGCTGGGTCACATTGAGAATACTGATAAGGTTGGTCTGTACC
CAAGAAAGCTGGGTCACAATTCTGCTGCTGCTGCTGC
CAAGAAAGCTGGGTCGTTAGGTTGTTGCTCTTGCTGAAGC
CAAGAAAGCTGGGTCACAATTTCCAGAACTGGCCGGTTG
CAAGAAAGCTGGGTCTTGTGTGTAGAAATAACCTTGTGGCAGG
CAAGAAAGCTGGGTCACAATTCTGGGGTGGTAATTGTTGTTGTTG
CAAGAAAGCTGGGTCACATTGTTGTTGTGGTTGATAACGAGCG
CAAGAAAGCTGGGTCACAAGAATTGTTCTTGTTATTGCTGTCGTTG
CAAGAAAGCTGGGTCACATTGTTGTTGTTGCTGTTGCTGAG
CAAGAAAGCTGGGTCACACCCCCCGTTATTCATGTTATTCATGC
CAAGAAAGCTGGGTCCATATCAATTAAATTGAGGTTGTTAGCATATTGGTTTC
C
CAAGAAAGCTGGGTCACAATTATTACTATAGTAACTGTTATTGCTATTGTTACT
G
CAAGAAAGCTGGGTCTAAAGGCATGTCTGTTGTTCTGTTATTGTAG
CAAGAAAGCTGGGTCACAGTTTTGGGTGGTATTGTTCACAGGTG
CAAGAAAGCTGGGTCACGCCTATTTGCTCTTGAATTGTCATACCC
CAAGAAAGCTGGGTCAAATTCGACCTTTTGTGGAGAAGAGCTG
CAAGAAAGCTGGGTCTTTTTGTAGTTTTGCTAAACTATCTAATAGACTTTGAAC
ATTATTG
CAAGAAAGCTGGGTCACATGATTGATTGCCTGTCCTGTTTTGAATC
CAAGAAAGCTGGGTCTGGTCTCCTATTATATTGGATTTGTAAAGCATCGAC
CAAGAAAGCTGGGTCACAGCTTTGGTTGTATGGAGAGGATGAG
CAAGAAAGCTGGGTCATTTATTCTGCCATTGTAGGGGTTCACAG
CAAGAAAGCTGGGTCACATTGAGGATTTACTTGAGGAGGTAAACCAATG
CAAGAAAGCTGGGTCCCTATTATATGGATGGTAGCCATTATTACGTCTATTG
CAAGAAAGCTGGGTCCCAACGTGAACCGCCATTG
CAAGAAAGCTGGGTCACACTGTTGTTGTTGCTGAGGCG
CAAGAAAGCTGGGTCACAATTACCATTCATAGGATACACAGCATCGC
CAAGAAAGCTGGGTCACAATTGAGTCCCACTCCCTGCTG
CAAGAAAGCTGGGTCACATGAGCTCTGATGTTGTTGTTGTTGTTG
CAAGAAAGCTGGGTCACATTGTGCCGGGTTAATATTGAGATTCAAATTTG
CAAGAAAGCTGGGTCACAACCATTATTATTTGCATTTTGAATTTGCATTTGC
CAAGAAAGCTGGGTCACAGCTGTTGCTGTTGGTAGCATTAC
CAAGAAAGCTGGGTCACAAGAATTCTGTTGGTTCGTTGTATCTGAATTATTTC
CAAGAAAGCTGGGTCACACTGAGGATGATTATGTTGCTGTTGTTGAG
CAAGAAAGCTGGGTCACAATAACCATTTATAGAACTATTGTTGTTATGATTATA
GCTC
CAAGAAAGCTGGGTCACAACCTAGTCCACTTCCATTATTCATTCCATATC
CAAGAAAGCTGGGTCGTAATCGTCGTCACCACCGTATTG
CAAGAAAGCTGGGTCTGATGAATTTTTCTGGGTTATAGAAGAGTTCTG
CAAGAAAGCTGGGTCACATTGTTGGGGTATATAATACATCTGAGGAGC
CAAGAAAGCTGGGTCACATTGAGGTTGAAAGTGTGCGGC
CAAGAAAGCTGGGTCCAACCAAATTGACTGGCCAGCTG
CAAGAAAGCTGGGTCACACCCCTGTTGCAGTCTCGC
CAAGAAAGCTGGGTCACAATTATTCAAATATCTCATATTTTGAGGCTGTTGTTG
C
CAAGAAAGCTGGGTCCTGAGATAGATTTTGCAATGCGCAC
CAAGAAAGCTGGGTCACATCCACCTAACAAACCCGCAC
CAAGAAAGCTGGGTCACATTGGGAATGTTGAGATGTATCCTTAGAAGAAC
CAAGAAAGCTGGGTCACAATTATTCACCCAGCTAGGATTATTCCCTTG
CAAGAAAGCTGGGTCACAATTGTTACTGTTGTTGTTGTTAATATTGTTAATATT
G
CAAGAAAGCTGGGTCACACTGTTGTTGTTGTCGATGTTGTTCTAAGG
CAAGAAAGCTGGGTCACAATTAGCAGGGGCACTACCAGC
CAAGAAAGCTGGGTCGAATCCAAACGGATTTGATGCAGTAGC
CAAGAAAGCTGGGTCACAATTTTGGGAGTGAATACCAAATGATTCTTGTTG
CAAGAAAGCTGGGTCACATTGTTTTTGTTGTTGCTGTTGTTGTTG
CAAGAAAGCTGGGTCACACTGCTGCACTCTTTGGTCATATTGC
77
YOR113W
YPR129W
YJL141C
YLR177W
YAL021C
YGR119C
YNL288W
YDR293C
YNL251C
YBR212W
YJR091C
AZF1
SCD6
YAK1
YLR177W
CCR4
NUP57
CAF40
SSD1
NRD1
NGR1
JSN1
YDL189W
RBS1
YDR081C
YOL004W
YJL041W
YOR359W
PDC2
SIN3
NSP1
VTS1
YHL024W
YDR505C
YGR241C
YMR124W
YDR432W
RIM4
PSP1
YAP1802
YMR124W
NPL3
AGGAGATAACAAAATGCCTCCTCCAACTGCAC
AGGAGATAACAAAATGTGTGGCCTCGGTCGTGGG
AGGAGATAACAAAATGAACTCATCCAATAATAACGACTCGTCC
AGGAGATAACAAAATGTCTAACAACAGCTCCCAAAAATACTATCCAC
AGGAGATAACAAAATGAACGACCCTTCTTTACTAGGCTAC
AGGAGATAACAAAATGTTTGGTTTCAGCGGTAGTAATAACG
AGGAGATAACAAAATGTTTTCCGCTCAAAAGCCAATATATGG
AGGAGATAACAAAATGTCTAAAAATAGCAACGTTAACAACAATAGATCC
AGGAGATAACAAAATGTGTCAGCAATATGTGCAACCTATGATGC
AGGAGATAACAAAATGTCTCAGCAGCAGCAGCAGC
AGGAGATAACAAAATGTCTCAACAACCCCCACAATTTCTTCTCAATTC
AGGAGATAACAAAATGTCTCAAGTAAACAAACCTCAACAACAATTTTATGA
TAGTC
AGGAGATAACAAAATGTCTAATAATCAAAATCATTTAAGCATGTCACAAGC
TAGC
AGGAGATAACAAAATGTCTTCTTCAGCTTCTGCCAATCAGC
AGGAGATAACAAAATGAACTTCAATACACCTCAACAAAACAAAAC
AGGAGATAACAAAATGTCTCAATCTTCTGCCATAAACAAGAACAATCCG
AGGAGATAACAAAATGTCTTCATCTGGTAGATATAATGCTGCTAATTCCTT
TAC
AGGAGATAACAAAATGTCTAATCAACAACAGCAACCGTTTTCTC
AGGAGATAACAAAATGTGTCAACAATTACAAAACCAACAGTTGCTCATTTC
AGGAGATAACAAAATGTCTCAAAGTTTCCCGAATGGTAATCCTTTAATGC
AGGAGATAACAAAATGTCTTCAAATAGAGGTGGCTTCAGAGGTC
YER040W
YDR192C
GLN3
NUP42
AGGAGATAACAAAATGTCTCAATACAACCACGGTTCCCTCG
AGGAGATAACAAAATGTCTGGTTCACTGCAACAAAACGCATC
CAAGAAAGCTGGGTCACAGTACGGGTTCTGATTAGAATTACTGTTGTTTG
CAAGAAAGCTGGGTCAAATTCAACGTTGGAAGGAGGTTGCG
CAAGAAAGCTGGGTCACATTGAGAATTCTGTTGTTGTTGTTGTTGC
CAAGAAAGCTGGGTCACACTGGGTGTTGCGCCTAGC
CAAGAAAGCTGGGTCACACCCGCTTCCACCGCC
CAAGAAAGCTGGGTCACACTGTTCTTGAATTTGCTGCGGATAATTAG
CAAGAAAGCTGGGTCACAGCCTCTATTATTGACCATGTTGGGATTG
CAAGAAAGCTGGGTCACATGAGTTAGACCCAGGATTATTGCTATTGTTATTG
CAAGAAAGCTGGGTCGCTTTGTTGTTGTTGCTGCTGC
CAAGAAAGCTGGGTCACAATACATATTTGCACCGTTTCCCATTCC
CAAGAAAGCTGGGTCACAATTTGCTGAGTTATTGTTGTTTCCGTG
CAAGAAAGCTGGGTCACCAGAATATGAATTTTTTCCTTGAAAATGGTGG
CAAGAAAGCTGGGTCACAATTTGGTTGTCCAGGGTTACCTG
CAAGAAAGCTGGGTCACATTGCATGTGCTGTTGATCCTGATAG
CAAGAAAGCTGGGTCACAATTCGCATTTGCGGTAGCG
CAAGAAAGCTGGGTCATTTTGTTGGCTGCTGTTCAGC
CAAGAAAGCTGGGTCACAATTTCCAGCAGAACCTTGAGAAGG
CAAGAAAGCTGGGTCACATTGTTGTGGTTGTTGTGGTTGTTG
CAAGAAAGCTGGGTCTATATCTATTAAGTTAGGATTTTCTTGCTGATGCTGC
CAAGAAAGCTGGGTCACAATTAAACCCTTGGGGAACGTTCTG
CAAGAAAGCTGGGTCACAATAACCACCTCTTGAACCACCG
CAAGAAAGCTGGGTCACACTGGATATTACTATTGTTGCTATTATTATTATTGGT
AATG
CAAGAAAGCTGGGTCACAATTAGCGTTGACATTAGTAGCATTCATCTG
Other oligonucleotides used
Name
SUP35-XhoI
RevSUP35-KO
Sequence
GATAGTGTCTCGAGTTACTCGGCAATTTTAACAATTTTACC
GCAGTACGAAGCTTAGGTGGACCAGGTGGTGGAAGTGCTGATGCCTTGA
TCAAGG
GCAGTACGGAGCTCAAGATATCCATCATATTACCATTGTAATAC
GCAGTACGACTAGTTGTTGCTAGTGGGCAGATATAGAT
CGACTTGCTCGGAATAACATCTATATCTGCCCACTAGCAACAATGCAGCT
GAAGCTTCGTACGC
TCGGTATTATTGTGTTTGCATTTACTTATGTTTGCAAGAAATTTAGCATAG
GCCACTAGTGGATCTG
GW-univ-sense
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAACAAAATG
GW-univ-antisense
GGGGACCACTTTGTACAAGAAAGCTGGGTC
GAACAATCTGGAATTAGGTGGTCTGAACATGGATTTCTTGGGTCGACGGA
TCCCCGGG
TATACAGATAATTACTATCTTGGATACATAGATGCACCAGATCGATGAATT
CGAGCTCG
TAATGATACAAGTTTGTACCGCTACAGGTCATACGGATATGGTCGACGGA
TCCCCGGG
AAAAAAAAGTTTAATAGAACAGAATGATTAAAATCATTAGATCGATGAATT
CGAGCTCG
TAGCGCTTTCGGTAATGGTTTTAATAGTTCAATACGTTGGGGTCGACGGA
TCCCCGGG
ATGTGGTTGTGTGAAATTTATTGACCTCGCCTGTTCCTAAATCGATGAATT
CGAGCTCG
ACCCTTTGGCATTTGGAATACTGACATGAGCGTTTGGAGTGGTCGACGG
ATCCCCGGG
ACTAATGATAATAATATACATAAAAATATACGTAAACATCATCGATGAATTC
GAGCTCG
TGGCAAGGATAGATGTGGTAACGTCCCCCACCAATCACGTGGTCGACGG
ATCCCCGGG
TAAACATCTACGTACATACATATACATATATACATAATGTATCGATGAATTC
GAGCTCG
ACAATACAAGAATAATTGGTTAATTTTACAGCAACAAGACGGTCGACGGA
TCCCCGGG
AAGAAAATAATAAGCAACATAACAGAGGGAATAGGTGCGCATCGATGAAT
TCGAGCTCG
GCACAAACTGAGTAATTGGTTATTTGGTTGGAATGACCTAGGTCGACGGA
TCCCCGGG
TATTGTAAATGTTCATGAATAATTAGCTGGACGATTTCTGATCGATGAATT
CGAGCTCG
GATGAGAAGACCCGCGGTCATCAAGGCATTGCGTGGTGAAGGTCGACG
GATCCCCGGG
TTTCCTCCTTCTTCTTTCTTTCTTGTTTTTAAAGCAGCCTATCGATGAATTC
GAGCTCG
CCCTCTAGAAATAATTTTGTTTAACTTTAA TATACAATCAACAAGTTTG
CAAACTTGTTGATTGTATATTAAAGTTAAACAAAATTATTTCTAGAGGG
CTTGTACAAAGTGGTTGATAAC TGG CATCATCACCATCACCACCATTAAG
CTTAATGGTGGTGATGGTGATGATGCCAGTTATCAACCACTTTGTACAAG
CTTGTACAAAGTGGTTGATAAC CATATG TGG
CATCATCACCATCACCACCATTAAG
CTTAATGGTGGTGATGGTGATGATGCCACATATGGTTATCAACCACTTTGT
ACAAG
GATACA CATATG TCTTTGAACGACTTTCAAAAGCAAC
GATACA CATATG ATCGTTAACAACTTCGTCATCCACTTC
GTACAAAGTGGTTGATAAC TCTTTGAACGACTTTCAAAAG
CTTTTGAAAGTCGTTCAAAGAGTTATCAACCACTTTGTAC
CGAAGTTGTTAACGATTGGCATCATCACCATCAC
GTGATGGTGATGATGCCAATCGTTAACAACTTCG
GACGAAGTTGTTAACGAT TCGTACTACCATCACC
GGTGATGGTAGTACGAATCGTTAACAACTTCGTC
TTTTTCAGATAAAAGTGTAGCATACTAAATATATACCCCAAGTA
ATGTCGAAAGCTACATATAAGGAAC
TCAATTATTTTACATCATTTATACAACTGTACAGGGCCGCACATGATCA
GCATAGGCCACTAGTGGATC
AAGTTTCATGTTTCCTGCGC
GCGGCTTAACTGTGCCCTCC
SUP35C-Gly-HindIII
SUP35Prom-SacI
SUP35CProm-SpeI
ForwSUP35-KO
PGD1-Ceru-FW
PGD1-Ceru-RV
PUF2-Ceru-FW
PUF2-Ceru-RV
NRP1-Ceru-FW
NRP1-Ceru-RV
YBL081W-Ceru-FW
YBL081W-Ceru-RV
YPL184C-Ceru-FW
YPL184C-Ceru-RV
KSP1-Ceru-FW
KSP1-Ceru-RV
ASM4-Ceru-FW
ASM4-Ceru-RV
URE2-Ceru-FW
URE2-Ceru-RV
065noRBSf
065noRBSr
067WF
067WR
067Nde1WF
067Nde1WR
Nde1Mf
Nde1Mr
068delNde1for
068delNde1rev
068delNde1for2
068delNde1rev2
dest17MdelNde1for
dest17MdelNde1rev
5dan1p-ura3
3dan1p-ura3
dan1upseq
URA3-1-3
Function
Construction of pAG4xx-ccdB-SUP35C
Construction of pAG4xx-ccdB-SUP35C
Construction of pAG4xxSUP35-ccdB-SUP35C
Construction of pAG4xxSUP35-ccdB-SUP35C
Knock out of the SUP35 gene
Knock out of the SUP35 gene
Universal sense primer for 2nd round amplification of PCR fragments for Gateway
cloning
Universal antisense primer for 2nd round amplification of PCR fragments for
Gateway cloning
Forward primer for Cerulean integration at PGD1 locus
Reverse primer for Cerulean integration at PGD1 locus
Forward primer for Cerulean integration at PUF2 locus
Reverse primer for Cerulean integration at PUF2 locus
Forward primer for Cerulean integration at NRP1 locus
Reverse primer for Cerulean integration at NRP1 locus
Forward primer for Cerulean integration at YBL081W locus
Reverse primer for Cerulean integration at YBL081W locus
Forward primer for Cerulean integration at YPL184C locus
Reverse primer for Cerulean integration at YPL184C locus
Forward primer for Cerulean integration at KSP1 locus
Reverse primer for Cerulean integration at KSP1 locus
Forward primer for Cerulean integration at ASM4 locus
Reverse primer for Cerulean integration at ASM4 locus
Forward primer for Cerulean integration at URE2 locus
Reverse primer for Cerulean integration at URE2 locus
Forward primer for removal of Shine-Dalgarno site from pAED4-ccdb-his7
Reverse primer for removal of Shine-Dalgarno site from pAED4-ccdb-his7
Forward primer for addition of Trp codon to pAED4-ccdb-his7
Reverse primer for addition of Trp codon to pAED4-ccdb-his7
Forward primer for addition of Nde1 site to pRH1
Reverse primer for addition of Nde1 site to pRH1
Forward primer for insertion of Sup35M at Nde1
Reverse primer for insertion of Sup35M at Nde1
Forward primer for removal of 5' Nde1 site from pRH2
Reverse primer for removal of 5' Nde1 site from pRH2
Forward primer for removal of 3' Nde1 site from pRH2
Reverse primer for removal of 3' Nde1 site from pRH2
Forward primer for removal of 3' Nde1 site from pRH3
Reverse primer for removal of 3' Nde1 site from pRH3
Forward primer for integration of Ura3-His5 cassette at DAN1
Reverse primer for integration of Ura3-His5 cassette at DAN1
Used with URA3-1-3 to confirm Ura3-His5 integration at DAN1
Used with dan1upseq to confirm Ura3-His5 integration at DAN1
78
Table S4. Yeast Strains
Name
YRS098
YRS099
YRS100
YRS101
YRS102
YRS103
YRS104
YRS105
YRS106
YRS107
YRS108
YRS109
YRS110
YRS111
YRS112
YRS113
YRS114
YRS115
YRS116
YRS117
YRS118
YRS119
YRS120
YRS121
YRS122
YRS123
YRS124
YRS125
YRS126
YRS127
YRS128
YRS129
YRS130
YRS131
YRS132
YRS133
YRS134
YRS135
YRS136
YRS137
YRS138
YRS139
YRS140
YRS141
YRS142
YRS143
YRS144
YRS145
YRS146
YRS147
YRS148
YRS149
YRS150
YRS151
YRS152
YRS153
YRS154
YRS155
YRS156
YRS157
YRS158
YRS159
YRS160
YRS161
YRS162
YRS163
YRS164
YRS165
YRS166
YRS167
YRS168
YRS169
YRS170
YRS171
YRS172
YRS173
YRS174
YRS175
YRS176
YRS177
YRS178
YRS179
YRS180
YRS181
YRS182
YRS183
YRS184
YRS185
YRS186
YRS187
YRS188
YRS189
YRS190
YRS191
YRS192
Genotype
MATα, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [pin-]
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG426GPD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SNF5PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-MSS11PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-CYC8PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YBR016WPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-ENT2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-CBK1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SUP35PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-MCM1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NAB2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-DEF1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-RNQ1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-GPR1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-GAL11PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PAN1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NEW1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PUF2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NUP116PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NRP1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SWI1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YBR108WPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SAP30PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-MCA1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-TAF12PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-UPC2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-GTS1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YPR022CPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YCK1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-MED2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SLM1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PGD1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YAP1801PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-RLM1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PSP2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NUP100PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-RAT1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-LSM4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NAB3PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-ENT1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SCD5PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YBL081WPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SGF73PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PUB1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SOK2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YPL184CPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-POP2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PIN3PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-MOT3PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-AKL1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PUF4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PCF11PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SKG6PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-KSP1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PEX13PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-EPL1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-TIF4632PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-CLA4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-HRR25PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SNF2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SKG3PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NUP49PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-WWM1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-RGT1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-ASM4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PDR1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-URE2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-TIF4631PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SLA1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SLT2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-CLG1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SLA2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-AZF1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SCD6PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YAK1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YLR177WPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-CCR4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NUP57PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-CAF40PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SSD1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NRD1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NGR1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-JSN1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-RBS1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PDC2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SIN3PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NSP1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-VTS1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-RIM4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PSP1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YAP1802PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YMR124WPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-GLN3PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NUP42PrD-SUP35C
Construction
Osherovich et al., 2004
Osherovich et al., 2004
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
plasmid shuffle using YRS100
79
YRS193
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; URE2::Cerulean-HphMX4; pAG415ADHURE2PrD-SUP35C
integrated Cerulean-HphMX4 at
URE2 locus in YRS165
YRS194
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; NRP1::Cerulean-HphMX4; pAG415ADHNRP1PrD-SUP35C
integrated Cerulean-HphMX4 at
NRP1 locus in YRS118
YRS195
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; ASM4::Cerulean-HphMX4; pAG415ADHASM4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; PGD1::Cerulean-HphMX4; pAG415ADHPGD1PrD-SUP35C
integrated Cerulean-HphMX4 at
ASM4 locus in YRS163
integrated Cerulean-HphMX4 at
PGD1 locus in YRS130
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; YPL184C::Cerulean-HphMX4; pAG415ADHYPL184CPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; KSP1::Cerulean-HphMX4; pAG415ADHKSP1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; PUF2::Cerulean-HphMX4; pAG415ADHPUF2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; YBL081W::Cerulean-HphMX4; pAG415ADHYBL081WPrD-SUP35C
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 anb1::ura3-SpHIS5 [PIN+]
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 dan1::ura3-SpHIS5 [PIN+]
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 dan1::ura3-SpHIS5 [pin-]
his3Δ1 leu2Δ0 ura3Δ0 dan1::ura3-HIS5 mot3::KanMX4
integrated Cerulean-HphMX4 at
YPL184C locus in YRS144
integrated Cerulean-HphMX4 at
KSP1 locus in YRS152
integrated Cerulean-HphMX4 at
PUF2 locus in YRS116
integrated Cerulean-HphMX4 at
YBL081W locus in YRS140
YRS098 anb1::ura3-SpHIS5
YRS098 dan1::ura3-SpHIS5
YRS202 passaged 4x on GdnHCl
sporulant of diploid of YRS202 x
BY4741 mot3::KanMX4
MATa; leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; dan1::ura3-HIS5
MATa; leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [pin-]; dan1::ura3-HIS5
MATa; leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; dan1::ura3-HIS5; [MOT3+]
MATa/α; leu2-3,112/leu2-3,112; his3-11,-15/his3-11,-15; trp1-1/trp1-1; ura3-1/ura3-1; ade1-14/ade1-14; can1-100/can1-100; [psi-]; [PIN+];
DAN1/dan1::ura3-HIS5; [MOT3+]
MATa/α; leu2-3,112/leu2-3,112; his3-11,-15/his3-11,-15; trp1-1/trp1-1; ura3-1/ura3-1; ade1-14/ade1-14; can1-100/can1-100; [psi-]; [PIN+];
DAN1/dan1::ura3-HIS5; [mot3-]
MATa; leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; dan1::ura3-HIS5; hsp104::KanMX4
MATa/α; leu2-3,112/leu2-3,112; his3-11,-15/his3-11,-15; trp1-1/trp1-1; ura3-1/ura3-1; ade1-14/ade1-14; can1-100/can1-100; [PSI+]; [PIN+]; [swi-];
SWI1/swi1::Cerulean-HphMX4
MATa/α; leu2-3,112/leu2-3,112; his3-11,-15/his3-11,-15; trp1-1/trp1-1; ura3-1/ura3-1; ade1-14/ade1-14; can1-100/can1-100; [PSI+]; [PIN+]; [SWI+];
SWI1/swi1::Cerulean-HphMX4
YRS099 dan1::ura3-SpHIS5
YRS205 passaged 4x on GdnHCl
YRS205 URA+
YRS207 x 4712
YRS196
YRS197
YRS198
YRS199
YRS200
YRS201
YRS202
YRS203
YRS204
YRS205
YRS206
YRS207
YRS208
YRS209
YRS210
YRS211
YRS212
YRS213
YRS214
YRS215
YRS216
YRS217
YRS218
YRS219
YRS220
YRS221
YRS222
YRS223
YRS224
YRS225
YRS226
YRS227
YRS228
YRS229
YRS230
YRS231
YRS232
YRS233
YRS234
YRS235
YRS236
YRS237
YRS238
YRS239
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YBR016WPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-CBK1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SUP35PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-GPR1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NEW1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PUF2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NRP1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SWI1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-SAP30PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YPR022CPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PGD1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-RLM1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-LSM4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YBL081WPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-PUB1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-YPL184CPrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-KSP1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-ASM4PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-URE2PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-NSP1PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415ADH-GLN3PrD-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415SUP-NM-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415SUP-NM(Q-N)-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415SUP-NM(N-Q)-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415SUP-NM-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415SUP-NM(Q-N)-SUP35C
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-]; [PIN+]; sup35::KanMX4; pAG415SUP-NM(N-Q)-SUP35C
YRS205 x 4712
YRS205 hsp104::KanMX4
[YBR016WPrD-C+]
[CBK1PrD-C+]
[SUP35PrD-C+]
[GPR1PrD-C+]
[NEW1PrD-C+]
[PUF2PrD-C+]
[NRP1PrD-C+]
[SWI1PrD-C+]
[SAP30PrD-C+]
[YPR022CPrD-C+]
[PGD1PrD-C+]
[RLM1PrD-C+]
[LSM4PrD-C+]
[YBL081WPrD-C+]
[PUB1PrD-C+]
[YPL184CPrD-C+]
[KSP1PrD-C+]
[ASM4PrD-C+]
[URE2PrD-C+]
[NSP1PrD-C+]
[GLN3PrD-C+]
[psi-]
[psi-]
[psi-]
[PSI+]
[PSI+]
[PSI+]
80
Table S5. Comparison of median amino acid frequencies
Candidates PrDs were split into a positive (cPrDs that satisfied the criteria of the assay) and a negative (cPrDs
that did not satisfy the criteria) set. The sequences of the complete PrDs and the core PrDs of the two groups
were used to calculate the median amino acid frequencies. Amino acids are shown in the left column in single
letter code. QN refers to the combined median frequency of Qs and Ns.
81
82
Chapter Three
Opposing Effects of Glutamine and Asparagine
Dictate Prion Formation by Intrinsically
Disordered Proteins
This chapter has been submitted for publication: Halfmann, R.*, Alberti, S.*, Krishan, R., Lyle, N.,
O’Donnell, C., King, O., Berger, B., Pappu, R., and Lindquist, S.
*equal authorship
83
SUMMARY
The conformational flexibility and exceptional hydrogen-bonding capacity of glutamine- and
asparagine-rich polypeptides allows them to switch between disordered states and self-templating
amyloids. Such transitions influence human protein-folding diseases, the assembly of biofilms and
the formation of protein-based genetic elements (prions). A systematic survey for prion-forming
domains suggested, unexpectedly, that glutamine (Q) and asparagine (N) residues have distinct
effects on amyloid formation. To investigate, we used cell biological, biochemical, and
computational techniques to compare Q/N-rich protein variants wherein Ns were replaced with Qs
or Qs with Ns. Qs and Ns had strong and opposing effects: N-richness promoted the rapid assembly
of benign self-templating amyloids; Q-richness promoted the formation of toxic non-amyloid
conformers. Molecular simulations suggest that these effects derive from the enhanced turnforming propensity of Ns relative to Qs. The disparate behavior of these two chemically similar
amino acids profoundly shapes the functionality of Q- and N-rich proteins.
INTRODUCTION
Proteins with little to no regular secondary structure, or intrinsically disordered proteins
(Radivojac et al., 2007), are abundant in eukaryotic proteomes. They play critical roles in gene
regulation, signaling, and intracellular transport and are often centrally located in protein
interaction networks (Turoverov et al., 2010). Structural disorder promotes interaction
promiscuity, a property that is necessary for the function of these proteins. But this can also pose a
tremendous burden for cellular protein homeostasis (Gsponer et al., 2008; Vavouri et al., 2009).
Intrinsically disordered proteins tend to have low complexity sequences that are depleted of orderpromoting hydrophobic residues (Romero et al., 2001).
Of particular interest are a subset of low complexity proteins enriched in the polar
uncharged residues glutamine (Q) and asparagine (N). Despite their general tendency toward
disorder (Weathers et al., 2004; Pierce et al., 2005; Toombs et al., 2010), Q/N-rich sequences
nevertheless, on occasion, self-assemble into some of the most highly-ordered structures in biology
– amyloids (Perutz et al., 2002; Uversky, 2008; Alberti et al., 2009). Amyloids are pseudocrystalline
fibrillar polymers stabilized by extensive intermolecular hydrogen-bonding between individual
polypeptide monomers (Nelson and Eisenberg, 2006). During amyloid formation, Q/N-rich proteins
transition from one extreme of conformational space to the other. The transition involves a collapse
84
of disordered monomers into molten oligomers, which then undergo an internal disorder-to-order
transition that produces an elongation-competent species (Krishnan and Lindquist, 2005;
Mukhopadhyay et al., 2007; Walters and Murphy, 2009; Williamson et al., 2010).
Several protein misfolding diseases, including Huntington’s disease and multiple
spinocerebellar ataxias, are associated with the aggregation of polyQ sequences. Both the severity
of the disease and the tendency to aggregate are correlated with the length of the polyQ tract
(Perutz and Windle, 2001). Q-rich and N-rich proteins can also undergo conformational switches to
amyloid under non-pathological conditions, and in some cases these amyloids have important
biological roles. Among such functional amyloids, extracellular adhesins of bacteria constitute an
ancient and broadly distributed class of proteins that act as structural scaffolds for biofilm
formation (Larsen et al., 2007; Hammer et al., 2008; Dueholm et al., 2010). For these intrinsically
disordered proteins, the initial switch from disorder to amyloid is carefully orchestrated by a
dedicated nucleation machinery on the cell surface (Wang et al., 2008). Another class of Q/N-rich
proteins can serve as “protein only” elements of inheritance when they switch at a low frequency to
the amyloid state. The latter, known as prions, are united only by the extraordinary ability of their
amyloid conformations to perpetuate through a self-templating protein folding reaction that
heritably alters protein function (Glover et al., 1997; Alberti et al., 2009).
In the baker’s yeast Saccharomyces cerevisiae, in which Q/N-rich prions have been
characterized most extensively, the self-templating reaction goes on for generation after generation
and causes a wide variety of heritable phenotypes. Prion phenotypes can result either from the
inactivation of the prion protein’s normal function, or from novel functions acquired by the protein
in its prion conformation (Halfmann et al., 2010; Rogoza et al., 2010; Si et al., 2010). Unlike the
mammalian prion, yeast prions are not overtly detrimental. On the contrary, phenotypic diversity
generated by prion switching may facilitate the ability of yeast to survive and adapt to rapid
changes in their natural microbial environments (True and Lindquist, 2000; Halfmann et al., 2010).
A recent genome-wide survey found that prion-forming proteins were more likely to be N-
rich than Q-rich (Alberti et al., 2009). This observation was unexpected, as it challenged the
common assumption that Ns and Qs are functionally equivalent for prion formation (see for
example Michelitsch and Weissman, 2000; Osherovich et al., 2004; Ross et al., 2005a). It was
subsequently suggested that the observed bias was better explained by the abundance of structurebreaking proline residues in the Q-rich sequences that happen to have been tested (Toombs et al.,
2010). Here, we provide an in-depth analysis of the contributions of N- and Q-richness alone to
85
prion formation. We find that the molecular distinction between these residues has decisive
functional consequences for Q/N-rich disordered proteins.
RESULTS
Q and N have disparate effects on prion formation by Sup35
To compare the effects of Ns and Qs on prion formation, we generated two variants of the
amyloidogenic prion domain (PrD) of the yeast prion protein Sup35. Normally, 15% of the residues
in this PrD are Ns and 29% are Qs (Sup35WT). In the two modified variants, either all Q residues
were replaced with Ns (Sup35N), or all N residues were replaced with Qs (Sup35Q) (Figure 1A). The
sequences were otherwise identical.
We first analyzed the propensity of these proteins to form alternative self-propagating
conformations in vivo, using a phenotypic reporter for prion formation that is based on changes in
the activity of Sup35 (Alberti et al., 2009). Sup35 is a translation termination factor; the prion
switch reduces its activity, causing ribosomes to read through stop codons at an increased
frequency. In yeast bearing a premature stop codon in the ADE1 gene, read through changes colony
color from red to white and allows growth in the absence of adenine. Each Sup35 variant (WT, N, or
Q) was constitutively expressed in strains lacking endogenous Sup35. All chimeric proteins
accumulated to similar levels (Figure S2A) and yielded a comparable red colony color. That is, all
possessed normal Sup35 activity and could stably maintain a soluble non-prion state (Figure S2B).
The spontaneous rate of prion formation by Sup35 is normally quite low (~ one in 106 cells;
Lancaster et al., 2010) with endogenous expression levels. To allow a more meaningful comparison
between variants, we increased the likelihood of prion conversion by transiently over-expressing
each PrD variant as an EYFP fusion from a strong inducible promoter (GAL1, Figure S1A). This
resulted in the expected increase in white Ade+ colonies for Sup35WT. For Sup35N white Ade+
colonies were even more frequent but for Sup35Q they were essentially absent (Figure 1B).
To confirm that the white Ade+ colonies are due to prion formation, we tested their
dependence on Hsp104, a AAA+ ATPase whose amyloid-fragmenting activity is critical for prion
propagation (Chernoff et al., 1995). We passaged presumptive prion colonies of Sup35WT and
Sup35N on media containing a low concentration of guanidine hydrochloride, which selectively
inhibits Hsp104’s ATPase activity (Grimminger et al., 2004). Indeed, this treatment restored cells to
their original red phenotype (Figure 1C). This was not due to off-target effects of GdnHCl, as genetic
ablation of HSP104 had the same effect (Figure 1C). Thus, the increased appearance of nonsense86
suppression phenotypes in Sup35N cells results from accelerated acquisition of self-propagating
prion conformers. The few white Sup35Q colonies proved not to be due to prions.
Another regulator of yeast prions is the prion-inducing factor [RNQ+], which is itself a prion
conformer of the Rnq1 protein. [RNQ+] strongly promotes other proteins like Sup35 to convert de
novo to their own prion states (Derkatch et al., 2001). But once formed, Sup35 prions do not require
this factor for their continued propagation. When [RNQ+] was eliminated by gene deletion, pre-
existing Sup35WT and Sup35N prions were not affected (Figure 1C). De novo prion induction was
eliminated in Δrnq1 cells expressing Sup35WT (Figure S2C). It was greatly reduced, but not
eliminated, in cells expressing Sup35N. Thus, the extremely strong prionogenic nature of Sup35N
can bypass the need for [RNQ+].
The well-characterized yeast prions are SDS-resistant amyloids that are readily visualized
by SDD-AGE. Many, including Sup35, can form a variety of different amyloids, which give rise to
phenotypically distinct prion states (white and pink color variants; Derkatch et al., 1996;
Kryndushkin et al., 2003). Sup35N-expressing cells produced similar phenotypic variants that were
associated with the expected differences in amyloid size (Figure 1D, S2D).
Sup35Q did not form prions under these conditions. However, subsequent experiments
revealed that rare colonies with all the hallmarks of prions could form when the protein was
expressed at extremely high levels (supplemental text and Figure S4B). These states, however, were
highly unstable (not shown). Therefore, Q-richness confers a substantial, but not insurmountable,
barrier to prion formation and propagation by Sup35Q.
Q and N have disparate effects on amyloid formation by Sup35
There are several mechanisms by which Q and N substitutions could change the rate or
energy landscape of prion formation. We first asked if the Q and N variants had intrinsically
different propensities to form amyloid de novo. We induced Sup35 PrD-EYFP variants for 24 hrs in
cells that did not carry prion forms of these proteins. Despite similar expression levels (Figure S1A),
these variants showed very different aggregation behaviors (Figure 1E). The WT protein
partitioned between SDS-soluble and amyloid states. All detectable Sup35N coalesced into SDS-
resistant aggregates. All of the Sup35Q remained SDS-soluble.
To determine if these differences result from inherently different conformational
tendencies of each variant, we examined amyloid formation in vitro. We purified the variants from
bacteria under fully denaturing conditions. The proteins were then diluted into a physiological
assembly buffer containing Thioflavin-T (ThT), a dye that fluoresces upon binding amyloid (LeVine,
87
1993). Sup35WT and Sup35N formed ThT-binding-competent aggregates after a short lag phase, as is
characteristic for prion proteins. Sup35Q was incapable of forming amyloid in the time period
examined (Figure 1F). We conclude that the intrinsic amyloid propensities of Sup35 variants are
strongly promoted by Ns and inhibited by Qs.
Ns and Qs influence other proteins in the same way
To determine if these effects were general, we created N→Q variants of two highly N-rich
PrDs, one from Ure2 and the other from Lsm4 (Ure2Q and Lsm4Q, Figure 2A), and subjected them to
the same tests used for Sup35. (We did not make Q→N variants because the wild-type proteins are
already highly enriched in Ns). As determined using Sup35C-fusions, Ure2WT and Lsm4WT drove
prion formation at high frequencies. The corresponding Q-rich versions did not (Figure 2B, S1B-C,
S2E-F). The Q-rich PrDs were also severely impaired for amyloid formation, both in vivo when over-
expressed as EYFP fusions (Figure 2C) and in vitro following their purification and dilution into
physiological buffer (Figure 2D).
Thus far, our analyses dealt only with proteins that are normally proficient at prion
formation. To determine if N-richness can drive prion formation in a protein that does not normally
form them, we generated a Q→N variant of a fragment of the Gal11 transcription factor (Gal11N,
Figure 3A). As reported previously (Alberti et al., 2009), the WT sequence lacked prion activity
(Figure 3B, S3C-D). In contrast Gal11N readily produced Ade+ colonies. The Ade+ phenotype of
Gal11N could be reversed by Hsp104 inactivation (Figure 3C) and, as expected for a prion, did not
require the continued presence of [RNQ+] (Figure 3C). SDD-AGE revealed SDS-insoluble amyloid
aggregates of Gal11N-Sup35C in Ade+ cells (Figure 3D). Finally, the different prion propensities of
the Gal11 PrD variants corresponded to their cellular amyloid propensities when they were
expressed de novo in cells that did not contain the prion: Gal11WT-EYFP did not form SDS-resistant
aggregates whereas Gal11N-EYFP did (Figure 3E, S3A). Thus, replacing Qs with Ns in a non-prion
protein is sufficient to create an artificial prion with properties similar to those of natural prions.
Many proteins associated with amyloid diseases contain long glutamine tracts (polyQ).
Expansions of the polyQ region in the huntingtin protein (Htt) confer a length-dependent
propensity to aggregate, both in humans and when heterologously expressed in yeast (Krobitsch
and Lindquist, 2000; Duennwald et al., 2006). To explore the distinction between Qs and Ns in such
a protein, we compared a disease-associated version of Htt exon 1 (HttQ47), with a Q→N variant of
the same protein (HttN47, Figure 3F). When fused to EYFP and expressed for 24 hrs, both variants
formed SDS-resistant aggregates that were strongly promoted by the presence of [RNQ+] (Figure
88
3G). However, regardless of [RNQ+] status, HttN47 partitioned much more completely to the SDS-
resistant fraction than did HttQ47. Thus, as for yeast prions, Ns are more amyloidogenic than Qs in a
disease-associated homopolymer tract.
N-richness reduces proteotoxicity of Q/N-rich proteins
Over-expressed fluorescently-tagged Q/N-rich proteins display a variety of localization
patterns. Prion-like proteins typically form bright punctate or ribbon-like foci indicative of bundled
amyloid filaments (Alberti et al., 2009; Kawai-Noma et al., 2010; Tyedmers et al., 2010). Non prion-
forming proteins remain entirely diffuse or coalesce weakly into amorphous foci (Alberti et al.,
2009). All of the N-rich, prion-proficient proteins studied here formed foci with sharp boundaries
and, often, an elongated filament-like morphology (Figure 4A, top). The Q-rich proteins also formed
cytoplasmic foci after 48 hrs of expression, but these were less crisp and surrounded by diffuse
fluorescence (Figure 4A, bottom). By SDD-AGE the Q-rich proteins were largely SDS-sensitive
(Figure 1E, 2C, 3E, S1D-F, S3B).
Over-expressed disordered proteins have an increased tendency to form toxic interactions
with other proteins (Vavouri et al., 2009). Computational analyses indicate that this tendency may
be further increased by Q-richness (Figure S10). We examined whether the different solubilities of
Q- and N-rich proteins influenced yeast growth. We transformed inducible PrD-EYFP variants into
yeast cells carrying a chromosomal deletion of the PrD of Sup35. Cells were then spotted onto
media that either induced or repressed expression. The Ure2, Lsm4, or Gal11 variants were not
toxic (not shown). Of the Sup35 variants, Sup35Q was the most toxic, followed by Sup35WT. Sup35N
was relatively benign (Figure 4B, left). Similarly, HttQ47 was toxic relative to HttN47 (Figure 4C, left).
To determine whether toxicity is enhanced or reduced by amyloid formation, we examined
isogenic strains containing the amyloid-promoting factor [RNQ+]. This background decreased the
toxicity of Sup35WT (Figure 4B) as well as both variants of Htt (Figure 4C), consistent with the
hypothesis that toxic activities of non-amyloid conformers are suppressed by amyloid formation.
Notably, Sup35Q, which had an extremely low amyloid propensity regardless of [RNQ+] status, was
not affected.
Q-rich proteins preferentially form toxic non-amyloid conformers
We also tested the inherent tendency of Q-rich proteins to form non-amyloid aggregates.
We incubated purified Sup35 variants in assembly buffer for 24 hrs, with end-over-end agitation,
and examined their partitioning between soluble and insoluble states by centrifugation. SDS was
89
then added to the insoluble fraction followed by a second centrifugation step to separate SDSinsoluble (amyloid) from SDS-soluble (non-amyloid) aggregates. Sup35WT and Sup35N converted
almost entirely to an SDS-insoluble state (Figure 5A). A large fraction of Sup35Q remained soluble.
Of the Sup35Q that did precipitate, most did so as an SDS-soluble species.
To determine if the different aggregates formed by Q- and N-rich proteins might contribute
directly to toxicity, we applied purified protein preparations to human neuroblastoma cells in
culture. None were toxic when freshly diluted from denaturant. When the proteins were allowed to
aggregate for 24 hrs, Sup35Q became severely toxic, as seen by cell detachment (Figure 5B), and by
membrane permeabilization quantified by adenylate kinase release (Figure 5C). The extreme
distinctions between Sup35 variants in this assay prompted us to examine Ure2 PrD variants. After
24 hrs of aggregation, Ure2WT was only mildly toxic whereas Ure2Q was severely toxic (Figure S5C).
Q-rich proteins have a defect in amyloid conversion
What biophysical forces govern the distinct aggregation behaviors of these proteins? We
used a conformation-specific antibody (A11; Kayed et al., 2003) to detect molten oligomers that are
on-pathway to amyloid nucleation (Serio et al., 2000; Shorter and Lindquist, 2004). All three
variants accumulated A11-reactive species (Figure 6A). Sup35Q formed these species more rapidly
than Sup35WT and Sup35N. It also remained in this form much longer.
To address whether Ns and Qs influence polymerization per se, we examined the rates at
which freshly diluted soluble proteins polymerized onto their own preformed amyloid templates.
Each variant was incubated with agitation for one week in assembly buffer and confirmed to have
formed ThT-fluorescent, SDS-resistant aggregates (Figure S4A). These were sonicated into similar
sized fragments and normalized to contain approximately the same number of fiber ends (Figure
S6A). Nonlinear regression of ThT fluorescence kinetics was then used to determine initial
polymerization rates across a range of added fiber concentrations (Figure 6B, S6C). The rates of
seeded polymerization differed dramatically between variants. Sup35N converted more rapidly
than Sup35WT; Sup35Q converted much more slowly. The polymerization of Ure2 was altered in the
same manner by Q substitutions (Figure S5A, S6C).
Next, we asked if Qs and Ns contribute to template specificity. Preformed sonicated
amyloids of each of the Sup35 and Ure2 PrD variants were used to cross-seed amyloid formation by
each of the other variants. In all but one case, cross-seeding was not observed, indicating that Ns
and Qs generally create incompatible templates (Figure 6C). The single exception occurred between
the pair of proteins with the greatest sequence identity: Sup35WT and Sup35Q. This relationship was
90
asymmetric: Sup35WT effectively polymerized onto Sup35Q amyloids, but Sup35Q did not
polymerize onto Sup35WT amyloids. Thus, Sup35Q amyloids are not defective for templating. Rather,
the non-amyloid conformers have a reduced ability to be templated.
The mechanistic distinction between Qs and Ns
Why does a subtle chemical distinction between N and Q side chains, namely, one
methylene group, so strongly influence amyloid propensity? The conformational fluctuations that
lead a disordered protein to convert to amyloid are difficult to dissect experimentally. Molecular
simulations provide a complementary tool for investigating the free energy landscapes and
thermodynamics of β-sheet formation in such sequences (Wang et al., 2006; Vitalis et al., 2007;
Pappu et al., 2008; Vitalis et al., 2008; Vitalis et al., 2009). We performed molecular simulations
with polyQ and polyN molecules. For practical reasons we limited the simulations to molecules
containing 30 glutamines (Q30) or 30 asparagines (N30). As in previous work (Vitalis et al. 2009),
local conformational restraints were used to generate non-specific biases of the backbone dihedral
angles in the β-basin of conformational space, thus allowing us to observe rare conformations that
might be sampled on-pathway to amyloid formation.
In the presence of these conformational restraints, monomeric N30 formed ordered β-sheets
as quantified by DSSP-E scores (Figure 7A). The effects of homotypic intermolecular interactions
were simulated using two N30 molecules. Intermolecular interactions neither diminished nor
enhanced the intrinsic β-sheet-propensity, provided that the per-residue entropic penalty was pre-
paid. Monomeric Q30 showed greatly reduced ordered β-sheet content even in the presence of
biases that restrict the backbone dihedral angles to the β-basin. However, in simulations with two
restrained Q30 molecules, there was positive coupling and the overall β-sheet content of both Q30
molecules increased through intermolecular interactions, suggesting that ordered β-sheet
formation in Q-rich systems requires at least two interacting molecules (Zhang and Muthukumar,
2009) that have been appropriately biased to sample conformations drawn from the β-basin.
Next, we quantified the thermodynamics of non-specific bimolecular associations (Figure
7B). The probability of intermolecular associations was smaller for N30 than for Q30. The
intermolecular associations in such simulations are largely non-specific (Vitalis et al., 2008; Vitalis
et al., 2009), i.e. spontaneous fluctuations lead disordered monomers to form disordered dimers
and, by extrapolation, molten oligomers. The presence of conformational restraints decreased this
disorder and, in turn, caused systematic diminutions in the magnitudes of intermolecular
associations, an observation borne out by the temperature-dependence of these probabilities. The
91
lower disorder for N30 and its increased ability to form ordered β-sheet structures (Figure 7A),
leads to weaker non-specific intermolecular associations. Together, these results suggest an
increased tendency for non-specific aggregation by Q-rich systems.
The different non-specific association tendencies of Q30 and N30 appeared to result, at least
in part, from a difference in turn formation between the two systems (Figure 7C). No more than
four Ns were needed to form a tight turn. Conversely, the bulkier side chain of Q formed a wider
bulge and required at least five residues (often more) to promote the reversal of chain direction.
DISCUSSION
In recent years proteins with intrinsically disordered regions have engendered a great deal
of interest. Such regions can have tethering or bristle-like functions in extended states, but more
often drive the binding interactions that govern hubs in regulatory networks (Haynes et al., 2006;
Turoverov et al., 2010). Disordered proteins also feature prominently in protein misfolding
diseases (Turoverov et al., 2010). We have focused on a subset of disordered proteins with the
capacity to form protein-based genetic elements in yeast. Analyzing the defining sequence feature
of this subset, the Q/N-rich “prion-like” proteins, we find that Qs and Ns strongly and disparately
affect transitions into higher order complexes. In diverse Q/N-rich proteins, changing Qs to Ns
greatly enhanced amyloid- and prion-forming capabilities. Changing Ns to Qs had a different effect,
resulting in the accumulation of non-amyloid assemblies that were toxic in both yeast and
mammalian systems. Q and N content affected not only the ability of oligomers to mature into
amyloids, but also the efficiency with which soluble proteins could be templated by amyloids, once
formed.
Our molecular simulations provide a rationale for the disparities between Q-rich and N-rich
sequences. The shorter N side chain enhances the ability of this residue to hydrogen bond to the
polypeptide backbone. This leads to more robust turn-formation, increased β-sheet propensity, and
a decreased tendency for nonspecific intermolecular associations. We propose that these
distinctions become amplified as multiple monomers come together and, as a result, N-rich
molecules more effectively form ordered self-assemblies on pathway to amyloid. Regardless of the
mechanism of amyloid nucleation – homogeneous monomeric nucleation (Chen et al., 2002), or
nucleated conformational conversion within molten oligomers (Serio et al., 2000; Mukhopadhyay et
al., 2007) – the barrier for molecular conversion to an ordered, β-sheet-rich conformation is lower
for N-rich sequences. Furthermore, by reducing nonspecific interactions, N-richness is likely to
92
lessen the depletion of soluble species through off-pathway aggregation, which competes with
amyloid polymerization (Powers and Powers, 2008).
We also note that Ns, but not Qs, are commonly involved in hydrogen-bonded spines, or
“asparagine-ladders”, of β-helices in the Protein Data Bank (Jenkins and Pickersgill, 2001; Lenore
Cowen, personal communication). The β-helix is a model structure for several amyloids, including
those of the prions formed by Het-s (Wasmer et al., 2008) and Sup35 (Krishnan and Lindquist,
2005; Tessier and Lindquist, 2009).
The disparity we observed between Qs and Ns was surprising. The notion that Q and N are
interchangeable for prion formation is pervasive. Many sequences in the prion literature are
described as “Q/N-rich” though they are, in fact, enriched for only one of these residues (Si et al.,
2003; Ross et al., 2005b; Decker et al., 2007; Patel et al., 2009a; Salazar et al., 2010). Algorithms
commonly used to identify amyloidogenic sequences – TANGO (Fernandez-Escamilla et al., 2004)
and Zyggregator (Tartaglia and Vendruscolo, 2008) – failed to yield a clear prediction about the
effects of Q and N replacements (Figure S9). Moreover, they failed entirely to predict amyloid
formation by Q/N-rich PrDs (Alberti et al., 2009) or the PrD variants analyzed in this work (Figure
S9). The distinctions revealed here should better inform future sequence-based predictions of
amyloid formation.
Amyloids have a wide range of structural functions, ranging from peptide hormone storage
and biopolymer synthesis in mammals, to spore dispersal and cellular adhesion in microbes
(Fowler et al., 2007; Maji et al., 2009). Biofilm-forming amyloids driven by N-rich sequences have
recently been identified in Pseudomonas (Dueholm et al., 2010). In yeast and possibly other
organisms, N-rich amyloids also function as protein-based elements of inheritance – prions. The
stochastic switching of prion proteins to and from amyloid states might be important in
maintaining adaptive phenotypic diversity within clonal cell populations (True and Lindquist, 2000;
Halfmann et al., 2010; Lancaster et al., 2010). N-rich sequences are found in roundworm and insect
proteomes, and are extremely abundant in certain lower eukaryotes such as Dictyostelium and
Plasmodium (Michelitsch and Weissman, 2000; Harrison and Gerstein, 2003; Singh et al., 2004). It is
tempting to suggest that the biological functions of these proteins involve self-assembly into
amyloid.
While amyloids represent one extreme of conformational space (highly ordered and stable)
many functions of Q/N rich proteins derive from the other conformational extreme they populate:
disorder. Qs and Ns are predicted to have roughly equivalent disorder-promoting tendencies
(Weathers et al., 2004). Indeed, our Q and N variants are all predicted to be highly disordered (9 of
93
10 disorder prediction web-servers reviewed in He et al., 2009). Yet, intrinsically disordered
proteins (aside from prions) are typically enriched for Qs and depleted of Ns (Radivojac et al.,
2007). This bias is most prevalent in the proteomes of mammals, which contain many more Q-rich
sequences than N-rich sequences (Kreil and Kreil, 2000; Michelitsch and Weissman, 2000; Karlin et
al., 2002; Harrison and Gerstein, 2003; Kozlowski et al., 2010). The bias cannot be attributed to
differences in codon frequencies or to structural properties of the DNA, but instead reflect positive
selective pressures acting on Q-rich proteins (Bacolla et al., 2008; Kozlowski et al., 2010). Our
findings suggest that the puzzling deficiency in Ns results from strong selective pressure against
amyloid formation, which would inactivate the essential functions of these proteins. In agreement,
the bias against Ns increases with the length of the disordered region (Peng et al., 2006). Longer
disordered regions have an increased risk for amyloid formation (Liu and Lindquist, 1999; Chen et
al., 2002; Toombs et al., 2010), making them particularly susceptible to N-richness.
Molecular simulations suggest that Q-rich protein:protein interactions are highly
unstructured (this work and Wang et al., 2006; Vitalis et al., 2008; Vitalis et al., 2009). This property
is likely integral to the functions of Q-rich proteins in many large and dynamic protein assemblies:
transcriptional regulatory complexes, RNA processing bodies and endocytic complexes (Xiao and
Jeang, 1998; Titz et al., 2006; Decker et al., 2007; Meriin et al., 2007; Buchan et al., 2008; Alberti et
al., 2009). We suggest that the conformational tendencies of Q-rich polypeptides expedite the
assembly or remodeling of these complexes. Further, that Q-rich protein interactions are
structurally less-constrained may grant the freedom to explore new binding partners, accelerating
the functional diversification of network hubs and the evolution of novel circuitries.
Conversely, the conformational tendencies of Q-rich sequences increase their burden on
protein homeostasis. Disordered proteins tend to be toxic when over-expressed, due to mass-action
driven interaction promiscuity (Vavouri et al., 2009). This liability may drive the extraordinarily
tight regulation of the cellular concentrations of intrinsically disordered proteins in general, and
“Q/N-rich” proteins in particular (Gsponer et al., 2008). Q-richness appears to increase the
propensity for toxic interactions by disordered proteins (Figure S10), which, in turn, may
contribute to the pathology of Q-rich proteins in disease. We demonstrate that over-expressed Q-
rich proteins can be detoxified by amyloid formation, presumably by sequestering the protein
species prone to making toxic associations. These observations add to a growing body of evidence
from a wide range of proteins and disease models that amyloids often reduce, rather than
exacerbate, the consequences of protein misfolding (Takahashi et al., 2008; Truant et al., 2008;
Treusch et al., 2009).
94
A single methylene distinguishes Q from N. Yet this difference unequivocally alters one
prominent activity of Q/N-rich proteins, prion formation, and also influences another, toxicity.
Further understanding the conformational preferences of disordered proteins will be key to
elucidating their widespread roles in both normal biology and disease.
EXPERIMENTAL PROCEDURES
DNA synthesis and cloning procedures
Variant versions of PrDs were synthesized and assembled by DNA2.0 (Menlo Park, CA) and then
cloned into the pDONR221 plasmid. The coding sequences were codon-optimized for expression in
yeast and contained flanking sequences that allowed for Gateway® recombination and dual
expression in yeast and bacteria (Alberti et al., 2009). Synthesized sequences are shown below,
with recombinogeic attB sites in blue, the Shine-Dalgarno ribosome binding site in red, and the
yeast Kozak consensus sequence in green:
>N→Q SUP35 PrD-M
ACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAACAAAATGTCGGATAGCCAACAGGGCCAACAAC
AACAACAATACCAACAATACAGCCAACAAGGACAACAACAGCAGGGTCAGCAACGTTATCAAGGATATCA
AGCTTATCAAGCCCAAGCACAGCCGGCAGGTGGCTATTACCAGCAGTATCAAGGGTACTCAGGTTACCAAC
AGGGTGGATATCAGCAGTACCAACCTGATGCCGGATATCAACAGCAATACCAGCCTCAAGGCGGTTATCAG
CAATATCAACCACAAGGAGGATACCAGCAGCAATTCCAACCTCAAGGAGGTAGGGGGCAATATAAACAAT
TTCAATATCAGCAACAATTGCAAGGGTACCAGGCTGGCTTTCAACCGCAATCACAGGGTATGAGTTTACA
AGACTTTCAGAAACAGCAAAAGCAAGCTGCACCAAAACCGAAGAAAACTCTAAAGCTGGTAAGTTCATCT
GGGATAAAGCTGGCGAACGCTACTAAAAAGGTAGGTACTAAGCCTGCTGAAAGTGACAAGAAAGAGGAGG
AAAAATCTGCAGAAACGAAAGAACCCACTAAAGAACCTACCAAAGTGGAAGAACCTGTGAAAAAGGAAGA
AAAGCCAGTTCAAACTGAGGAAAAGACTGAAGAGAAGTCAGAGTTGCCTAAGGTTGAAGACTTAAAGATT
TCTGAATCTACACACAACACCAATAATGCTAATGTTACCAGTGCAGATGCATTGATCAAAGAGCAAGAAG
AAGAAGTCGATGATGAAGTGGTGAATGATAACCCAGCTTTCTTGTACAAAGTGGT
>Q→N SUP35 PrD-M
ACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAACAAAATGTCAGATTCCAACAACGGAAATAACA
ATAATAACTATAATAACTACTCTAATAACGGCAATAACAACAATGGGAACAATCGTTACAACGGATATAA
CGCTTACAATGCGAATGCCAATCCAGCAGGGGGATATTACAACAACTATAACGGTTACTCAGGCTATAAC
AACGGAGGTTACAATAATTACAACCCTGACGCGGGCTACAATAACAACTATAATCCTAACGGGGGTTACA
ACAATTACAATCCAAATGGCGGATACAACAATAACTTTAACCCAAACGGCGGCAGGGGTAACTATAAGAA
TTTCAATTACAATAACAACTTGAATGGTTACAACGCAGGTTTTAACCCGAACAGTAATGGTATGAGTTTA
AACGACTTCAATAAAAACAACAAGAATGCTGCCCCCAAACCGAAGAAGACATTGAAGCTAGTCTCATCAT
CCGGTATTAAACTTGCCAATGCCACTAAGAAAGTTGGTACAAAGCCGGCCGAAAGCGACAAGAAAGAAGA
AGAAAAATCCGCGGAAACAAAGGAACCAACTAAAGAACCAACCAAGGTTGAAGAACCTGTTAAGAAGGAG
GAAAAGCCAGTACAAACGGAAGAAAAGACCGAAGAAAAGAGTGAACTGCCTAAAGTGGAAGACCTAAAG
ATTTCTGAATCTACTCATAACACCAACAACGCGAACGTCACGTCCGCTGATGCCTTGATAAAGGAACAAGA
AGAGGAAGTAGACGATGAAGTTGTTAACGATAACCCAGCTTTCTTGTACAAAGTGGT
95
>N→Q URE2 PrD
ACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAACAAAATGATGCAACAGCAGGGGCAACAGGTTT
CCCAACTTTCTCAGGCCTTAAGACAAGTTCAAATTGGTCAAAGACAGTCTCAGACTACAACGGACCAGTCA
CAGATCCAGTTTGAGTTCTCTACGGGAGTTCAACAGCAGCAACAACAGCAGAGTTCTAGTCAACAGCAACA
AGTACAGCAGCAGCAAAGCGGCAGACAAGGTAGTCAGCAGCAAGATCAGGAGCAGCAAATCAAACAAACC
TTGGAACAACACAGGCAACAACAACAGAACCCAGCTTTCTTGTACAAAGTGGT
>N→Q LSM4 PrD
ACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAACAAAATGAGTCAGCAAATCCAATCCCAGCAGC
AGTCTCAATCACAAGGTCCAGGTCATAAACGTTATTACCAACAAAGAGACTCCCAACAACAAAGGGGACA
GTACCAAAGGAGACAACAGCAGCAGGGTCAGAGTCAAAGAAGGCCTTACTCTCAACAACGTCAGTATCAA
CAAAGTCAATCTTCACAGATCCAACAATCAATTCAATCTATCCAGTCCCAACAGCAACAAATGCAACAGGG
GCTGGGAGGGTCTGTCCAGCACCATTTTCAGAGTTCATCTCCACAGAAGGTAGAGTTTAACCCAGCTTTCT
TGTACAAAGTGGT
>Q→N GAL11 PrD
ACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAACAAAATGTCGAACAACAACAACATGGCAAACA
ATAACGGGAATCCCGGGACAACATCTACTGGAAATAACAACAATATTGCAACCAACAATAACATGAATAA
CTCATTGAATAATATGAACCACCTAAATAATTTAAAGATGAATAATAACAACAATAATAATAACAATAAT
AATAACAATAATAATAACAATAATAATAACAATAACAATCATATTTATCCTTCCAGTACACCAGGAGTAG
CTAACTATAGTGCTATGGCCAATGCGCCCGGAAATAATAACCCAGCTTTCTTGTACAAAGTGGT
>Q→N Htt47
ACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAACAAAATGGCGACACTAGAGAAATTAATGAAGG
CTTTCGAGAGTCTTAAGAGCTTTAACAACAATAACAATAACAATAATAACAATAATAATAATAACAATAA
TAACAATAATAACAACAACAACAACAATAACAACAACAATAACAACAATAACAACAATAACAACAACAAT
AACAATAATAACAATAATAACAACCCTCCTCCTCCACCGCCTCCTCCACCGCCTCCACAGTTGCCACAGCCA
CCACCACAAGCCCAGCCTTTATTGCCCCAACCGCAGCCGCCGCCGCCTCCTCCGCCGCCTCCACCTGGTCCA
GCCGTCGCAGAGGAACCCTTACATAGACCAGGTAACCCAGCTTTCTTGTACAAAGTGGT
Additional entry clones were generated for the PrDs (lacking the M domain) of each Sup35 variant.
PCR reactions used Platinum Pfx DNA polymerase (Invitrogen, CA), variant Sup35 PrD-M entry
clones as templates, and the following oligos:
N-SUP35N-reverse
GGGG AC CAC TTT GTA CAA GAA AGC TGG GTC ACA ATT CTT GTT GTT
TTT ATT GAA GTC G
N-SUP35Q-reverse
GGGG AC CAC TTT GTA CAA GAA AGC TGG GTC ACA TTG CTT TTG CTG
TTT CTG AAA GTC
N-SUP35-forward
GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA G
The correct amplification and integration of DNA into pDONR221 (Invitrogen, CA) was
confirmed by sequencing. ORFs in entry clone format were transferred into the following
96
destination vectors: pAG424GAL-ccdB-EYFP (Alberti et al., 2009), pAG415SUP35-ccdB-SUP35C,
pAG415ADH1-ccdB-SUP35C, pAG415GPD-ccdB-SUP35, pRH1 and pRH2 (Alberti et al., 2009).
Yeast media and strains
The media used were standard synthetic media or YPD containing 2 % D-glucose (SD) or 2 % Dgalactose (SGal). Plates used for prion curing contained 5 mM guanidine hydrochloride (GdnHCl).
The yeast strains used in this study were derived from YJW509 (leu2-3,112; his3-11,-15; trp1-1;
ura3-1; ade1-14; can1-100; [psi-]; [pin-]) andYJW584 (leu2-3,112; his3-11,-15; trp1-1; ura3-1;
ade1-14; can1-100; [psi-]; [PIN+]) (see Osherovich et al., 2004; Alberti et al., 2009 for details on
strain generation). Strains used in this study are found in Table S1.
Table S1: Yeast strains used in this study.
1
YRS098
MATα, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-];
[pin-]
2
YRS099
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-];
[PIN+]
3
YRS240
YRS099 sup35::HygB; pAG415SUP-NM-SUP35C
4
YRS241
YRS099 sup35::HygB; pAG415SUP-NM(Q→N)-SUP35C
5
YRS242
YRS099 sup35::HygB; pAG415SUP-NM(N→Q)-SUP35C
6
YRS243
YRS240 [PSI+]weak
7
YRS244
YRS240 [PSI+]strong
8
YRS245
YRS241 [PRION+]SUP35-N, weak
9
YRS246
YRS241 [PRION+]SUP35-N, strong
10 YRS247
YRS099 sup35::HygB; pAG415ADH1-NM(N→Q)-SUP35C
11 YRS248
YRS247 [PRION+]SUP35-Q
12 YRS249
YRS240 rnq1::KanMX4
13 YRS250
YRS241 rnq1::KanMX4
14 YRS251
YRS242 rnq1::KanMX4
15 YRS252
YRS240 hsp104::KanMX4
16 YRS253
YRS241 hsp104::KanMX4
17 YRS254
YRS242 hsp104::KanMX4
18 YRS255
YRS099 sup35::HygB; pAG415ADH1-URE2WTPrD-SUP35C
19 YRS256
YRS099 sup35::HygB; pAG415ADH1-URE2QPrD-SUP35C
20 YRS257
YRS256 [PRION+]URE2-Q
21 YRS258
YRS099 sup35::HygB; pAG415ADH1-LSM4WTPrD-SUP35C
22 YRS259
YRS099 sup35::HygB; pAG415ADH1-LSM4QPrD-SUP35C
23 YRS260
YRS099 sup35::HygB; pAG415ADH1-GAL11WTPrD-SUP35C
24 YRS261
YRS099 sup35::HygB; pAG415ADH1-GAL11NPrD-SUP35C
25 YRS262
YRS261 [PRION+]GAL11-N
26 YRS263
YRS098 sup35::SUP35133-685
27 YRS264
YRS099 sup35::SUP35133-685
97
Yeast techniques
Sup35 variants for prion maintenance, prion induction, and microscopy consisted of the entire
prion-determining region of Sup35 (PrD and M domains), fused to either Sup35C or EYFP. All other
yeast experiments and protein variants utilized PrD regions only. For cell spotting assays (prion
induction and toxicity), PrD-EYFP fusions were expressed from a high copy galactose inducible
plasmid. For prion induction, cells were grown overnight in galactose- prior to plating on glucose-
containing media. For toxicity, cells were grown overnight in glucose- prior to plating on either
galactose- or glucose-containing media. Plates were incubated at 30°C.
SDD-AGE
SDD-AGE was performed as described (Alberti et al., 2009).
Protein purifications
All proteins were expressed and purified from E. coli BL21-AI essentially as described (Alberti et al.,
2009), using either pRH1 (for fusing a 7xHis tag to the C-termini of Sup35 PrD-M, Ure2 PrD, and
Lsm4 PrD variants) or pRH2 (for fusing a Sup35 M domain plus 7xHis tag to the C-termini of Ure2
PrD variants). Sup35 variants were further purified by seeded polymerization in assembly buffer,
with rotation, for one week, followed by recovery of aggregated protein by ultracentrifugation for
one hour at 100,000 rcf. Truncation products and other co-purified contaminants remained in the
supernatant. The pellet was re-dissolved in 6 M GdnHCl followed by precipitation with 5 volumes
methanol at -80°C. Methanol-precipitated proteins were resuspended in 6 M GdnHCl, incubated for
5 min at 95°C, and then filtered through a YM-100 Microcon filter immediately prior to use.
In vitro aggregation assays
For reactions monitoring the rate of amyloid formation, proteins were diluted into assembly buffer
(5 mM K2HPO4, pH 6.6; 150 mM NaCl; 5 mM EDTA; 2 mM TCEP) plus 0.5 mM ThT, in black
nonbinding microplates (Corning, NY) with 100 μl per well. GdnHCl concentrations in reactions did
not exceed 60 mM, and were equalized in all pairwise comparisons. De novo amyloid assembly
reactions monitored by ThT fluorescence were incubated at 25°C and shaken 10 sec every 2 min.
For unseeded reactions with Sup35 variants, 3 PTFE 3/32” plastic beads (McMaster-Carr) were
added to each well to increase the rate of assembly. Seeded reactions were not shaken.
Fluorescence measurements (450 nm excitation, 482 nm emission) were made with a Sapphire II
plate reader (Tecan, NC). For seeded reactions, data were fit to one phase (pseudo-first order)
98
associations using GraphPad Prizm software. To achieve a better fit at early time points, Sup35Q
was fit to two phases. For experiments requiring larger reaction volumes (oligomer formation
kinetics, preparation of aggregates for fractionation and membrane disruption assays), 1 ml
reactions were performed in 1.5 ml Eppendorf tubes with 50 rpm end-over-end rotation at 25°C.
For monitoring oligomer formation, reactions were staggered such that all time points were
collected at the same time. Fifty μl of reactions containing 2.5 μM protein were applied to
nitrocellulose using a vacuum manifold. Blots were developed using anti-His6 (1:2000 dilution,
Invitrogen) or A11 polyclonal antibodies (1:100 dilution) essentially as described (Shorter and
Lindquist, 2004).
To generate amyloid seeds for comparisons of fiber elongation rates, proteins were
assembled using continuous end-over-end agitation for 5 days. Aggregates were then collected by
ultracentrifugation (100,000 rcf for 1 hr) and resuspended in fresh assembly buffer. We sonicated
these preparations to fragment the amyloid fibrils into similar lengths, as determined by SDD-AGE
(Figure S6A), thus ensuring approximately the same number of fiber ends per mass of polymer.
Seed stocks were then normalized according to their amounts of SDS-resistant protein as described
(Dong et al., 2007) (Figure S6B).
To ensure meaningful comparisons between variants for seeded reactions, we analyzed
seeded polymerization rates at varying concentrations of soluble protein. We found no evidence for
polymerizable soluble oligomers; all reactions had an approximately first-order dependence on
soluble protein concentration (Figure S7).
Membrane disruption assay
Toxilight Bioassay kit measures leakage of adenylate kinase from the cells to the extracellular
medium due to the loss of cell integrity (damage of plasma membrane). 2 x 105 SH-SY5Y cells were
seeded in 24-well plates and grown overnight in a 1:1 mixture of DMEM and Ham’s F12 and 10%
FBS. Fresh or pre-aggregated proteins of Sup35 PrD-M-His7 variants (2.5 µM) were prepared in
serum-free medium and applied for 12-15 hrs. Cells were briefly spun at 800 rcf and 30 µl of the
medium was carefully removed and used for the toxicity assay as recommended by the
manufacturer.
Molecular simulations
We simulated one or two polyglutamine (polyQ) and polyasparagine (polyN) molecules N-acetyl(Gln)30-N′-Methylamide and N-acetyl-(Asn)30-N′-Methylamide; the chains were modeled in atomic
99
detail; for brevity we refer to these molecules as Q30 and N30, respectively. Markov chain Metropolis
Monte Carlo (MC) Simulations were performed in the canonical ensemble and molecules were
enclosed in a spherical droplet of radius 200Å, which was enforced using a harmonic boundary
potential. The replica exchange method was used to enhance conformational sampling (Sugita and
Okamoto, 1999). The degrees of freedom were the backbone φ, ψ, ω and sidechain χ dihedral
angles. For MC simulations with two chains, rigid-body coordinates, namely center-of-mass
translations and rotations were included as additional degrees of freedom. Bond lengths and bond
angles were held fixed at values prescribed by Engh and Huber (Engh and Huber, 1991). We used
parameters from the OPLS-AA/L forcefield (Kaminski et al., 2001) with appropriate modifications
and the ABSINTH implicit solvent model (Vitalis and Pappu, 2009). Details of the move sets, the
sampling protocol, and convergence tests are identical to those used in previous work on similar
systems (Vitalis et al., 2009).
Simulations were performed in the presence or absence of local conformational restraints.
To impose conformational restraints, we used a parameter referred to as fβ, which denotes the
fraction of residues in the polypeptide that are biased to sample backbone dihedral angles from the
β-basin of (φ,ψ) space; fβ assumes values between 0 and 1. The method used to quantify fβ has been
described in published work (Vitalis et al., 2009). Local dihedral angle biases were incorporated by
adding a harmonic restraint potential of the form Urestr= k(fβ– fβ)2 to the molecular mechanics
energy functions. Here, fβ andfβare the target and actual values for fβ, respectively. Following
calibrations performed in previous work, k=2.5 kcal/mol per restrained degree of freedom for both
N30 and Q30. When fb=  the backboneφ, ψ angles for all residues in the polypeptides are
biased to adopt conformations from the β-basin. The entropic penalty associated with sampling φ, ψ
angles from the β-basin is pre-paid in simulations carried out in the presence of restraints placed
on fb. The extent of formation of orderedβ-sheets is quantified using normalized DSSP-E scores
(Kabsch and Sander, 1983), which are used to quantify β-sheet contents in protein structures.
SUPPLEMENTAL RESULTS AND DISCUSSION
The defect in prion formation by NQ PrDs is not absolute
While Ns are generally more amyloidogenic than Qs, Ns were not an absolute requirement
for amyloid and prion formation in our assays. Sup35Q was unable to form amyloid under the
experiment conditions shown in Figure 1F. However, we found that increasing the level of agitation
100
by employing end-over-end rotation instead of horizontal agitation allowed all Sup35 variants to
form amyloid, as determined by ThT fluorescence, after five days (Figure S4A).
As the frequency of appearance of prion states is strongly affected by the cellular
concentration of prion protein, we asked if we could drive the Q PrD variants into a prion state by
expressing them at very high levels. We placed Sup35Q PrD-Sup35C under the control of the strong
ADE1 promoter, which produced significantly higher protein levels than the wild-type SUP35
promoter. We then introduced a plasmid for constitutive expression of Sup35Q PrD-M-EYFP, further
raising the total cellular concentration of Sup35Q. Next, we grew the cells to mid-log phase and
plated a fraction of the liquid culture on medium lacking adenine. Indeed, we now observed rare
Ade+ colonies on the selective plates, which upon further characterization were confirmed to be
true prions (Figure S4B). These prion states, however, were mitotically very unstable and exhibited
a high frequency of loss (data not shown). Similar results were obtained for Ure2Q (Figure S4B).
Patel et al. recently discovered that the highly Q-rich chromatin remodeling factor Cyc8
could be induced to form rare, but stable, prion states (Patel et al., 2009a). The prospective prion
associated with long-term memory formation, neuronal CPEB, is also enriched for Qs, but not Ns (Si
et al., 2003). Post-translational modifications, interactions with other proteins, and other sequence
elements in prion proteins (such as the repeating amphipathic QA motif in Cyc8) may contribute to
their prion behavior. Indeed, the amyloid propensities of individual amino acids are strongly
influenced by sequence context (Lopez de la Paz and Serrano, 2004; Wang et al., 2008; Goldschmidt
et al., 2010; Maurer-Stroh et al., 2010).
Enrichment for prolines in Q-rich sequences does not sufficiently explain their decreased
prion propensities
Our previous suggestion of the non-equivalence of N and Q for prion formation (Alberti et
al., 2009) had been challenged by a subsequent analysis of amino acid prion propensities using
artificial prion sequences (Toombs et al., 2010). The authors suggested an alternative explanation
for our results: Q-rich sequences also tend to be enriched in prolines, which have the lowest βpropensity of all amino acids. The results with Q and N variants presented in the current work
strongly refute this explanation, as Ns were consistently more prionogenic than Qs even within
otherwise identical sequences. Nevertheless, we also examined the statistical relationship between
prolines, Qs, Ns, and prion propensities determined in Alberti et al. (Alberti et al., 2009).
Specifically, we examined how the Q- and N-frequencies deviate from the expected Q- and N-
frequencies (given the proline frequency for each sequence) with “prion score" (Figure S8). Our
101
analysis suggests that Ns (to a greater extent than Qs) are able to overcome the inhibition of prion
formation by prolines. That is to say, prionogenic peptides with high proline content tend also to
have a greater enrichment for Ns (which generally decreases the frequency of Qs as a consequence).
The correlation of Q-richness with dosage sensitivity
Vavouri et al. found intrinsic disorder to be the single best predictor of dosage sensitivity
upon overexpression (OE) of yeast proteins (Vavouri et al., 2009). To test whether Q-richness and
N-richness are predictive of doage sensitivity beyond the extent predicted by disorder alone, we
performed a logistic regression of dosage-sensitivity as a function of disorder, Q-richness and Nrichness (Figure S10). As in Vavouri et al., we used the predicted number of disordered residues
according to GlobProt as the measure of disorder, here log2 transformed (after adding 1 to avoid
logs of zero) to improve fit. As a local measure of Q-richness we used the maximum number of Qs in
any 30 amino-acid window, and similarly for N-richness. In the logistic regression, disorder and Q-
richness were both significant predictors of dosage sensitivity (p = 8e-16 and p = 0.0006
respectively),
but
N-richness
was
not
(p
=
0.6).
This
indicates
that
Q-richness is predictive of toxicity even after disorder is accounted for, but N-richness is not. The
same conclusion holds in logistic regression using just disorder and Q-richness as predictors, or just
disorder and N-richness as predictors, so this result is not due to correlations between Q-richness
and N-richness. Statistical analysis was performed using the glm function in R.
REFERENCES
Alberti, S., Halfmann, R., King, O., Kapila, A., and Lindquist, S. (2009). A systematic survey identifies
prions and illuminates sequence features of prionogenic proteins. Cell 137, 146-158.
Bacolla, A., Larson, J.E., Collins, J.R., Li, J., Milosavljevic, A., Stenson, P.D., Cooper, D.N., and Wells, R.D.
(2008). Abundance and length of simple repeats in vertebrate genomes are determined by their
structural properties. Genome Res 18, 1545-1553.
Buchan, J.R., Muhlrad, D., and Parker, R. (2008). P bodies promote stress granule assembly in
Saccharomyces cerevisiae. J Cell Biol 183, 441-455.
Chen, S., Ferrone, F.A., and Wetzel, R. (2002). Huntington's disease age-of-onset linked to
polyglutamine aggregation nucleation. Proc Natl Acad Sci U S A 99, 11884-11889.
Chernoff, Y.O., Lindquist, S.L., Ono, B., Inge-Vechtomov, S.G., and Liebman, S.W. (1995). Role of the
chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+]. Science 268, 880884.
Decker, C.J., Teixeira, D., and Parker, R. (2007). Edc3p and a glutamine/asparagine-rich domain of
Lsm4p function in processing body assembly in Saccharomyces cerevisiae. J Cell Biol 179, 437-449.
Derkatch, I.L., Bradley, M.E., Hong, J.Y., and Liebman, S.W. (2001). Prions affect the appearance of
other prions: the story of [PIN(+)]. Cell 106, 171-182.
102
Derkatch, I.L., Chernoff, Y.O., Kushnirov, V.V., Inge-Vechtomov, S.G., and Liebman, S.W. (1996).
Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae. Genetics 144, 1375-1386.
Dong, J., Bloom, J.D., Goncharov, V., Chattopadhyay, M., Millhauser, G.L., Lynn, D.G., Scheibel, T., and
Lindquist, S. (2007). Probing the role of PrP repeats in conformational conversion and amyloid
assembly of chimeric yeast prions. J Biol Chem 282, 34204-34212.
Dueholm, M.S., Petersen, S.V., Sonderkaer, M., Larsen, P., Christiansen, G., Hein, K.L., Enghild, J.J.,
Nielsen, J.L., Nielsen, K.L., Nielsen, P.H., et al. (2010). Functional amyloid in Pseudomonas. Mol
Microbiol.
Duennwald, M.L., Jagadish, S., Giorgini, F., Muchowski, P.J., and Lindquist, S. (2006). A network of
protein interactions determines polyglutamine toxicity. Proc Natl Acad Sci U S A 103, 11051-11056.
Engh, R.A., and Huber, R. (1991). Accurate Bond and Angle Parameters for X-Ray Protein-Structure
Refinement. Acta Crystallographica Section A 47, 392-400.
Fernandez-Escamilla, A.M., Rousseau, F., Schymkowitz, J., and Serrano, L. (2004). Prediction of
sequence-dependent and mutational effects on the aggregation of peptides and proteins. Nat
Biotechnol 22, 1302-1306.
Fowler, D.M., Koulov, A.V., Balch, W.E., and Kelly, J.W. (2007). Functional amyloid--from bacteria to
humans. Trends Biochem Sci 32, 217-224.
Glover, J.R., Kowal, A.S., Schirmer, E.C., Patino, M.M., Liu, J.J., and Lindquist, S. (1997). Self-seeded
fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S.
cerevisiae. Cell 89, 811-819.
Goldschmidt, L., Teng, P.K., Riek, R., and Eisenberg, D. (2010). Identifying the amylome, proteins
capable of forming amyloid-like fibrils. Proc Natl Acad Sci U S A 107, 3487-3492.
Grimminger, V., Richter, K., Imhof, A., Buchner, J., and Walter, S. (2004). The prion curing agent
guanidinium chloride specifically inhibits ATP hydrolysis by Hsp104. J Biol Chem 279, 7378-7383.
Gsponer, J., Futschik, M.E., Teichmann, S.A., and Babu, M.M. (2008). Tight regulation of unstructured
proteins: from transcript synthesis to protein degradation. Science 322, 1365-1368.
Halfmann, R., Alberti, S., and Lindquist, S. (2010). Prions, protein homeostasis, and phenotypic
diversity. Trends Cell Biol 20, 125-133.
Hammer, N.D., Wang, X., McGuffie, B.A., and Chapman, M.R. (2008). Amyloids: friend or foe? J
Alzheimers Dis 13, 407-419.
Harrison, P.M., and Gerstein, M. (2003). A method to assess compositional bias in biological
sequences and its application to prion-like glutamine/asparagine-rich domains in eukaryotic
proteomes. Genome Biol 4, R40.
Haynes, C., Oldfield, C.J., Ji, F., Klitgord, N., Cusick, M.E., Radivojac, P., Uversky, V.N., Vidal, M., and
Iakoucheva, L.M. (2006). Intrinsic disorder is a common feature of hub proteins from four
eukaryotic interactomes. PLoS Comput Biol 2, e100.
He, B., Wang, K., Liu, Y., Xue, B., Uversky, V.N., and Dunker, A.K. (2009). Predicting intrinsic disorder
in proteins: an overview. Cell Res 19, 929-949.
Jenkins, J., and Pickersgill, R. (2001). The architecture of parallel beta-helices and related folds. Prog
Biophys Mol Biol 77, 111-175.
Kabsch, W., and Sander, C. (1983). Dictionary of Protein Secondary Structure - Pattern-Recognition
of Hydrogen-Bonded and Geometrical Features. Biopolymers 22, 2577-2637.
Kaminski, G.A., Friesner, R.A., Tirado-Rives, J., and Jorgensen, W.L. (2001). Evaluation and
reparametrization of the OPLS-AA force field for proteins via comparison with accurate quantum
chemical calculations on peptides. Journal of Physical Chemistry B 105, 6474-6487.
Karlin, S., Brocchieri, L., Bergman, A., Mrazek, J., and Gentles, A.J. (2002). Amino acid runs in
eukaryotic proteomes and disease associations. Proc Natl Acad Sci U S A 99, 333-338.
Kawai-Noma, S., Pack, C.G., Kojidani, T., Asakawa, H., Hiraoka, Y., Kinjo, M., Haraguchi, T., Taguchi, H.,
and Hirata, A. (2010). In vivo evidence for the fibrillar structures of Sup35 prions in yeast cells. J
Cell Biol 190, 223-231.
103
Kayed, R., Head, E., Thompson, J.L., McIntire, T.M., Milton, S.C., Cotman, C.W., and Glabe, C.G. (2003).
Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis.
Science 300, 486-489.
Kozlowski, P., de Mezer, M., and Krzyzosiak, W.J. (2010). Trinucleotide repeats in human genome
and exome. Nucleic Acids Res 38, 4027-4039.
Kreil, D.P., and Kreil, G. (2000). Asparagine repeats are rare in mammalian proteins. Trends
Biochem Sci 25, 270-271.
Krishnan, R., and Lindquist, S.L. (2005). Structural insights into a yeast prion illuminate nucleation
and strain diversity. Nature 435, 765-772.
Krobitsch, S., and Lindquist, S. (2000). Aggregation of huntingtin in yeast varies with the length of
the polyglutamine expansion and the expression of chaperone proteins. Proc Natl Acad Sci U S A 97,
1589-1594.
Kryndushkin, D.S., Alexandrov, I.M., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2003). Yeast [PSI+]
prion aggregates are formed by small Sup35 polymers fragmented by Hsp104. J Biol Chem 278,
49636-49643.
Lancaster, A.K., Bardill, J.P., True, H.L., and Masel, J. (2010). The spontaneous appearance rate of the
yeast prion [PSI+] and its implications for the evolution of the evolvability properties of the [PSI+]
system. Genetics 184, 393-400.
Larsen, P., Nielsen, J.L., Dueholm, M.S., Wetzel, R., Otzen, D., and Nielsen, P.H. (2007). Amyloid
adhesins are abundant in natural biofilms. Environ Microbiol 9, 3077-3090.
LeVine, H., 3rd (1993). Thioflavine T interaction with synthetic Alzheimer's disease beta-amyloid
peptides: detection of amyloid aggregation in solution. Protein Sci 2, 404-410.
Liu, J.J., and Lindquist, S. (1999). Oligopeptide-repeat expansions modulate 'protein-only'
inheritance in yeast. Nature 400, 573-576.
Lopez de la Paz, M., and Serrano, L. (2004). Sequence determinants of amyloid fibril formation. Proc
Natl Acad Sci U S A 101, 87-92.
Luheshi, L.M., Tartaglia, G.G., Brorsson, A.C., Pawar, A.P., Watson, I.E., Chiti, F., Vendruscolo, M.,
Lomas, D.A., Dobson, C.M., and Crowther, D.C. (2007). Systematic in vivo analysis of the intrinsic
determinants of amyloid Beta pathogenicity. PLoS Biol 5, e290.
Maji, S.K., Perrin, M.H., Sawaya, M.R., Jessberger, S., Vadodaria, K., Rissman, R.A., Singru, P.S., Nilsson,
K.P., Simon, R., Schubert, D., et al. (2009). Functional amyloids as natural storage of peptide
hormones in pituitary secretory granules. Science 325, 328-332.
Maurer-Stroh, S., Debulpaep, M., Kuemmerer, N., Lopez de la Paz, M., Martins, I.C., Reumers, J.,
Morris, K.L., Copland, A., Serpell, L., Serrano, L., et al. (2010). Exploring the sequence determinants
of amyloid structure using position-specific scoring matrices. Nat Methods 7, 237-242.
Meriin, A.B., Zhang, X., Alexandrov, I.M., Salnikova, A.B., Ter-Avanesian, M.D., Chernoff, Y.O., and
Sherman, M.Y. (2007). Endocytosis machinery is involved in aggregation of proteins with expanded
polyglutamine domains. FASEB J 21, 1915-1925.
Michelitsch, M.D., and Weissman, J.S. (2000). A census of glutamine/asparagine-rich regions:
implications for their conserved function and the prediction of novel prions. Proc Natl Acad Sci U S
A 97, 11910-11915.
Mukhopadhyay, S., Krishnan, R., Lemke, E.A., Lindquist, S., and Deniz, A.A. (2007). A natively
unfolded yeast prion monomer adopts an ensemble of collapsed and rapidly fluctuating structures.
Proc Natl Acad Sci U S A 104, 2649-2654.
Nelson, R., and Eisenberg, D. (2006). Recent atomic models of amyloid fibril structure. Curr Opin
Struct Biol 16, 260-265.
Osherovich, L.Z., Cox, B.S., Tuite, M.F., and Weissman, J.S. (2004). Dissection and design of yeast
prions. PLoS Biol 2, E86.
Pappu, R.V., Wang, X., Vitalis, A., and Crick, S.L. (2008). A polymer physics perspective on driving
forces and mechanisms for protein aggregation. Arch Biochem Biophys 469, 132-141.
104
Patel, B.K., Gavin-Smyth, J., and Liebman, S.W. (2009). The yeast global transcriptional co-repressor
protein Cyc8 can propagate as a prion. Nat Cell Biol.
Peng, K., Radivojac, P., Vucetic, S., Dunker, A.K., and Obradovic, Z. (2006). Length-dependent
prediction of protein intrinsic disorder. BMC Bioinformatics 7, 208.
Perutz, M.F., Pope, B.J., Owen, D., Wanker, E.E., and Scherzinger, E. (2002). Aggregation of proteins
with expanded glutamine and alanine repeats of the glutamine-rich and asparagine-rich domains of
Sup35 and of the amyloid beta-peptide of amyloid plaques. Proc Natl Acad Sci U S A 99, 5596-5600.
Perutz, M.F., and Windle, A.H. (2001). Cause of neural death in neurodegenerative diseases
attributable to expansion of glutamine repeats. Nature 412, 143-144.
Pierce, M.M., Baxa, U., Steven, A.C., Bax, A., and Wickner, R.B. (2005). Is the prion domain of soluble
Ure2p unstructured? Biochemistry 44, 321-328.
Powers, E.T., and Powers, D.L. (2008). Mechanisms of protein fibril formation: nucleated
polymerization with competing off-pathway aggregation. Biophys J 94, 379-391.
Radivojac, P., Iakoucheva, L.M., Oldfield, C.J., Obradovic, Z., Uversky, V.N., and Dunker, A.K. (2007).
Intrinsic disorder and functional proteomics. Biophys J 92, 1439-1456.
Rogoza, T., Goginashvili, A., Rodionova, S., Ivanov, M., Viktorovskaya, O., Rubel, A., Volkov, K., and
Mironova, L. (2010). Non-Mendelian determinant [ISP+] in yeast is a nuclear-residing prion form of
the global transcriptional regulator Sfp1. Proc Natl Acad Sci U S A 107, 10573-10577.
Romero, P., Obradovic, Z., Li, X., Garner, E.C., Brown, C.J., and Dunker, A.K. (2001). Sequence
complexity of disordered protein. Proteins 42, 38-48.
Ross, E.D., Edskes, H.K., Terry, M.J., and Wickner, R.B. (2005a). Primary sequence independence for
prion formation. Proc Natl Acad Sci U S A 102, 12825-12830.
Ross, E.D., Minton, A., and Wickner, R.B. (2005b). Prion domains: sequences, structures and
interactions. Nat Cell Biol 7, 1039-1044.
Salazar, A.M., Silverman, E.J., Menon, K.P., and Zinn, K. (2010). Regulation of synaptic Pumilio
function by an aggregation-prone domain. J Neurosci 30, 515-522.
Serio, T.R., Cashikar, A.G., Kowal, A.S., Sawicki, G.J., Moslehi, J.J., Serpell, L., Arnsdorf, M.F., and
Lindquist, S.L. (2000). Nucleated conformational conversion and the replication of conformational
information by a prion determinant. Science 289, 1317-1321.
Shorter, J., and Lindquist, S. (2004). Hsp104 catalyzes formation and elimination of self-replicating
Sup35 prion conformers. Science 304, 1793-1797.
Si, K., Choi, Y.B., White-Grindley, E., Majumdar, A., and Kandel, E.R. (2010). Aplysia CPEB can form
prion-like multimers in sensory neurons that contribute to long-term facilitation. Cell 140, 421-435.
Si, K., Lindquist, S., and Kandel, E.R. (2003). A neuronal isoform of the aplysia CPEB has prion-like
properties. Cell 115, 879-891.
Singh, G.P., Chandra, B.R., Bhattacharya, A., Akhouri, R.R., Singh, S.K., and Sharma, A. (2004). Hyperexpansion of asparagines correlates with an abundance of proteins with prion-like domains in
Plasmodium falciparum. Mol Biochem Parasitol 137, 307-319.
Sugita, Y., and Okamoto, Y. (1999). Replica-exchange molecular dynamics method for protein
folding. Chemical Physics Letters 314, 141-151.
Takahashi, T., Kikuchi, S., Katada, S., Nagai, Y., Nishizawa, M., and Onodera, O. (2008). Soluble
polyglutamine oligomers formed prior to inclusion body formation are cytotoxic. Hum Mol Genet
17, 345-356.
Tartaglia, G.G., and Vendruscolo, M. (2008). The Zyggregator method for predicting protein
aggregation propensities. Chem Soc Rev 37, 1395-1401.
Tessier, P.M., and Lindquist, S. (2009). Unraveling infectious structures, strain variants and species
barriers for the yeast prion [PSI+]. Nat Struct Mol Biol 16, 598-605.
Titz, B., Thomas, S., Rajagopala, S.V., Chiba, T., Ito, T., and Uetz, P. (2006). Transcriptional activators
in yeast. Nucleic Acids Res 34, 955-967.
105
Toombs, J.A., McCarty, B.R., and Ross, E.D. (2010). Compositional determinants of prion formation
in yeast. Mol Cell Biol 30, 319-332.
Treusch, S., Cyr, D.M., and Lindquist, S. (2009). Amyloid deposits: protection against toxic protein
species? Cell Cycle 8, 1668-1674.
Truant, R., Atwal, R.S., Desmond, C., Munsie, L., and Tran, T. (2008). Huntington's disease: revisiting
the aggregation hypothesis in polyglutamine neurodegenerative diseases. FEBS J 275, 4252-4262.
True, H.L., and Lindquist, S.L. (2000). A yeast prion provides a mechanism for genetic variation and
phenotypic diversity. Nature 407, 477-483.
Turoverov, K.K., Kuznetsova, I.M., and Uversky, V.N. (2010). The protein kingdom extended:
ordered and intrinsically disordered proteins, their folding, supramolecular complex formation, and
aggregation. Prog Biophys Mol Biol 102, 73-84.
Tyedmers, J., Treusch, S., Dong, J., McCaffery, J.M., Bevis, B., and Lindquist, S. (2010). Prion induction
involves an ancient system for the sequestration of aggregated proteins and heritable changes in
prion fragmentation. Proc Natl Acad Sci U S A 107, 8633-8638.
Uversky, V.N. (2008). Amyloidogenesis of natively unfolded proteins. Curr Alzheimer Res 5, 260287.
Vavouri, T., Semple, J.I., Garcia-Verdugo, R., and Lehner, B. (2009). Intrinsic protein disorder and
interaction promiscuity are widely associated with dosage sensitivity. Cell 138, 198-208.
Vitalis, A., Lyle, N., and Pappu, R.V. (2009). Thermodynamics of beta-sheet formation in
polyglutamine. Biophys J 97, 303-311.
Vitalis, A., and Pappu, R.V. (2009). ABSINTH: A New Continuum Solvation Model for Simulations of
Polypeptides in Aqueous Solutions. Journal of Computational Chemistry 30, 673-699.
Vitalis, A., Wang, X., and Pappu, R.V. (2007). Quantitative characterization of intrinsic disorder in
polyglutamine: insights from analysis based on polymer theories. Biophys J 93, 1923-1937.
Vitalis, A., Wang, X., and Pappu, R.V. (2008). Atomistic simulations of the effects of polyglutamine
chain length and solvent quality on conformational equilibria and spontaneous homodimerization. J
Mol Biol 384, 279-297.
Walters, R.H., and Murphy, R.M. (2009). Examining polyglutamine peptide length: a connection
between collapsed conformations and increased aggregation. J Mol Biol 393, 978-992.
Wang, X., Hammer, N.D., and Chapman, M.R. (2008). The molecular basis of functional bacterial
amyloid polymerization and nucleation. J Biol Chem 283, 21530-21539.
Wang, X., Vitalis, A., Wyczalkowski, M.A., and Pappu, R.V. (2006). Characterizing the conformational
ensemble of monomeric polyglutamine. Proteins 63, 297-311.
Wasmer, C., Lange, A., Van Melckebeke, H., Siemer, A.B., Riek, R., and Meier, B.H. (2008). Amyloid
fibrils of the HET-s(218-289) prion form a beta solenoid with a triangular hydrophobic core.
Science 319, 1523-1526.
Weathers, E.A., Paulaitis, M.E., Woolf, T.B., and Hoh, J.H. (2004). Reduced amino acid alphabet is
sufficient to accurately recognize intrinsically disordered protein. FEBS Lett 576, 348-352.
Williamson, T.E., Vitalis, A., Crick, S.L., and Pappu, R.V. (2010). Modulation of polyglutamine
conformations and dimer formation by the N-terminus of huntingtin. J Mol Biol 396, 1295-1309.
Xiao, H., and Jeang, K.T. (1998). Glutamine-rich domains activate transcription in yeast
Saccharomyces cerevisiae. J Biol Chem 273, 22873-22876.
106
Figure 1. Prion formation by Sup35 is promoted by Ns, inhibited by Qs. (A) WT sequence of the Sup35
PrD (top), and Q and N replacement variants. (B) Yeast strains expressing Sup35 variants spotted as 5-fold
serial dilutions onto YPD (nonselective) or SD-ade (prion-selective) plates. Prion states were induced by the
over-expression of PrD-M-EYFP fusions for 24 hours prior to plating. (C) The N-substituted variant of Sup35
can form a prion state that is equivalent to that of WT. White Ade+ Sup35N cells were isolated and passaged
on plates containing 5 mM GdnHCl ("GdnHCl") or transformed with gene-specific knock-out cassettes to
delete RNQ1 ("∆RNQ1") or HSP104 ("∆HSP104"). All presumptive prion strains were curable and lost the
prion state upon deletion of HSP104. A representative [PRION+] strain of Sup35N (right) is compared to a
strong [PRION+] strain of Sup35WT (left). (D) Sup35N can form different conformational variants that are
equivalent to those of Sup35WT. Colonies with weak and strong Ade+ phenotypes were isolated (Figure S2D).
SDS-resistant aggregates were detected by SDD-AGE and immunoblotting with a Sup35C-specific antibody.
(E) Variant Sup35 PrD-M-EYFP fusions were expressed for 24 hours in [RNQ+] cells prior to SDD-AGE
analysis. PrD-M-EYFP was detected with a GFP-specific antibody. (F) Sup35 PrD-M-His7 variants were
purified under denaturing conditions and then diluted to 5 µM in assembly buffer. Reactions were agitated
for 10 sec every 2 min in the presence of non-binding plastic beads. Amyloid formation was monitored by
ThT fluorescence. Data were normalized by the final values achieved for each variant after extended
incubations (Figure S4A). Data represent means +/- SEM.
107
Figure 2. Replacing Ns with Qs eliminates prion-formation by N-rich PrDs. (A) The sequences of the
Ure2 and Lsm4 PrDs (top), along with the Q variants. (B) Yeast strains containing variant Ure2 and Lsm4
PrDs fused to Sup35C were spotted to YPD and SD-ade plates as in Figure 1B. Prion states were induced by
over-expression of PrD-EYFP fusions for 24 hours prior to plating. Representative Ade+ colonies for Ure2WT
and Lsm4WT (but not the few Ade+ colonies observed for Ure2Q) showed SDS-resistant aggregates by SDDAGE and were eliminated by growth on GdnHCl (not shown). (C) Variant Ure2 and Lsm4 PrD-EYFP fusions
were expressed for 24 hrs in [RNQ+] cells prior to SDD-AGE analysis as in Figure 1E. (D) Purified denatured
variants of Ure2 and Lsm4 PrD-His7 were diluted to 20 μM or 5uM, respectively, in assembly buffer.
Reactions were agitated for 10 sec every 2 min in the absence of beads. Amyloid formation was monitored by
ThT fluorescence. Data represent means +/- SEM.
108
Figure 3. Replacing Qs with Ns increases amyloid and prion formation by Q-rich proteins. (A) WT and N
variants of the putative PrD of Gal11, residues 630-720. (B) Yeast strains containing variants of the Gal11 PrD
fused to Sup35C were spotted to YPD and SD-ade plates as in Figure 1B. Prion states were induced by overexpression of PrD-EYFP fusions for 24 hours prior to plating. (C-D) Gal11N PrD-Sup35C-expressing cells can
convert to a prion state. Representative Ade+ cells were isolated and analyzed as in Figure 1C-D. (E) Variant
PrD-M-EYFP fusions were expressed for 24 hrs in [RNQ+] cells, followed by SDD-AGE analysis as in Figure 1D.
(F) The sequence of Huntingtin exon 1 with a homopolymeric expansion of 47 Qs (top), and the N variant
(bottom). (G) HttQ47 and HttN47 fused to EYFP were expressed for 24 hrs in [rnq-] or [RNQ+] cells, followed
by SDD-AGE analysis as in Figure 1E.
109
Figure 4. N-richness reduces proteotoxicity of Q/N-rich proteins. (A) Single-copy plasmids coding for
PrD-EYFP fusions were introduced into [RNQ+] cells. Expression was induced by addition of galactose for 48
hours and protein localization was determined by fluorescence microscopy. (B) [rnq-] or [RNQ+] yeast
bearing the indicated Sup35 PrD-EYFP variants were spotted as 5-fold serial dilutions to plates that either
induced (galactose) or repressed (glucose). Growth on glucose established that equal cell densities were
plated for each variant. Differences in growth on galactose indicate toxicity resulting from expression of the
indicated protein. Duplicate transformants are shown. White dotted lines divide two halves of the same plate
and are provided for clarity. (C) As in (B), but with HttQ47- and HttN47-EYFP.
110
Figure 5. Q-rich proteins preferentially form non-amyloid conformers. (A) Quantitation of soluble,
amyloid, and non-amyloid aggregated protein in assemblies of Sup35 PrD-M-His7 variants. Freshly diluted 5
µM solutions were induced to assemble with end-over-end agitation for 24 hrs. Soluble and aggregated
fractions were partitioned by centrifugation at 39,000 rcf for 30 min. The aggregate fraction was further
resuspended in 1 % SDS and allowed to incubate at 25°C for 30 min, followed by a second centrifugation step.
Protein concentrations are shown (+/- SEM) for the original supernatant (“soluble”), post-SDS supernatant
(“non-amyloid aggregation”) and post-SDS pellet (“amyloid aggregation”). (B-C) Toxicity of variant Sup35
PrD-M-His7 assemblies to human neuroblastoma cells. SH-SY5Y cells incubated for 15 hrs with 2.5 μM of
either freshly diluted or pre-aggregated protein, as indicated, were visually inspected for cell detachment (B)
or assayed for membrane disruption by adenylate kinase release (C).
111
Figure 6. Q-rich proteins have reduced rates of conformational conversion to amyloid. (A) Sup35 PrDM-His7 variants were diluted to 2.5 μM in assembly buffer and incubated for the indicated times prior to the
removal of 50 μl to a nitrocellulose membrane. Pre-amyloid oligomers (top) or total protein (bottom) were
detected with A11 or anti-His6 antibodies respectively. (B) Sup35 PrD-M-His7 variants were diluted to 7.5
μM in assembly buffer containing ThT, followed immediately by the addition of various concentrations (%
m/m) of the respective preformed sonicated amyloid fibers. Reactions were incubated without agitation and
monitored for amyloid polymerization by ThT fluorescence. Nonlinear regression (as shown on left for WT, fit
to one-phase association curves) was used to determine initial rates of amyloid elongation (as shown in
middle, plotted against normalized seed concentrations). Dotted lines denote the 95% CI of the best fit line.
Slopes of the best fit lines show the seeding efficiencies of each variant amyloid preparation, relative to WT
(right). (C) The ability of individual variants to polymerize onto heterologous pre-assembled amyloids. 5 μM
soluble protein was seeded with 10% (m/m) preformed aggregates in each case. Data show means +/- SEM.
112
Figure 7. Molecular simulations of polyN (N30) and polyQ (Q30). (A) Fraction of ordered β-sheet
(quantified by significant DSSP-E scores) formed by N30 and Q30. Single N30 and Q30 molecules were simulated
in the absence (dark blue) or presence (yellow) of local conformational restraints that pre-pay the perresidue entropic penalty for populating the β-basin in conformational space. Pairs of N30 and Q30 molecules
simulated with (cyan) or without (dark brown) local conformational restraints show the effects of homotypic
intermolecular interactions on ordered β-sheet content. (B) Temperature-dependent probabilities of
realizing homotypic intermolecular associations, quantified as the probability that the intermolecular
(center-of-mass to center-of-mass) distance between the pair of N30 or Q30 molecules is ≤ 25Å (corresponding
to less than 0.025% of the total volume available to the molecules in the simulation setup). Simulations were
performed for pairs of N30 and Q30 molecules without (dark blue and yellow) and with (cyan and dark brown)
local conformational restraints. (C) Visual comparison of ordered β-sheet structures formed by N30 (left) and
Q30 (right) molecules in the presence of local conformational restraints. The fractional β-content fβ is 0.78 for
both of the structures shown. Note the tighter turn formed by N30 relative to Q30, and the resulting differences
in the lengths of intramolecular antiparallel β-sheets.
113
Supplemental Figure 1. Variant PrD fusions are expressed at equal levels but have different
aggregation propensities in vivo. (A-C) Constructs containing the coding sequences of the variant PrD-EYFP
chimeras under the control of a galactose-regulatable promoter were introduced into yeast cells. The
resulting transformants were grown for 24 hours under inducing conditions (in the presence of galactose)
and cell lysates were prepared and subjected to SDS-PAGE. Separated proteins were analyzed by
immunoblotting with a GFP-specific antibody. Detection of Rnq1 with an Rnq1-specific antibody was used to
demonstrate equal loading. (D-F) Yeast cells containing expression constructs for variant PrD-EYFP fusions
were grown for 48 hours under inducing conditions and cell lysates were prepared and subjected to SDDAGE. Separated protein particles were transferred to a nitrocellulose membrane and analyzed with a GFPspecific antibody.
114
Supplemental Figure 2. Variant Sup35C fusions are expressed at comparable levels, but differ in their
propensities to adopt a prion state. (A) Cell lysates of yeast cells expressing Sup35WT, Sup35N and Sup35Q
were analyzed by immunoblotting with a GFP-specific antibody. Equal loading was demonstrated by
immunodetection of Rnq1 with a Rnq1-specific antibody. (B) Yeast cells expressing Sup35WT, Sup35N and
Sup35Q display comparable colony colors when in the [prion-] states, indicating that the variant fusion
proteins are soluble and have no defects in translation termination. (C) Yeast strains containing variant
Sup35 differ in the prion induction frequency and their dependence on [RNQ+]. Sup35WT, Sup35N and Sup35Q
yeast were grown to mid-log phase, normalized by OD600 and plated onto YPD and SD-ade plates. Prion states
were induced prior to plating by overexpression of PrD-EYFP fusions for 24 hours. Yeast cells deleted for
RNQ1 (∆RNQ1) and HSP104 (∆HSP104) were compared to wild-type cells (WT). (D) Sup35N can form prion
strains that are reminiscent of strong and weak [PSI+]. The prion state was induced by expression of Sup35N
PrD-EYFP for 24 hr and the cells were subsequently plated onto adenine-deficient medium to select for
prions. Ade+ colonies were isolated and transferred to YPD plates. Weak and strong prion variants that
resulted from de novo induction of [PSI+] are shown for comparison (left). (E) WT and Q-substituted Ure2 PrD
and Lsm4 PrD fused to Sup35C have similar expression levels. Fusion proteins were detected in cell lysates by
immunoblotting with a C domain-specific anti-Sup35 antibody. Equal loading was demonstrated by
immunodetection of Rnq1 with a Rnq1-specific antibody. (F) Yeast cells expressing variant Ure2 PrD-Sup35C
and Lsm4 PrD-Sup35C display comparable colony colors when in the [prion-] states, indicating that fusion
proteins are soluble and behave normally.
115
Supplemental Figure 3. Variant Gal11 PrD fusions are expressed at equal levels but have different
aggregation propensities in vivo. (A) Constructs containing the coding sequences of Gal11 PrD-EYFP
variants under the control of a galactose-regulatable promoter were introduced into yeast cells.
Transformants were grown for 24 hours in the presence of galactose to induce expression and cell lysates
were prepared and subjected to SDS-PAGE. Separated proteins were analyzed by immunoblotting with a GFPspecific antibody. Detection of Rnq1 with an Rnq1-specific antibody was used to demonstrate equal loading.
(B) Yeast cells containing variant Gal11 PrD-EYFP expression constructs were grown for 48 hours under
inducing conditions (in the presence of galactose) and cell lysates were prepared and subjected to SDD-AGE.
Separated protein particles were transferred to a nitrocellulose filter and analyzed with a GFP-specific
antibody. (C) WT and N-substituted Gal11 PrD have similar expression levels when fused to Sup35C. Fusion
proteins were detected in cell lysates by immunoblotting with a C domain-specific anti-Sup35 antibody. (D)
Yeast cells expressing WT and variant Gal11 PrD-Sup35C display similar colony colors when in the [prion-]
state.
116
Supplemental Figure 4. Q-substituted variants of the Sup35 and Ure2 PrDs can enter prion states
under highly permissive conditions. (A) Purified denatured Sup35 PrD-M-His7 variants diluted to 5 μM in
assembly buffer were incubated with-end-over rotation for 5 days and then examined for ThT-fluorescence
(error bars = SEM). (B) ADH1 promoter-driven expression constructs for Sup35PrD-M-Sup35C or Ure2PrDSup35C were introduced into yeast cells to replace the endogenous SUP35 gene. The resulting strains were
transformed with plasmids containing coding sequences for EYFP fusions to the PrDs of Sup35 and Ure2
under the control of the strong GPD promoter. To select for prion states the cells were then plated onto
adenine-deficient medium and Ade+ colonies were transferred onto YPD plates. Yeast strains showing a
white colony color on YPD were lysed and the resulting lysates were analyzed by SDD-AGE and
immunoblotting with an antibody specific to the C domain of Sup35.
117
Supplemental Figure 5. Additional data for Ure2 PrD-M-His7. (A) Initial rates of amyloid elongation, as
for Sup35 in Figure 6B. (B) Cross-seeding analysis, as for Sup35 in Figure 6C. (C) Toxicity of aggregates to SHSY5Y cells, as for Sup35 in Figure 4D.
118
Supplemental Figure 6. Determination of relative polymerization rates. (A) Aggregates of Sup35 and
Ure2 PrD-M-His7 variants assembled as in Figure S4A were collected by ultracentrifugation, resuspended in
fresh assembly buffer, sonicated, and then examined by SDD-AGE. This ensured that the preparations
contained approximately the same number of fiber ends per mass of polymer. Note that SDD-AGE often fails
to detect protein monomers. Consequently, the absence of detectable monomers on this blot does not indicate
an absence of SDS-soluble species in the assemblies. (B) SDS-resistant protein was quantified by differential
entry into an SDS-PAGE gel following incubation in sample buffer at either 25°C or 95°C. (C) The indicated
proteins were diluted to 7.5 μM in assembly buffer containing the indicated concentrations of SDS-resistant
pre-assembled fibers, and monitored for ThT fluorescence over time. ThT data were normalized by the
calculated fluorescence for 100% assembly (final ThT data for 7.5 μM seed stocks, divided by SDS-resistant
fraction). Data from three replicates each were fit to one-phase association curves. To achieve a better fit at
early time points, Sup35Q was fit to two-phases. Data indicate means +/- SEM.
119
Supplemental Figure 7. Dependence of polymerization rates on substrate concentration. Purified
denatured proteins were diluted to the indicated concentrations in assembly buffer containing a fixed
concentration of seed (0.02 µM total seed stock for Sup35WT, Sup35N and Ure2WT, or 0.2 µM total seed stock
for Sup35Q and Ure2Q) and examined for ThT fluorescence over time. Initial assembly rates were determined
as in Figure S6. For qualitative comparisons of the relationship between assembly rate and substrate
concentration, data for each variant were normalized by the slope of the linear regression against added
substrate protein. Data indicate means +/- SEM.
120
Supplemental Figure 8. Prions exhibit abnormally more Ns than expected given the sequence
frequency of proline (P), while conversely containing slightly fewer Qs than expected. (A) The 92 Q/Nrich sequences were clustered by their “prion score” as defined (Alberti et al., 2009). On the y-axis, the
difference between the frequency of N and that which is expected given the sequence frequency of P. (B)
Similarly, the y-axis depicts the difference between the frequency of Q and that which is expected given the
sequence frequency of P. Boxes include upper and lower quartiles; median in red; whiskers cover full range of
values.
121
122
Supplemental Figure 9. Amyloid prediction algorithms do not predict a strong difference between N
and Q. TANGO and Zyggregator predictions were run on all 92 Q/N-rich sequences from Alberti et al. (Alberti
et al., 2009) using a pH of 7. For each sequence, NQ and QN predictions were also performed. (A) TANGO
predicted an AGG score of 0 for 51 of the 92 sequences. Shown are sequences with non-zero scores. Such low
scores generally indicate very low likelihoods for amyloid formation; for comparison, the Aβ1-42 peptide
received a score of 1565. (B) For the 41 sequences receiving a non-zero AGG score, the percent change in AGG
score between WT and NQ substitutions and between WT and QN substitutions is given. In 39 cases, the
NQ substitution produced higher amyloid propensity. (C) Zyggregator scores (Zagg) for all 92 sequences
are provided. Zagg score values range between 0.5 and 1.0 for most peptides and proteins (shaded region).
Scores below 0.5 suggest unusual resistance to aggregation while scores above 1.0 are considered
aggregation-prone (Luheshi et al., 2007). All scores fall within the normal or aggregation-resistant range. (D)
The percent change in Zagg score between WT and NQ substitutions and between WT and QN
substitutions is given.
123
Supplemental Figure 10. Correlation of Q- and N-richness with dosage sensitivity. Shown is a scatter
plot depicting the relation between Q-richness (horizontal axis), N-richness (vertical axis), dosage sensitivity
(red x for OE toxic proteins, grey o for OE nontoxic proteins) and disorder (indicated by marker size). Marker
sizes increase with disorder, binned into 10 quantiles, so that e.g. the smallest size is for the 10% of proteins
with the fewest disordered residues and the largest size is for the 10% of proteins with the most disordered
residues. Coordinates of points were jittered by up to 0.5 in each direction to reduce overlap.
124
Chapter Four
Epigenetics in the Extreme: Prions and the
Inheritance of Environmentally Acquired Traits
This chapter was published previously: Halfmann, R. and Lindquist, S. (2010). Science 330(6004),
629-32
125
In its modern usage, “epigenetics” encompasses all mechanisms for the inheritance of biological
traits that do not involve alterations of the coding sequence of DNA (Rando and Verstrepen, 2007).
Considered elsewhere in this issue are well known epigenetic mechanisms that control access to
DNA by modifying nucleotides or associated histones, or involve the transmission of information
through RNA. Here, we discuss an extreme case of epigenetic inheritance with a mechanism that is
not based on heritable changes in nucleic acid. Instead it is based on robust self-propagating
changes in the folding of certain proteins known as prions.
Prions operate outside the canonical steps of molecular biology’s central dogma. As protein-
based elements of inheritance, prions perpetuate not by changing the way that genetic information
is transcribed or translated, but rather, by co-opting the final step in the decoding of genetic
information – protein folding. A key feature of prion-forming proteins is their ability to exist in very
different stable conformational states. In addition to a “native” non-prion conformation, they
occasionally fold into a prion conformation that then replicates itself by templating the
conformational conversion of other molecules of the same protein. These changes in conformation
profoundly alter the functions of the proteins involved, resulting in phenotypes unique to each
determinant protein.
The idea that proteins could transmit information in a manner analogous to nucleic acids was
first conceived to explain bafffling infectious neurodegenerative diseases (e.g. Kuru and mad cow
disease; reviewed in Aguzzi and Calella, 2009). As evidence accumulated that these diseases did not
require nucleic acids for transmission, the infectious agent was postulated to be a self-replicating
protein. It is now clear that the prion does not synthesize itself from individual amino acids. Rather,
it is a host-encoded protein in a conformation profoundly different from normal. The prion
“replicates” simply by templating that conformation to other molecules of the protein. The initially
mysterious and controversial nature of infectious prions created such a stir that, even today, it
sometimes overshadows what we believe is a far more interesting aspect of prion biology: the
ability of proteins to serve as elements of heredity.
In the baker’s yeast, S. cerevisiae, prions create dominant cytoplasmically-transmitted traits that
are, in contrast to the original disease-causing prion in mammals, often advantageous to the
organism (reviewed in Halfmann et al., 2010). Most biochemically characterized prion proteins
have a modular prion-forming domain that is highly disordered in its native state (Serio et al., 2000;
Alberti et al., 2009). The extreme flexibility of these domains facilitates their occasional conversion
to a self-propagating conformer, which, for most prions, is a well-ordered fibrillar protein polymer,
or amyloid. De novo prion formation appears to proceed through a high-energy oligomeric nucleus
126
that is stabilized by interacting with, and converting, other prion proteins to the same conformation
(Eigen, 1996; Patino et al., 1996; Serio et al., 2000) (Figure 1A). The elongating prion polymer is
then severed into smaller actively growing pieces by the action of protein remodeling factors like
the disaggregase Hsp104 (reviewed in Shkundina and Ter-Avanesyan, 2007). Finally, the resulting
fragments are disseminated to daughter cells, ensuring the stable inheritance of the selfperpetuating prion template through round after round of cell division. Indeed, prions are stable
even during mating and meiosis, allowing their transmission through the germline. Prion states are
not irreversible, however. Random fluctuations in prion dissemination to daughter cells, as well as
changes in the activities of remodeling proteins and other factors, can generate daughter cells with
the original non-prion state (Figure 1B).
To date, at least nine different proteins are known to form prions in S. cerevisiae (Halfmann et
al., 2010; Rogoza et al., 2010), and an additional eighteen have experimentally verified prionforming domains (Alberti et al., 2009). The best understood prion protein, Sup35, is a translation
termination factor whose ability to form prions has been conserved for hundreds of millions of
years of fungal evolution (Chernoff et al., 2000). When Sup35 switches to a prion state, its ability to
function in translation is compromised, leading to increased stop codon readthrough and ribosome
frameshifting (True et al., 2004; Namy et al., 2008a) (Figure 1C). The resulting changes in gene
expression have diverse phenotypic effects, including alterations in cell-adhesion, nutrient
utilization, and resistance to various toxins and antibiotics (True et al., 2004; Tyedmers et al.,
2008). Importantly, these phenotypes differ in different strain backgrounds, presumably due to
genetic variation in sequences downstream of stop codons that are silent in the absence of the
prion.
Prions diversify protein function.
Many prion phenotypes result from qualitative changes in protein function. As function is
dictated by structure, the refolding of a polypeptide into its prion form can dramatically alter the
non-prion function and can even create novel gains of function. Aside from the ability to template
their own conformational changes through homotypic interactions, some prion conformers form
new interactions with other proteins. For example, the prion form of the HET-s protein in the
filamentous fungus Podospora anserina interacts with an allelic variant of the same protein that is
itself incapable of forming prions. This interaction is the basis of a self/non-self discrimination
system that reduces the spread of parasitic cytoplasmic elements (Saupe, 2007). Likewise, the prion
form of the S. cerevisiae Rnq1 protein has the ability to interact with other prion forming proteins.
127
In this case, the interaction stimulates those proteins to convert to their own prion states (reviewed
in Shkundina and Ter-Avanesyan, 2007) (Figure 1C). Another example of functionality gained in the
prion state is that of the S. cerevisiae transcriptional regulator, Sfp1. In this case, prion formation
causes resistance to translation inhibitors and, remarkably, increases the cells’ growth rate on rich
media – phenotypes distinct from those of the non-prion state and opposite those of the genetic
knockout of Sfp1 (Rogoza et al., 2010).
Prions respond to environmental extremes.
The way that proteins fold and interact with other proteins is exquisitely sensitive to
environmental stress and the status of the protein folding machinery. Abrupt changes in
temperature, pH, and intracellular metabolites can have immediate consequences for protein
folding and the regulation of protein chaperones and protein remodeling factors. Not surprisingly,
then, environmental stresses also dramatically increase rates at which prions appear and disappear
(Tyedmers et al., 2008). The more extreme the stress, the greater the frequency of prion switching.
Hence a second meaning invoked by our title – “epigenetics in the extreme”. In this way, prions
connect environmental stresses with an unusual type of phenotypic plasticity that could improve an
organism’s ability to adapt to altered environments. When organisms experience protein
homeostatic stress – which will commonly occur when they are poorly adapted to their
environment – increases in protein “misfolding” and concomitant prion formation will facilitate the
exploration of alternative phenotypes (Figure 1). Indeed, we postulate that the accelerated
appearance of prions in response to stress constitutes an evolved bet-hedging strategy: it allows a
fraction of cells to try new phenotypes that, with reasonable frequency, prove beneficial (Halfmann
et al., 2010; Rogoza et al., 2010). The self-sustaining nature of prions ensures that successful
strategies are immediately heritable to subsequent generations. Prions then, are a quasiLamarckian (Rando and Verstrepen, 2007; Koonin and Wolf, 2009) mechanism that connects
environmental conditions to the acquisition and transgenerational inheritance of new traits.
Prions allow for the sudden appearance of complex traits.
Complex evolutionary adaptations are the product of multiple interacting genetic loci
(Weissman et al., 2009). A plausible mechanism for the appearance of complex adaptations is
phenotypic capacitance. Phenotypic capacitance is a property of certain biological systems that
allows for the accumulation of genetic variation in a silent form, followed by its sudden stepwise
release to create new phenotypes (reviewed in Masel and Siegal, 2009). Because prions allow cells
128
to switch between two distinct and heritable physiological states, they provide one of the clearest
examples for the reversible expression of natural genetic variation. In contrast to other
mechanisms for genetically encoded stochastic phenotypic variation, such as Hsp90-buffered
protein folding and variably methylated CpG islands (Feinberg and Irizarry, 2010), newly revealed
prion-based phenotypes are immediately and robustly heritable. These traits can ultimately
become hardwired by subsequent genetic changes, as demonstrated for phenotypes revealed by
Sup35 prion formation (True et al., 2004). This observation provides experimental validation for
the conjecture of West-Eberhard that in some cases genes may be followers rather than leaders in
evolution (West-Eberhard, 2003; Jablonka and Raz, 2009).
Yeast prions are well-positioned to alter the phenotypic effects of genetic variation. The
approximately two dozen prionogenic proteins discovered to date in yeast are enriched for proteins
with information processing functions, including transcription factors and RNA-binding proteins
(Alberti et al., 2009; Halfmann et al., 2010). Some, like Swi1, Cyc8, and Sfp1, are globally acting
transcriptional regulators of a large fraction of the yeast genome (Du et al., 2008; Patel et al., 2009a;
Rogoza et al., 2010). Others, like Puf2, Ptr69, and Pub1, act post-transcriptionally on the stabilities
of hundreds of functionally diverse mRNAs (Hogan et al., 2008). Due to the large number of
regulatory targets of these proteins, reductions or alterations in their activities resulting from their
conversion to a prion conformation can have large, and complex, phenotypic effects. Importantly,
these effects also change the strength of the selective pressures that act on prion targets, resulting
in these target sequences diverging at different rates when expressed under the prion versus nonprion states. As a consequence, prion-revealed phenotypes will tend to differ between genetic
backgrounds (True et al., 2004). Thus, prions create phenotypic diversity on two levels: within
isogenic populations they create distinct physiological states (prion versus non-prion), and within
genetically diverse populations, they enhance the effects of genetic variation between lineages.
A wider range of prion phenomena?
In multicellular organisms, developmental signals trigger the epigenetic switches that drive cell
differentiation. These switches parallel prions in that both respond (directly or indirectly) to
changes in the extracellular environment. In S. cerevisiae, chromatin remodeling factors like Swi1
and Cyc8 participate in epigenetic decisions that govern, for example, whether the cells grow as
unicellular or as cohesive multicellular forms (Fleming and Pennings, 2001). The fact that Swi1 and
Cyc8 also form prions suggests a possible functional link between chromatin-based and prion-
based regulatory strategies. In higher eukaryotes, too, prion-like switches may be involved in cell
129
remodeling processes. During memory formation, individual synapses must acquire a durable
molecular “mark” that establishes – amongst the many hundreds of such marks most neurons carry
– the individual long-term maintenance of that synapse. One protein contributing to this mark,
neuronal CPEB, appears to undergo a prion-like conformational switch that can activate translation
of synaptic mRNAs while simultaneously creating a non-diffusable self-sustaining aggregate that
can act as a molecular memory (Si et al., 2010). We fully expect that many such prion-like
physiological switches await discovery as our abilities to characterize protein complexes and
protein aggregates in vivo continue to improve.
A large array of regulatory strategies influences protein folding and may, in the future, prove to
blur distinctions between prions and other epigenetic mechanisms for perpetuating phenotypes.
Covalent
modifications
including
disulfide
formation,
phosphorylation,
ubiquitination,
glycosylation, etc., as well as protein-protein interactions (e.g. chaperone binding and prion
templating) can all profoundly change protein folding landscapes and/or the activity of folded
proteins. We note that all of these forms of regulation can theoretically give rise to self-sustaining
heritable – that is, epigenetic – states. In fact, examples of these types of heritable factors now
include an autoactivatable kinase, an autoactivatable protease, and a novel prion that appears to
result from the interaction of two separate proteins involved in glucose signaling (Brown and
Lindquist, 2009; Jablonka and Raz, 2009).
The origins of prions.
The propensity of proteins to misfold and aggregate is likely as ancient as protein-based life
forms themselves. Indeed, most polypeptides have an inherent tendency to form self-templated
amyloid structures (Chiti and Dobson, 2006). Prion-forming proteins are unusual in having a
conformational flexibility that allows access to the amyloid fold under physiological conditions
(Alberti et al., 2009; Uversky, 2009). This property derives in part from a greatly reduced amino
acid complexity compared to globular proteins (Romero et al., 2001; Alberti et al., 2009). We
suggest that primordial proteins would have had similarly simple sequences resulting in an
elevated tendency to form self-perpetuating structures. Further, early biological systems would
have lacked elaborate protein folding machinery whose primary modern role is the prevention of
protein aggregation. Without strong control over the important final step in the processing of geneencoded information – protein folding – ancient polypeptides would have unencumbered access to
self-perpetuating prion states. We speculate that prion formation by ancient proteins may have
played a central role in the molecular evolution of early biological systems.
130
Our increasing awareness of prion phenomena highlights the fact that protein folding is not
always uniquely specified by an amino acid sequence, but instead provides a rich substrate for
epigenetic determination of the map between genotype and phenotype. Beyond our speculative
thoughts about early life, we suggest that prions are not simply elements of disease transmission,
but make unique contributions to the flow of genetic information that are likely to profoundly
influence the adaptive success, and therefore the evolution, of prion-containing organisms.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
O. J. Rando, K. J. Verstrepen, Cell 128, 655 (Feb 23, 2007).
A. Aguzzi, A. M. Calella, Physiol Rev 89, 1105 (Oct, 2009).
R. Halfmann, S. Alberti, S. Lindquist, Trends Cell Biol 20, 125 (Mar).
T. R. Serio et al., Science 289, 1317 (Aug 25, 2000).
S. Alberti, R. Halfmann, O. King, A. Kapila, S. Lindquist, Cell 137, 146 (Apr 3, 2009).
M. Eigen, Biophys Chem 63, A1 (Dec 10, 1996).
M. M. Patino, J. J. Liu, J. R. Glover, S. Lindquist, Science 273, 622 (Aug 2, 1996).
I. S. Shkundina, M. D. Ter-Avanesyan, Biochemistry (Mosc) 72, 1519 (Dec, 2007).
T. Rogoza et al., Proc Natl Acad Sci U S A 107, 10573 (Jun 8).
Y. O. Chernoff et al., Mol Microbiol 35, 865 (Feb, 2000).
O. Namy et al., Nat Cell Biol, (Aug 1, 2008).
H. L. True, I. Berlin, S. L. Lindquist, Nature 431, 184 (Sep 9, 2004).
J. Tyedmers, M. L. Madariaga, S. Lindquist, PLoS Biol 6, e294 (Nov 25, 2008).
S. J. Saupe, Prion 1, 110 (Apr, 2007).
A. K. Lancaster, J. P. Bardill, H. L. True, J. Masel, Genetics 184, 393 (Feb).
E. V. Koonin, Y. I. Wolf, Biol Direct 4, 42 (2009).
D. B. Weissman, M. M. Desai, D. S. Fisher, M. W. Feldman, Theor Popul Biol 75, 286 (Jun, 2009).
J. Masel, M. L. Siegal, Trends Genet 25, 395 (Sep, 2009).
A. P. Feinberg, R. A. Irizarry, Proc Natl Acad Sci U S A 107 Suppl 1, 1757 (Jan 26).
M. J. West-Eberhard, Developmental plasticity and evolution. (Oxford University Press, Oxford ;
New York, 2003), pp. xx, 794 p.
E. Jablonka, G. Raz, Q Rev Biol 84, 131 (Jun, 2009).
Z. Du, K. W. Park, H. Yu, Q. Fan, L. Li, Nat Genet 40, 460 (Apr, 2008).
B. K. Patel, J. Gavin-Smyth, S. W. Liebman, Nat Cell Biol, (Feb 15, 2009).
D. J. Hogan, D. P. Riordan, A. P. Gerber, D. Herschlag, P. O. Brown, PLoS Biol 6, e255 (Oct 28,
2008).
A. B. Fleming, S. Pennings, EMBO J 20, 5219 (Sep 17, 2001).
K. Si, Y. B. Choi, E. White-Grindley, A. Majumdar, E. R. Kandel, Cell 140, 421 (Feb 5).
J. C. Brown, S. Lindquist, Genes Dev 23, 2320 (Oct 1, 2009).
F. Chiti, C. M. Dobson, Annu Rev Biochem 75, 333 (2006).
V. N. Uversky, Front Biosci 14, 5188 (2009).
P. Romero et al., Proteins 42, 38 (Jan 1, 2001).
131
Fig. 1 Prion epigenetics. (A) The "life cycle" of a yeast amyloid prion. Soluble nonprion conformers in [prion–
] cells occasionally fold into an oligomeric amyloid nucleus, which then grows by sequestering additional
nonprion conformers and templating their conformational conversion. The resulting prion particle divides
into smaller transmissible pieces through the action of protein-remodeling factors such as Hsp104. The prion
particles are disseminated to daughter cells during cell division. (B) Prion formation and loss are promoted
by stress, and this provides a mechanism for the acquisition of heritable phenotypes in response to
environmental changes. [prion–] cells are well adapted to environment 1, but are poorly adapted to
environment 2. When the environment changes, stress-induced changes in protein homeostasis result in an
increased frequency of prion appearance ([PRION+] cells) and consequently the exploration of new
phenotypes. Some phenotypes revealed by prions provide a fitness advantage in environment 2, so that
[PRION+] cells survive and proliferate. The occasional loss of prion states—a process that is also increased by
stress—ensures that [prion–] cells will be available when conditions return to normal (environment 1).
132
Fig. 2. Prion phenotypes can result from either a loss of function or a gain of function when the prion protein
acquires its prion conformation. (Left) The [PSI+] prion conformation of the translation termination factor
Sup35 prevents it from associating with ribosomes. This results in the translational read-through of stop
codons and corresponding C-terminal extensions that alter the activities of newly synthesized proteins.
(Right) The Rnq1 protein, in its prion state, acquires the ability to induce other proteins, such as Sup35, to
convert to their own prion states.
133
134
Appendix A
Evolutionary Capacitance by Yeast Prions
This chapter is being prepared for submission: Halfmann, R., Lancaster, A., and Lindquist, S.
135
ABSTRACT
Some proteins, known as prions, can undergo self-sustaining conformational conversions, leading
to changes in their activities that are heritable across thousands of generations. The ability of these
proteins to switch between conformational states has been theorized to have adaptive value in the
baker’s yeast, Saccharomyces cerevisiae, by accelerating the appearance of new phenotypes.
Evidence that prions have evolved to such purpose, however, is lacking. We find that prion-like
transcription factors preferentially regulate certain rapidly evolving gene families. Examining one
of these factors in detail, Mot3, we find that frequent prion switching affects the expression of
genetic variation within the genes it regulates, resulting in new mating and cell adhesion
phenotypes. These findings suggest that prion formation by yeast regulatory proteins facilitates the
acquisition of new traits.
INTRODUCTION
Heritable phenotypic diversity is the substrate of natural selection. New phenotypes allow
organisms to adapt to changing environments, but the ability of mutations to cause new phenotypes
is strongly inhibited by selective pressures that act to stabilize local phenotypic optima (Masel and
Trotter, 2010). Evolutionary capacitors temporarily reduce genetic robustness, facilitating the
aquisition of new phenotypes, which, on occasion, prove adaptive (Rutherford and Lindquist, 1998;
Masel and Trotter, 2010).
An unusual mechanism for the acquisition of new phenotypes based on heritable variation
involves self-perpetuating protein conformations, or prions (True and Lindquist, 2000; Halfmann et
al., 2010). Prions are best characterized in the baker’s yeast, Saccharomyces cerevisiae, where they
act as cytoplasmic epigenetic elements. Prion conformers interact with nonprion conformers of the
same protein and template their conformational conversion to the same, self-perpetuating state.
The structural changes accompanying prion formation profoundly alter the activities of prion
proteins, resulting in heritable phenotypes that, under diverse conditions, can be advantageous to
their host cells (reviewed in Halfmann and Lindquist, 2010). The best understood prion, [PSI+], is
formed by the translation termination factor, Sup35. [PSI+] reduces Sup35’s normal activity and
consequently increases frequencies of ribosomal frameshifting and stop codon read through
(Liebman and Sherman, 1979; True et al., 2004; Wilson et al., 2005; Namy et al., 2008a). The
resulting alterations in newly synthesized proteins can cause phenotypic changes to, for example,
136
colony morphology, antibiotic resistance, and carbon source utilization. Because [PSI+]
spontaneously appears and disappears from cells at low frequencies, it acts as a bistable phenotypic
switch. In the prion-free state, mutations downstream of stop codons are buffered and free to
accumulate in a silent form. But when Sup35 switches to [PSI+], these accumulated mutations are
suddenly revealed. Because mutations accumulate at higher rates in the buffered, prion-free state,
the spectrum of phenotypes revealed by [PSI+] tends to differ between genetic backgrounds.
For Sup35, and likely for other prion proteins, conformational conversion into and out of
the prion state is influenced by changes in protein homeostasis (Tyedmers et al., 2008). Thus,
environmental stresses increase the rates at which cells switch between prion states. In effect,
prions accelerate the exploration of new phenotypes precisely when they are most likely to have
adaptive value (Tyedmers et al., 2008; Halfmann et al., 2010; Lancaster et al., 2010).
Of the approximately two dozen prionogenic proteins now known in yeast, regulatory
proteins like transcription factors and RNA binding proteins are over-represented (Alberti et al.,
2009). Prion-driven alterations in the activities of these proteins, as with [PSI+], may relax genetic
robustness by reducing the fidelity of processes that regulate and decode genetic information
(Halfmann et al., 2010). Consequently, many yeast prions are situated to act as evolutionary
capacitors. Whether prions have evolved to this purpose, however, is unclear (Nakayashiki et al.,
2005; Sniegowski and Murphy, 2006; Halfmann et al., 2010).
Arguably the greatest challenge to evolutionary capacitance is the fact that, for most
genomic loci, random mutations tend to be deleterious far more frequently than beneficial
(Sniegowski and Murphy, 2006). The haphazard revelation of cryptic variation by prion switching
would seem to be a poor adaptive strategy. Even when potential adaptations lie hidden within the
genome, they may not be accessible through a general reduction in genetic robustness, because this
would simultaneously reveal an excess of maladaptive variants elsewhere in the genome (Masel,
2006). Mechanisms that reduce the frequency of potentially maladaptive variants, for instance, by
mild pre-adaptive selection, are essential to the evolution of evolutionary capacitors (Masel, 2006).
The probability that revealed variation will be adaptive versus maladaptive differs
throughout the genome. Genome architectures reflect the fact that novel genetic variation will
benefit some gene functions more frequently than others. Telomeric regions, for example, have
accelerated rates of mutation and recombination that engender rapid duplication and
diversification of certain types of genes (Verstrepen and Fink, 2009; Brown et al., 2010). In yeast,
genes residing in subtelomeres tend to have niche-specific functions involving stress responses,
metabolism, and membrane transport. They tend not to have house-keeping activities such as
137
ribosomal function, cell-cycle control, and DNA-maintenance and repair (Fabre et al., 2005; Brown
et al., 2010). The broadened functionalites of yeast subtelomeric gene families reflect the ecological
and evolutionary history of the species (Fabre et al., 2005; Brown et al., 2010). Tandem repeats, or
microsatellites, are another genetic mechanism that greatly expedites the appearance of novel
genetic variants. As with subtelomeres, tandem repeat-containing regions are highly polymorphic
and enriched for gene activities that enable rapid alterations in expression and functionality (Rando
and Verstrepen, 2007; Vinces et al., 2009).
Due to the types of genes they regulate, and the nature of the genetic changes they create,
subtelomeres and tandem repeats are less likely to produce maladaptive variation than other types
of mutations. We reasoned, therefore, that they may be more likely to sustain the evolution of
evolutionary capacitors that specifically target these regions. Indeed, it has been previously
suggested that the localized uncovering of hidden variation by regulated subtelomeric silencing
may have an analogous effect to the expression of 3’ UTRs by [PSI+] (Rando and Verstrepen, 2007).
Here, we bring this analogy full circle. We show that prion proteins preferentially target
subtelomeric and tandem repeat-containing genes, and by doing so, accelerates the revelation of
new phenotypes.
RESULTS
Widespread regulation of subtelomeric and tandem repeat-containing genes by prion-like
transcription factors
We asked whether yeast genes with genomic features that promote genetic variation –
tandem repeats or a subtelomeric location – might be preferentially targeted by prions. To do so,
we employed a prion-predicting algorithm (Alberti et al., 2009) calibrated on all known yeast
prion-forming sequences (those identified in Alberti et al., 2009; Nemecek et al., 2009; Rogoza et al.,
2010) to rank yeast proteins by predicted prion-forming tendencies. Transcriptional targets of the
highest scoring transcription factors (n = 13) in the top 100 predicted prions were then obtained
from YEASTRACT (http://yeastract.com; Teixeira et al., 2006), and compared against lists of either
subtelomeric ORFs, defined as those ORFs with translational start sites residing within
subtelomeric coordinates identified by Llorente et al. (Llorente et al., 2000), or tandem-repeat
containing ORFs (Verstrepen et al., 2005).
Indeed, both of these gene categories were significantly more often regulated by
transcription factors that contain predicted prion domains (Table 1). The enrichment for
138
subtelomeric genes is robust to errors in our prediction methodology: it remains highly significant
even after eliminating the predicted prion proteins that make the strongest contribution: Rlm1,
Sok2, and Mot3 (p = 1.17 x 10-13).
Prion characteristics of the transcriptional repressor Mot3
We had previously discovered that Mot3 can form an amyloid-based prion state that
reduces its transcriptional repressor activity (Alberti et al., 2009). In keeping with prion
nomenclature we designated this [MOT3+], with capital letters denoting the fact that prions are
dominant in genetic crosses and brackets denoting cytoplasmic inheritance. To further establish
Mot3’s prion behavior, we utilized a genetic reporter that confers a Ura+ phenotype upon [MOT3+]-
driven derepression of the DAN1 locus (Alberti et al., 2009) (Fig. 1A). Spontaneous Ura+ cells were
obtained by growth on media lacking uracil, and the phenotype confirmed to be prion-based by its
ability to be eliminated by treating cells with a low concentration (5 mM) of guanidine
hydrochloride (GdHCl) (Fig. 1B). GdHCl is a chemical inhibitor of Hsp104, a protein remodeling
factor whose activity is essential for the propagation of most prions. Sporulation of these cells
revealed 4:0 segregation of Ura+, consistent with a cytoplasmically inherited trait (Fig. 1B).
Prions generally phenocopy loss-of-function mutations in their determinant genes.
However, unlike genetic mutations, prions cannot be complemented by the full-length prion gene.
Proteins containing the prion domain will simply be inactivated by the prion state. Indeed, such was
the case for [MOT3+]: cells remained Ura+ upon exogenous expression of WT MOT3 (Fig. 1C). Mot3
has an intrinsically disordered, Q- and N-rich prion domain (PrD) characteristic of yeast prions (Fig.
S1A). We constructed a Mot3 variant lacking much of the predicted prion domain (Δ8-157), and
confirmed that exogenous expression of this variant did, indeed, restore [MOT3+] cells to the
original, ura-, phenotype (Fig. 1C).
Next, we analyzed the ability of Mot3 variants to form prions when expressed from their
endogenous chromosomal context. To examine spontaneous versus induced prion formation, we
transiently over-expressed either EYFP alone, or Mot3PrD-EYFP, in diploids homozygous for
individual Mot3 variants. WT Mot3 formed a low frequency of Ura+ colonies spontaneously; these
were greatly increased by transient PrD over-expression (Fig. S1B). A variant lacking only the poly-
asparagine tract (Δ143-157), which is expected to make strong contributions to prion formation
due to the highly prionogenic nature of asparagines (Halfmann et al., submitted), was not observed
to form prions spontaneously (Fig. S1B, 1D). This variant was still capable of prion-like aggregation,
albeit at a reduced efficiency, when induced by the over-expression of WT Mot3PrD (Fig. S1B). Δ8139
157 was entirely unable to form prions, even upon over-expression of Mot3 PrD. However, this
variant was not used in subsequent experiments due to a weak Ura+ background phenotype
indicating that it conferred a partial loss of function to Mot3 (Fig. S1B).
Environmental stresses can dramatically increase the rates of prion switching (Tyedmers et
al., 2008). Indeed, this is also true for Mot3. The frequency of de novo conversion to [MOT3+] was
strongly increased by the presence of a remarkably common stressor in yeast’s natural
environment, ethanol (Fig. 1D). Preliminary experiments indicate that Mot3’s response to ethanol
may by specifically tailored to this stress, as other, comparably toxic stresses like 1.5 M NaCl had a
much weaker inducing effect (not shown).
Most prion proteins can acquire not just one, but multiple, conformations capable of
sustained self-propagation. These conformations vary in the extent to which they deplete the
soluble pool of prion proteins, resulting in slightly different phenotypes.
We observed that
[MOT3+], too, conferred a variety of stable phenotypic variations, as evidenced by the diversity of
colony sizes arising on prion-selective media. We used an electrophoretic technique for the
resolution of amyloid polymers, SDD-AGE (Halfmann and Lindquist, 2008), to compare Mot3 prion
polymers between independent [MOT3+] isolates. Indeed, we observed a range of sizes for SDS-
resistant aggregates of Mot3 (Fig. 1E), as expected for prion conformational variants (Kryndushkin
et al., 2003).
[MOT3+] is a phenotypic capacitor of rapidly evolving traits
[MOT3+] conferred a wide array of natural phenotypes to cells that carried it. [MOT3+]
haploid cells of the MAT a mating type had a prominent morphological abnormality: they exhibited
polarized growth reminiscent of schmoos (Fig. 2A), growth projections typically observed only in
the presence of mating factors produced by cells of the opposite mating type. We confirmed that
this phenotype resulted from a loss of Mot3 activity, as the same phenotype was observed in ∆mot3
cells (not shown). When mixed with MAT α cells, [MOT3+] MAT a cells mated with a higher
efficiency than their corresponding prion-deficient counterparts (Fig. 2B), demonstrating that,
indeed, the schmoo-like morphologies result from a hyper-active mating behavior. This phenotype
was observed in S288C and W303 backgrounds, and only in the MAT a mating type. Interestingly,
the alterations to mating behavior were not observed in MATa [MOT3+] cells of the
∑1278b
background (not shown). Thus, [MOT3+] acts on one or more cryptic genetic polymorphisms to
confer novel phenotypic differences between two very closely related strains (Dowell et al., 2010).
140
Sexual reproductive traits evolve extremely rapidly, and many genes that modify mating
behavior reside in subtelomeres and/or contain tandem repeats (Fabre et al., 2005; Vinces et al.,
2009). Reasoning that the variation observed for this [MOT3+]-dependent trait may be a direct
consequence of hypervariable repeat regions, we identified all repeat-length polymorphisms in
Mot3-regulated ORFs that differed between the published genomes for these two strains (Dowell et
al., 2010). Indeed, one such polymorphism occurred within PRM7, a gene regulated by mating
pheromone (Heiman and Walter, 2000). The two alleles of PRM7 had a sizeable difference in repeat
number (from 47 in S288C to 37∑1278b).
in
They also had different translation start sites,
resulting in a large N-terminal truncation of the ∑1278b gene product. These differences would be
expected to cause a strong reduction in the relative functionality of this gene in ∑1278b, consistent
with the absence of a [MOT3+]-dependent mating phenotype in this background. Experiments are
underway to test this hypothesis. We also note that additional Mot3-regulated genes involved with
mating, though largely identical between the two strains, could be differentially influenced by
[MOT3+] as a result of synthetic interactions with other regulators.
To determine if other traits that are influenced by hypervariable subtelomeric and repeat-
containing genes are similarly influenced by Mot3 prion formation, we constructed isogenic
[MOT3+] and [mot3-] derivatives of a diploid S288C/∑1278b strain. This hybrid is competent for
the expression of multiple cell-surface adhesins encoded by subtelomeric and highly repetitive
genes. It has a hyperfunctional FLO1 allele (from S288C) and an important positive regulator of
FLO11 expression, FLO8 (from ∑1278b).
[MOT3+] dramatically enhanced the tendency of these cells to adhere both to themselves
and to other surfaces. In liquid media, [MOT3+] cells exhibited strong Flo1-type flocculation (Fig.
2C, S1C-E). On solid media, [MOT3+] cells readily adhered to, and penetrated, the agar surface (Fig.
2D). These phenotypes require FLO11-dependent formation of multicellular filaments (Dranginis et
al., 2007). A related but much less pronounced phenotype was also observed in W303 [MOT3+]
cells (Fig. 2E).
To what extent does prion formation influence the phenotypic manifestation of standing
genetic variation in S. cerevisiae? To examine the consequences of Mot3 prion formation in diverse
yeast isolates, we integrated a nourseothricin (NAT)-resistance reporter for Mot3 activity into a
diverse panel of sequenced strains (Liti et al., 2009) and then selected for stable [MOT3+]
derivatives. Because of technical challenges associated with isolating spontaneous [MOT3+]
derivatives (resistance to NAT at high cell densities), we induced the prion by transiently overexpressing Mot3 PrD, followed by selection for NAT-resistance at low cell-densities. Resistant
141
colonies were readily induced in this manner for 29 of 36 strains. Prion states were confirmed by
reversion of NAT-resistance upon GdHCl-induced inactivation of the prion propagating factor,
Hsp104.
These isolates exhibited highly variable [MOT3+]-dependent phenotypes. [MOT3+] induced
only mild flocculation in some strains (not shown), while most were non-flocculent. We suspect the
absence of strong flocculation phenotypes is due to these strains having relatively short, albeit
highly polymorphic, alleles of FLO1 (Fig. S1F). In some strains, [MOT3+] induced strong phenotypes
consistent with FLO11 derepression, including adhesive growth (Fig. 3A) and filamentation (Fig.
3B). These phenotypes were either absent or much less pronounced in most strains. However,
among strains that did show [MOT3+]-induced adhesion, the intensity of the phenotype
approximated the lengths of the FLO11 repeat region (Fig. S1F). The adhesive strength of yeast
flocculins scales with repeat number (Verstrepen et al., 2005).
The putative evolvability properties of prions requires their ability to switch reversibly
between the two states (Masel and Trotter, 2010). Not only could diverse strains acquire [MOT3+],
but they were also observed to switch spontaneously back to the original ([mot3-]) state (Fig. 3C).
The high frequency of reversion, coupled with the remarkable phenotypic strength of the prion in
cells that contained it, resulted in two phenotypically distinct subpopulations in cell cultures
deriving from single [MOT3+] colonies (Fig. 3C).
A frequently used argument against the biological relevance of yeast prions is that most
prion states have not been observed to occur naturally in wild yeast isolates (Nakayashiki et al.,
2005). To determine if [MOT3+] occurs naturally in yeast, we utilized a second diverse collection of
yeast, which, unlike the collection of monosporic derivatives used above, were composed primarily
of original, non-laboratory isolates (Jarosz and Lindquist, in press). We analyzed these strains by
SDD-AGE to identify pre-existing prion states of Mot3. Indeed, multiple isolates contained SDS-
resistant aggregates of Mot3 (Fig. 4A) that could be eliminated by Hsp104 inactivation (Fig. 4B).
Finally, preliminary observations confirm the existence of at least one naturally occurring [MOT3+]dependent phenotype in a rapidly evolving trait – colony morphology (Fig. 4C).
DISCUSSION
Based on these findings, we propose a model for phenotypic capacitance by prion-forming
transcriptional repressors like Mot3 (Fig. 5). Genetic features of prion-regulated genes, such as
intragenic tandem repeats or a highly recombinogenic chromosomal context, promote the rapid
142
generation of new alleles corresponding to gene duplications, gene deletions, and repeat
expansions and contractions. Under most conditions, transcriptional repression by fully functional
Mot3 precludes the phenotypic manifestation and consequent elimination of these variants through
negative selective pressures. Eventually, the spontaneous or stress-induced switching of Mot3 to its
prion state derepresses its target genes, revealing accumulated mutations in a sudden stepwise
fashion. Because several variants could be exposed in this manner simultaneously, the prion switch
allows for the appearance of complex new traits involving synthetic interactions between new
alleles. Such traits would be exceedingly unlikely to arise without such a capacitance mechanism
(Masel and Siegal, 2009). Note that this model is also applicable to transcriptional activators that
form prions. In such cases, however, the roles of the non-prion and prion state are reversed.
Mutations would be buffered in the inactive, prion state of the activator, and revealed when the
prion state is lost.
In addition to Mot3, three other transcriptional regulators have been confirmed to form
prions in yeast: the global transcription factors Sfp1 and Cyc8, and the chromatin remodeling
factor Swi1 (Du et al., 2008; Patel et al., 2009a; Rogoza et al., 2010). Sfp1 is a modulator of cell
growth that regulates approximately 10% of the genome (Rogoza et al., 2010). Consistent with an
adaptive role of prion formation, the Sfp1 prion state, [ISP+], confers a growth advantage on rich
media (Rogoza et al., 2010). In striking similarity to Mot3, Cyc8 and Swi1 are highly involved with
the regulation of mating and other rapidly evolving social behaviors, including cell-adhesion and
carbohydrate utilization (Du et al., 2008; Patel et al., 2009a). Like [MOT3+], the prion formed by
Cyc8, [OCT+], induces Flo1-dependent flocculation (Patel et al., 2009a). It also derepresses the
production of invertase (Patel et al., 2009a), a secreted enzyme whose various polymorphisms are
thought to be maintained in yeast populations through the stable coexistence of cheaters (cells that
do not express invertase) and cooperators (cells that express invertase to the benefit of all; Gore et
al., 2009). We suspect that prions will emerge as important models for the evolution of cooperation
by unicellular organisms.
What about prions that are not transcription factors? Might the many prion-like RNA-
processing proteins similarly modulate the expression of genes in rapidly evolving genomic
regions? We believe the answer is yes. As a case in point, we consider the best known yeast prion,
the translation termination factor Sup35. Prion formation by Sup35 increases ribosomal
frameshifting and stop codon read through (Liebman and Sherman, 1979; True et al., 2004; Wilson
et al., 2005; Namy et al., 2008a). Yeast telomeres have a greatly increased density of disabled ORFs
resulting from frameshifts or premature stop codons (Harrison et al., 2002). Changes in
143
translational fidelity brought about by Sup35’s prion state may activate these ORFs, allowing cells
to utilize an otherwise untapped reservoir of genetic variation.
The increasing pace of yeast prion discovery has made it clear that prions are not the
isolated anomalies they were once thought to be. On the contrary, their prevalence suggests that
they have adaptive biological functions. Our findings indicate that, by facilitating the appearance of
new phenotypes, one such function for prions may very well be the acceleration of adaptation itself.
MATERIALS AND METHODS
Computational methods
The algorithm used to detect putative prion-forming proteins was described previously (Alberti et
al., 2009).
Molecular cloning and yeast techniques
Standard cloning procedures, genetic manipulations, microscopy, and yeast growth conditions were
as described (Alberti et al., 2009). Gateway® entry clones and expression clones were generated as
described (Alberti et al., 2009), using oligos listed in Table 1. Stopless entry clones encoding MOT3
and MOT3PrD (as defined in Alberti et al., 2009) variants were recombined into pAG415-SUP35-
ccdb (Alberti et al., 2009), pAG424-GAL-ccdb-EYFP (Alberti et al., 2009), and pAG42HPH-GPD-ccdb-
EGFP (gift of Mikko Taipale). Allelic replacements of MOT3 were performed as described (Storici
and Resnick, 2006). A plasmid was created to introduce a genetic reporter for [MOT3+] into non-
laboratory yeast strains, as follows. The DAN1 promoter was amplified with BamH1_Dan1PROL and
Nco1_Dan1PROR. This PCR product was inserted into pAG25 (Goldstein and McCusker, 1999) via
BamH1 and Nco1. The Not1 fragment was released from the resulting plasmid and inserted into the
Spe1 site of pUG6 (Guldener et al., 1996). The resulting plasmid, pUG6DAN1_proNAT, was
linearized with BsrG1 (which cuts in the DAN1 promoter) before transformation. Transformants
were selected on YPD containing 200 μg/ml G418. Strains carrying this reporter were then
transformed with pAG42HPH-GPD-MOT3PrD-EGFP and selected on YPD containing 250 μg/ml
hygromycin B. [MOT3+] was isolated in these transformants by selection on YPD containing 20
μg/ml nourseothricin. Yeast colony PCRs were used to verify correct integrations and to examine
FLO1
and
FLO11
polymorphisms.
They
were
performed
(http://labs.fhcrc.org/hahn/Methods/mol_bio_meth/pcr_yeast_colony.html).
as
described
Filamentation
and
colony morphology were assayed as described (Gimeno et al., 1992; Reynolds and Fink, 2001). Agar
144
adhesion and invasion were assayed as described (Lo and Dranginis, 1998). Flocculation assays
were performed as described (Stratford and Assinder, 1991).
Table 1. Oligos used in this study.
Name
RTHmot3-7up
RTHmot3-157up
RTHmot3-143down
mot3pdPI
mot3pdPIIS
mot3-A
mot3-B
mot3-C
mot3-D
mot3pdseq5
mot3pdseq3
BamH1_Dan1PROL
Nco1_Dan1PROR
T7rev
dan1proNat_confR2
flo1rpt-upseq
flo1rpt-downseq
flo11rpt-upseq
flo11rpt-downseq
RTHmot3-7up
SDD-AGE
Sequence
[Phos]CAGGTGATGGTCCGCATTCAT
[Phos]GCTAGTACTGTTGTTTGCGACAGTGTAATCAG
[Phos]ATTCACCCAAACCAGTTTACTGCGGC
GACAGTGTAATCAGAAGCAGAAATATTGCTGTTGTTGCTGTT
GTTGCTG TTCGTACGCTGCAGGTCGAC
GGCTGGTAACAATATGTCTGCGTCGCCGATTGTCCATAACAA
TAGGGATAACAGGGTAATCCGCGCGTTGGCCGATTCAT
CTCCGTCTGGATTTACTAAACTTTG
AGTAATGGCTTATGTATGAAGCAGG
TAAGCAGGCAGAAGAGAAAAGATAA
TGAATTCATCAAGAGATTTGAAACA
CAATTCCTCAAGAAGGAACAGG
CTTCTGCCTGCTTAAGCACC
GATACA GGATCC TTTTGTCTCACACCCTTACAAAG
GATACACCATGGCTTGGGGTATATATTTAGTATGCTACAC
AATACGACTCACTATAGGGAGACCG
AGTACCCAGGGACCCTTTTG
GTGATGACTTCGAAGGGTACG
AGAAATCACAGAAGTTCCATTGC
CAACCCAACTGATTTCACAGC
TTGACTGCCAGGGTATTTGG
[Phos]CAGGTGATGGTCCGCATTCAT
Purpose
PCR-mediated deletions in MOT3 entry clone
PCR-mediated deletions in MOT3 entry clone
PCR-mediated deletions in MOT3 entry clone
amplification of counter-selectable cassette
targeted to MOT3
amplification of counter-selectable cassette
targeted to MOT3
confirming integrations at MOT3
confirming integrations at MOT3
confirming integrations at MOT3
confirming integrations at MOT3
confirming integrations at MOT3
confirming integrations at MOT3
creation of pUG6DAN1pro_NAT
creation of pUG6DAN1pro_NAT
confirming integration of pUG6DAN1pro_NAT
confirming integration of pUG6DAN1pro_NAT
examining repeat length polymorphisms
examining repeat length polymorphisms
examining repeat length polymorphisms
examining repeat length polymorphisms
PCR-mediated deletions in MOT3 entry clone
SDD-AGE was performed essentially as described (Halfmann and Lindquist, 2008). Benzonase
nuclease (250 U/ml final concentration) was included in the lysis buffer to reduce viscosity.
REFERENCES
Alberti, S., Halfmann, R., King, O., Kapila, A., and Lindquist, S. (2009). A systematic survey identifies
prions and illuminates sequence features of prionogenic proteins. Cell 137, 146-158.
Brown, C.A., Murray, A.W., and Verstrepen, K.J. (2010). Rapid expansion and functional divergence
of subtelomeric gene families in yeasts. Curr Biol 20, 895-903.
Dowell, R.D., Ryan, O., Jansen, A., Cheung, D., Agarwala, S., Danford, T., Bernstein, D.A., Rolfe, P.A.,
Heisler, L.E., Chin, B., et al. (2010). Genotype to phenotype: a complex problem. Science 328, 469.
Dranginis, A.M., Rauceo, J.M., Coronado, J.E., and Lipke, P.N. (2007). A biochemical guide to yeast
adhesins: glycoproteins for social and antisocial occasions. Microbiol Mol Biol Rev 71, 282-294.
Du, Z., Park, K.W., Yu, H., Fan, Q., and Li, L. (2008). Newly identified prion linked to the chromatinremodeling factor Swi1 in Saccharomyces cerevisiae. Nat Genet 40, 460-465.
Fabre, E., Muller, H., Therizols, P., Lafontaine, I., Dujon, B., and Fairhead, C. (2005). Comparative
genomics in hemiascomycete yeasts: evolution of sex, silencing, and subtelomeres. Mol Biol Evol 22,
856-873.
Gimeno, C.J., Ljungdahl, P.O., Styles, C.A., and Fink, G.R. (1992). Unipolar cell divisions in the yeast S.
cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68, 1077-1090.
Goldstein, A.L., and McCusker, J.H. (1999). Three new dominant drug resistance cassettes for gene
disruption in Saccharomyces cerevisiae. Yeast 15, 1541-1553.
145
Gore, J., Youk, H., and van Oudenaarden, A. (2009). Snowdrift game dynamics and facultative
cheating in yeast. Nature 459, 253-256.
Guldener, U., Heck, S., Fielder, T., Beinhauer, J., and Hegemann, J.H. (1996). A new efficient gene
disruption cassette for repeated use in budding yeast. Nucleic Acids Res 24, 2519-2524.
Halfmann, R., Alberti, S., and Lindquist, S. (2010). Prions, protein homeostasis, and phenotypic
diversity. Trends Cell Biol 20, 125-133.
Halfmann, R., and Lindquist, S. (2008). Screening for amyloid aggregation by semi-denaturing
detergent-agarose gel electrophoresis. J Vis Exp.
Halfmann, R., and Lindquist, S. (2010). Epigenetics in the extreme: prions and the inheritance of
environmentally acquired traits. Science 330, 629-632.
Harrison, P., Kumar, A., Lan, N., Echols, N., Snyder, M., and Gerstein, M. (2002). A small reservoir of
disabled ORFs in the yeast genome and its implications for the dynamics of proteome evolution. J
Mol Biol 316, 409-419.
Heiman, M.G., and Walter, P. (2000). Prm1p, a pheromone-regulated multispanning membrane
protein, facilitates plasma membrane fusion during yeast mating. J Cell Biol 151, 719-730.
Kryndushkin, D.S., Alexandrov, I.M., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2003). Yeast [PSI+]
prion aggregates are formed by small Sup35 polymers fragmented by Hsp104. J Biol Chem 278,
49636-49643.
Lancaster, A.K., Bardill, J.P., True, H.L., and Masel, J. (2010). The spontaneous appearance rate of the
yeast prion [PSI+] and its implications for the evolution of the evolvability properties of the [PSI+]
system. Genetics 184, 393-400.
Liebman, S.W., and Sherman, F. (1979). Extrachromosomal psi+ determinant suppresses nonsense
mutations in yeast. J Bacteriol 139, 1068-1071.
Liti, G., Carter, D.M., Moses, A.M., Warringer, J., Parts, L., James, S.A., Davey, R.P., Roberts, I.N., Burt,
A., Koufopanou, V., et al. (2009). Population genomics of domestic and wild yeasts. Nature 458, 337341.
Llorente, B., Durrens, P., Malpertuy, A., Aigle, M., Artiguenave, F., Blandin, G., Bolotin-Fukuhara, M.,
Bon, E., Brottier, P., Casaregola, S., et al. (2000). Genomic exploration of the hemiascomycetous
yeasts: 20. Evolution of gene redundancy compared to Saccharomyces cerevisiae. FEBS Lett 487,
122-133.
Lo, W.S., and Dranginis, A.M. (1998). The cell surface flocculin Flo11 is required for pseudohyphae
formation and invasion by Saccharomyces cerevisiae. Mol Biol Cell 9, 161-171.
Masel, J. (2006). Cryptic genetic variation is enriched for potential adaptations. Genetics 172, 19851991.
Masel, J., and Siegal, M.L. (2009). Robustness: mechanisms and consequences. Trends Genet 25,
395-403.
Masel, J., and Trotter, M.V. (2010). Robustness and evolvability. Trends Genet 26, 406-414.
Nakayashiki, T., Kurtzman, C.P., Edskes, H.K., and Wickner, R.B. (2005). Yeast prions [URE3] and
[PSI+] are diseases. Proc Natl Acad Sci U S A 102, 10575-10580.
Namy, O., Galopier, A., Martini, C., Matsufuji, S., Fabret, C., and Rousset, J.P. (2008). Epigenetic
control of polyamines by the prion [PSI(+)]. Nat Cell Biol.
Nemecek, J., Nakayashiki, T., and Wickner, R.B. (2009). A prion of yeast metacaspase homolog
(Mca1p) detected by a genetic screen. Proc Natl Acad Sci U S A 106, 1892-1896.
Patel, B.K., Gavin-Smyth, J., and Liebman, S.W. (2009). The yeast global transcriptional co-repressor
protein Cyc8 can propagate as a prion. Nat Cell Biol.
Rando, O.J., and Verstrepen, K.J. (2007). Timescales of genetic and epigenetic inheritance. Cell 128,
655-668.
Reynolds, T.B., and Fink, G.R. (2001). Bakers' yeast, a model for fungal biofilm formation. Science
291, 878-881.
146
Rogoza, T., Goginashvili, A., Rodionova, S., Ivanov, M., Viktorovskaya, O., Rubel, A., Volkov, K., and
Mironova, L. (2010). Non-Mendelian determinant [ISP+] in yeast is a nuclear-residing prion form of
the global transcriptional regulator Sfp1. Proc Natl Acad Sci U S A 107, 10573-10577.
Rutherford, S.L., and Lindquist, S. (1998). Hsp90 as a capacitor for morphological evolution. Nature
396, 336-342.
Sniegowski, P.D., and Murphy, H.A. (2006). Evolvability. Curr Biol 16, R831-834.
Storici, F., and Resnick, M.A. (2006). The delitto perfetto approach to in vivo site-directed
mutagenesis and chromosome rearrangements with synthetic oligonucleotides in yeast. Methods
Enzymol 409, 329-345.
Stratford, M., and Assinder, S. (1991). Yeast flocculation: Flo1 and NewFlo phenotypes and receptor
structure. Yeast 7, 559-574.
Teixeira, M.C., Monteiro, P., Jain, P., Tenreiro, S., Fernandes, A.R., Mira, N.P., Alenquer, M., Freitas,
A.T., Oliveira, A.L., and Sa-Correia, I. (2006). The YEASTRACT database: a tool for the analysis of
transcription regulatory associations in Saccharomyces cerevisiae. Nucleic Acids Res 34, D446-451.
True, H.L., Berlin, I., and Lindquist, S.L. (2004). Epigenetic regulation of translation reveals hidden
genetic variation to produce complex traits. Nature 431, 184-187.
True, H.L., and Lindquist, S.L. (2000). A yeast prion provides a mechanism for genetic variation and
phenotypic diversity. Nature 407, 477-483.
Tyedmers, J., Madariaga, M.L., and Lindquist, S. (2008). Prion switching in response to
environmental stress. PLoS Biol 6, e294.
Verstrepen, K.J., and Fink, G.R. (2009). Genetic and epigenetic mechanisms underlying cell-surface
variability in protozoa and fungi. Annu Rev Genet 43, 1-24.
Verstrepen, K.J., Jansen, A., Lewitter, F., and Fink, G.R. (2005). Intragenic tandem repeats generate
functional variability. Nat Genet 37, 986-990.
Vinces, M.D., Legendre, M., Caldara, M., Hagihara, M., and Verstrepen, K.J. (2009). Unstable tandem
repeats in promoters confer transcriptional evolvability. Science 324, 1213-1216.
Wilson, M.A., Meaux, S., Parker, R., and van Hoof, A. (2005). Genetic interactions between [PSI+] and
nonstop mRNA decay affect phenotypic variation. Proc Natl Acad Sci U S A 102, 10244-10249.
147
Table 1. Recombinogenic genes are preferentially regulated by prion-like transcription
factors.
148
Figure 1. Prion characteristics of the transcriptional repressor Mot3. (A) A genetic reporter for
[MOT3+]. Mot3 represses transcription of DAN1 under normal growth conditions. When the DAN1 ORF is
replaced with URA3, laboratory yeast strains can become prototrophic for uracil by prion-driven inactivation
of Mot3. (B) Non-Mendelian inheritance of the [MOT3+] prion state. The Ura+ phenotype in [MOT3+] cells is
eliminated by passaging the cells on GdHCl-containing media, indicating restoration of the [mot3-] state.
Sporulation of diploid [MOT3+] cells results in 4:0 segregation of the Ura+ phenotype, consistent with a
cytoplasmically transmitted trait. (C) Mot3 loss of function resulting from prion formation can be
complemented only by exogenously expressed Mot3 lacking the prion domain
∆8 ( -157). A genetic loss of
function (∆mot3), on the other hand, can be complemented by either WT or mutant MOT3. (D) The
spontaneous switching of Mot3 to its prion state is increased by stress. [mot3-] cells in late log phase were
incubated for 6 hrs in media alone, or media containing 12% ethanol (EtOH), prior to plating to –ura media.
Deletion of a critical region of the Mot3 PrD
∆143
(
-157) eliminates both spontaneous and EtOH-induced
prion formation. (E) Prion formation by Mot3 results in a gradient of phenotypic variants, as evidenced by the
range of colony sizes when selected on SD-ura. The phenotypic variations correspond to different selfperpetuating conformations of Mot3, as revealed by size differences in SDS-resistant Mot3 polymers detected
by SDD-AGE. Mot3 was detected via its naturally occurring 6xHis epitope.
149
Figure 2. [MOT3+] modifies physical cell-cell interactions in lab strains. (A) Cellular morphology of
S288C haploid cells, showing the presence of aberrant [MOT3+]-dependent polarized growth in the MATa
mating type. (B) S288C MATa [mot3-] or [MOT3+] cells were mixed 1:1 with W303 MATα and agitated for
18hrs in rich media, followed by plating to diploid selective media (5-fold dilution) or to nonselective media
(625-fold dilution). Diploid cells formed at a higher frequency with the [MOT3+] MATa mating partner. (C-D)
[MOT3+] confers strong flocculent (C) and invasive (D) phenotypes in a diploid S288C/Σ1278b hybrid. (E)
[mot3-] (bottom) and [MOT3+] (top) W303a/α cells were spotted side-by side on rich media and allowed to
grow into large colonies. The colonies were then replica-plated to media lacking uracil to determine the prion
status of variant sectors. Non-invasive cells were rinsed off of the rich plate to reveal invasive colony
projections. Note the spontaneous appearance of a [mot3-], non-invasive sector (*).
150
Figure 3. [MOT3+] is a phenotypic capacitor. (A) Induced [MOT3+] isolates of divergent strains of S.
cerevisiae were analyzed for FLO11-dependent phenotypes. Cryptic genetic variation is phenotypically
revealed by [MOT3+], causing some strains to adhere to the agar surface when grown in the presence of a
poor nitrogen source (proline). The strength of adhesion correlates with the number of repeats in FLO11 (Fig.
S1F). (B) [MOT3+] caused a dimorphic switch that varied in intensity between some strains, as observed by
filamentation on SLAD media. Treatment with GdHCl restored the cells to [mot3-] and the nonfilamentous
growth form. (C) Spontaneous nonfilamentous isolates were readily observed in filamentous [MOT3+] strains
such as NCYC 3318. Cells representing each growth form were micromanipulated and replated onto SLAD
media. The nonfilamentous phenotype was stable, and confirmed to represent spontaneous [mot3-]
revertants (not shown).
151
Figure 4. [MOT3+] occurs naturally in wild yeast isolates. (A) A collection of non-laboratory yeast
isolates was analyzed for pre-existing Mot3 prion states by SDD-AGE. SDS-resistant aggregates of Mot3 were
observed in multiple strains. (B) These aggregates could be eliminated by GdHCl treatment (as shown for Y35), confirming their prion nature. (C) Elimination of [MOT3+] from strain Y-35 altered its colony morphology
when grown on semi-solid media.
152
Figure 5. A model for evolutionary capacitance by prion transcription factors. (A) Mot3 preferentially
regulates genes that are highly recombinogenic, due, for example, to intragenic tandem repeats (shown as
repeating blue boxes in the ORF). (B) Functional Mot3 represses the transcription of its target genes under
normal growth conditions, allowing repeat-length polymorphisms (ORF’ and ORF’’) to accumulate in a
phenotypically silent state. (C) When cells experience environmental stress, indicating that they are poorly
adapted to their environment, a fraction of cells switch to the [MOT3+] state. This inactivates Mot3, resulting
in the derepression of Mot3-regulated ORFs and the revelation of new and potentially advantageous
phenotypes.
153
Supplemental Figure 1. (A) Primary structure of Mot3, with N (green) and Q (red) residues highlighted.
Regions of the prion domain for which genetic deletions were created are underlined (∆8-157 and ∆143157). The naturally occurring 6xHis epitope is indicated in blue. (B) Prion formation by Mot3 variants in their
endogenous chromosomal context. Homozygous diploids bearing the indicated MOT3 alleles and Galinducible versions of either EYFP (left) or WT Mot3PrD-EYFP (right) were grown overnight in galactose and
then spotted as 10-fold serial dilutions to either complete (YPD) or -ura media. Cells were photographed after
1 day on complete media or after 8 or 4 days on -ura media following EYFP or Mot3PrD-EYFP expression,
respectively. (C) [mot3-] and [MOT3+] cells were grown overnight in complete media (+ura), vortexed, and
photographed after allowing to settle for one minute. The flocculent phenotype was further increased when
[MOT3+] cells were grown in prion-selective media (-ura). (D) [MOT3+] and ∆mot3 cells were resuspended in
either flocculation buffer alone (left) or buffer containing 1 M maltose (middle) or mannose (right). Flo1-type
flocculation is inhibited only by mannose, whereas NewFlo-type flocculation is inhibited by both mannose
and maltose (Stratford and Assinder, 1991). (E) [MOT3+] derepresses a URA3 cassette integrated within the
coding sequence of FLO1 (Verstrepen et al., 2005), as indicated by increased sensitivity to 5-FOA. 5-FOAresistant papilla appearing in the [MOT3+] strain were confirmed to be [mot3-] by SDD-AGE (not shown). (F)
Repeat-length polymorphisms in the Mot3-regulated ORFs FLO1 and FLO11, in diverse isolates of S. cerevisiae,
as revealed by the lengths of PCR products generated with primer pairs flanking the repeat regions.
154
Appendix B
Prion formation by the GLFG Nucleoporin, Nup100
This chapter is being prepared for submission: Wright, J.*, Halfmann, R.*, Alberti, S., Lindquist, S.,
and Rexach, M.
*equal contribution
155
ABSTRACT
Prions are self-templating protein aggregates that cause transmissible neuropathies in mammals
and epigenetic changes in fungi. Propagation of the known yeast prions is driven by disordered
glutamine/asparagine (Q/N)-rich domains and requires the protein disaggregase Hsp104. Recent
data suggests that aromatic residues in prion domains enhance interactions with Hsp104. Here we
demonstrate that four Q/N-rich proteins of the nuclear pore complex, Nup100, Nup116, Nup49, and
Nup57, can form amyloids with prion-like characteristics in yeast. For Nup100, we present
evidence for bona fide prion formation, establishing a previously undiscovered capability of these
proteins to populate this distinct structural state. Finally, we demonstrate that nup amyloids reduce
the toxic consequences of nup over-expression, adding to a growing body of evidence for a wide
range of proteins that amyloid formation provides a general mechanism for counteracting the
toxicity associated with protein misfolding.
INTRODUCTION
Prions are self-replicating protein particles that were originally associated with fatal
neurological disorders in mammals (Prusiner, 1998). They are normal host proteins that have
acquired an altered conformation capable of converting other protein molecules to the same
conformation. Multiple prions have also been identified in yeast, where they act as “protein-only”
elements of inheritance, producing a wide range of dominant and cytoplasmically-transmissible
phenotypes (Saupe et al., 2000; True and Lindquist, 2000; True et al., 2004). It has been argued that
yeast prions, like their mammalian counterpart, constitute fungal protein misfolding diseases
(Wickner et al., 2007a). But unlike the mammalian prion, yeast prions are not overtly detrimental
and can have strong beneficial effects. For example, the prion state of the most well understood
yeast prion protein, Sup35, results in changes to gene expression that produce a wide variety of
phenotypes, including salt-tolerance, resistance to antibiotics, and altered colony morphologies,
depending on the genetic background (True and Lindquist, 2000; Tyedmers et al., 2008). Because
prions spontaneously appear at a low frequency within yeast populations, we have postulated that
they provide a sophisticated bet-hedging strategy to generate phenotypic heterogeneity that is
advantageous in fluctuating microbial environments (True and Lindquist, 2000; True et al., 2004;
Griswold and Masel, 2009; Halfmann et al., 2010).
156
There are currently seven well-characterized prion proteins in yeast, and approximately
twenty other yeast proteins capable of prion behavior have recently been identified (Du et al., 2008;
Alberti et al., 2009; Nemecek et al., 2009; Patel et al., 2009a; Toombs et al., 2009). All of these prions
are highly ordered amyloid aggregates of their determinant proteins. Access to this conformation is
provided by the intrinsically disordered character of their Gln(Q)/Asn(N)-rich prion-forming
domain (PrD). The ability of these domains to switch to a self-templating amyloid conformation is
necessary and sufficient for prion behavior (Ter-Avanesyan et al., 1994; Masison and Wickner,
1995; Derkatch et al., 1996; Patino et al., 1996).
Prions in yeast have a near absolute dependence on the protein remodeling factor Hsp104
(Alberti et al., 2009). Exposure of yeast cells to low concentrations (3-5 mM) of guanidinium
chloride (GdnHCl), a chemical inhibitor of Hsp104’s activity (Ferreira et al., 2001; Jung and Masison,
2001; Grimminger et al., 2004), blocks prion replication and results in the complete elimination of
prions from dividing cells. One important activity for Hsp104 is to shear prion aggregates into
smaller pieces, thereby increasing the number of amyloid fiber ends that are the sites of templating
activity for prion conformational conversion (Paushkin et al., 1996; Kushnirov and Ter-Avanesyan,
1998; Kryndushkin et al., 2003). A second activity is to promote de novo prion formation by
catalyzing amyloid nucleation from purified soluble protein (Shorter and Lindquist, 2006).
Another protein promotes prion formation in a very different way. This prion-inducing
factor, Rnq1, is itself a Q/N rich prion. When it is in its prion conformation it promiscuously
interacts with other Q/N rich proteins, causing them to aggregate and occasionally convert to selfpropagating prion states themselves.
Multiple subunits of the nuclear pore complex (NPC) bear sequence characteristics of
prions. A subset of these, the GLFG nucleoporins (Nups), contain large domains with a repeating
GLFG motif interspersed with intrinsically disordered Q/N-rich linker regions (Wente et al., 1992;
Michelitsch and Weissman, 2000; Denning et al., 2003; Alberti et al., 2009) (Fig. 1A). The NPC is a
supramolecular pore structure that gates macromolecular exchange between the cytoplasm and
nucleus (Alber et al., 2007). Its size-selective protein diffusion barrier is established, in part, by the
intermolecular association of GLFG nups into a dense yet flexible meshwork (Patel et al., 2007; Frey
and Gorlich, 2009).
We previously observed that, when over-expressed, full length GLFG nups form cytoplasmic
foci that we believe to be structurally related to the protein meshwork at the NPC (Patel et al.,
2007). Unlike prion aggregates, these foci require neither [RNQ+] nor Hsp104 for formation and can
be rapidly dissipated by treating cells with the hydrophobic alcohol 1,6-hexanediol (Patel et al.,
157
2007; Patel, Wright, Rexach unpublished). Interestingly, the Q/N-rich GLFG domains responsible
for non-prion aggregation were also observed to form prion-like aggregates in a recent analysis
(Alberti et al., 2009), indicating a remarkably broad range of conformations accessible to these
proteins. Here, we investigate the prion properties of four GLFG Nups: Nup100, Nup116, Nup49,
and Nup57.
RESULTS
GLFG nucleoporins form prion-like aggregates. Sequence analysis identified the regions of
these proteins with the highest Q/N density, similar to that of known yeast prions (Fig. 1A, S1A). To
determine if these regions were capable of prion-like aggregation, we over-expressed them as
fluorescent fusions in yeast. Indeed, the over-expressed CFP-tagged proteins coalesced into bright
cytoplasmic foci. However, unlike previously described foci formed by full-length GLFG nups, these
foci did not form in isogenic cells that were deleted of Hsp104, and which were consequently [rnq-]
(Fig. 1B-D). To test specifically for dependence on [RNQ+], we eliminated this prion by transiently
disrupting Hsp104 activity with GdnHCl, and retested for nup aggregation when Hsp104 activity
was restored. nup foci did not form in these cells (Fig S2A), demonstrating their strong dependence
on the prion inducing factor [RNQ+].
To further define the regions of nups responsible for prion-like [RNQ+]-dependent
aggregation, we tested three contiguous fragments of the Nup100 GLFG domain for aggregation: the
most N-terminal region, Nup100N (AA 1-200); a middle region, Nup100M (AA 200-400); and a C-
terminal region, Nup100C (AA 400-640) (Fig. 1A, S1A). While Nup100C did not form foci, Nup100N
formed foci in 27% of cells, and Nup100M in 85% (Fig. 1B). Examination of the sequences of these
fragments revealed that Nup100M contained the highest Q/N content and also the most GLFG
motifs. We further found that an even smaller fragment of Nup100M, which is highly Q/N rich and
contains several GLFG motifs, designated Nup100Mf (AA 300-400), also showed a high level of
aggregation (Fig. 4C). As with the other nup regions, all of these aggregation events required
Hsp104.
To test for specificity of aggregation among GLFG nups, we formed aggregates of Nup100M
by over-expression, and asked if these could recruit other nups that were being expressed at their
normal levels. To do so, we tagged the nups with GFP at their chromosomal loci and examined their
localization by fluorescence microscopy. In the absence of over-expressed Nup100M, they were
exclusively distributed around the nuclear rim, typical for components of the NPC. Nup100M over158
expression resulted in their partial mislocalization to cytoplasmic foci (Fig. 2A). The extent of
mislocalization correlated with their sequence similarity to Nup100M. Over-expression of
Nup100M itself resulted in foci formation by Nup100-GFP in 30% of cells. Nup116, which is
homologous to Nup100 over its entire length, formed fluorescent foci in 13% of cells. The more
distantly related Nup49 formed foci in 6% of cells. In contrast, the localization of Nup2-GFP, which
does not have GLFG motifs or a Q/N-rich region, was unaffected by Nup100M over-expression (Fig.
2A).
As a further test for sequence specificity of nup aggregation, we performed a
complementary experiment in which a tagged form of Nup100M was over-expressed and the
aggregation of untagged endogenous nups was assessed by their insolubility in cell lysates. Lysates
were separated into soluble (supernatant) and insoluble (pellet) fractions by centrifugation,
followed by Western analysis with anti-nup polysera. Of the nups reactive to this antibody, only
those most similar to Nup100M (Nup100, Nup116 and Nup57) were found in the insoluble fraction
together with Nup100M-CFP. In contrast, the nups Nsp1 and nNup145 did not cosediment with
Nup100M-CFP. Nsp1 is a Q/N-rich nup that does not contain GLFG motifs, while nNup145 does
contain GLFG motifs but is not Q/N-rich. All nups remained soluble in [rnq-] cells, in which
Nup100M-CFP does not aggregate (Fig. 2B). Together, these results suggest that both the Q/N-
richness and GLFG motifs are likely to contribute to the sequence specificity of nup prion-like
aggregation.
Nup100 contains a prion-forming domain. Yeast prion amyloids are resistant to
solubilization by the strong anionic detergent SDS. We used semi-denaturing detergent-agarose gel
electrophoresis (SDD-AGE) (Salnikova et al., 2005; Halfmann and Lindquist, 2008) to detect SDS-
resistant species of Nup100 in cell lysates. Nup100 was chromosomally tagged with an HA epitope
and induced to aggregate by over-expression of Nup100Mf. Antibodies against the HA-tag revealed
that a portion of endogenous Nup100 had entered an SDS-resistant high molecular weight form
(Fig. 2C).
The definitive biochemical characteristic of yeast prion proteins is an intrinsic capacity to
form self-templating amyloids by nucleated conformational conversion (Serio et al., 2000; Alberti et
al., 2009). To examine the amyloid forming propensity of Nup100 in vitro, bacterially expressed
His-tagged Nup100Mf was purified under denaturing conditions followed by dilution into a
physiological buffer. Amyloid assembly was monitored by thioflavin-T (ThT), an amyloid-specific
dye that changes its fluorescence properties upon binding to amyloid (yet does not affect the
kinetics of amyloid formation). After approximately four hours of incubation under continuous
159
agitation, ThT fluorescence began to increase exponentially (Fig. 3A). Amyloid formation by other
prion proteins displays similar kinetics – a lag phase followed by rapid assembly.
Although de novo amyloid nucleation by yeast prions is slow, once formed the amyloid
rapidly templates the conformational conversion of soluble protein to the same state (Serio et al.,
2000). It is the combination of these properties that allows prions to exist in either a soluble non
prion state or a self-templating prion state in vivo. To determine whether Nup100Mf amyloids have
a self-templating capacity, we added a small quantity of pre-assembled Nup100Mf amyloid (5%
w/w) to a fresh assembly reaction. Indeed, the lag phase to amyloid formation was completely
eliminated (Fig. 3A). Like other prions assembled in vitro, Nup100Mf aggregates had a classic
fibrillar amyloid morphology when examined by transmission electron microscopy (Fig. 3B).
Next we asked if Nup100Mf’s amyloid-forming properties do, in fact, allow it to populate
distinct phenotypic states in vivo. To do so we created a chimeric prion reporter consisting of
Nup100Mf fused to the non-prion domain of Sup35, which performs its normal translation
termination function (Fig. 4A). Prion-driven aggregation of Sup35 causes a nonsense suppression
phenotype, readily detected by adenine prototrophy and white-colored colonies in cells carrying
the ade1-14 nonsense mutation. When the endogenous Sup35 gene was replaced with the
Nup100Mf-Sup35C chimera, it recapitulated the heritable phenotypic switch associated with the
WT Sup35 prion (Fig. 4B). Prion-free cells from red colonies spontaneously gave rise to prion-
containing, white colonies upon restreaking. Following standard prion nomenclature, we will refer
to the prion state of the Nup100Mf-Sup35C chimera as [100Mf+] and the soluble non-prion state as
[100mf-].
Like other amyloid-based yeast prions, [100Mf+] required the continuous activity of Hsp104
for its propagation. Hsp104 activity was transiently repressed by growing cells on GdnHCl followed
by restreaking on normal media. The resulting colonies were red in color (Fig. 4C). Note that these
colonies had a darker shade of red than they exhibited prior to GdnHCl-treatment. This is due to the
fact that Hsp104-inhibition also eliminates the prion inducing factor [RNQ+], resulting in a loss of
the low level of spontaneous prion induction that gave the original colonies a pink color.
[RNQ+] stimulates prion formation by Sup35 and other prion proteins, but is not necessary
for their subsequent propagation. Indeed, [100Mf+] had this same characteristic. When [RNQ+] was
eliminated by deletion of the RNQ1 gene, the white state was stably maintained (Fig. 4D).
Nup100 is toxic when over-expressed. GLFG nups can be toxic when over-expressed in
yeast cells (Patel et al., 2007). We have previously shown for other over-expressed Q/N-rich
proteins that an accumulation of non-amyloid conformers is extremely toxic, but that toxicity is
160
alleviated by the redirection of prion proteins into benign amyloid aggregates (Douglas et al., 2008,
and Halfmann et al., submitted). Although the highly amyloidogenic fragments of Nup100
characterized above were not toxic, full-length Nup100 or Nup100-EGFP severely inhibited yeast
growth when expressed from a galactose-inducible promoter (Fig. 5A and data not shown). Fulllength Nup100-EGFP also formed fluorescent foci in the cytoplasm (Fig. 5C). But again unlike
smaller fragments of Nup100, foci of full length Nup100 formed independently of [RNQ+],
consistent with their propensity to form large non-amyloid complexes as previously reported for
full-length nups (Patel et al., 2007).
Cells over-expressing Nup100-EGFP eventually gave rise to faster-growing microcolonies,
or papilla, with reduced toxicity (Fig. 5B). Such papilla were less prevalent in an isogenic [rnq-]
background, suggesting they may derive from the conversion of Nup100-EGFP from an amorphous
toxic species to a relatively benign amyloid form. Indeed, when [rnq-] and [RNQ+] cells overexpressing Nup100-EGFP were examined by SDD-AGE, a large fraction of Nup100-EGFP partitioned
to an SDS-resistant aggregate in [RNQ+] cells, while only a small amount did so in [rnq-] cells (Fig.
5D).
Endogenous Nup100 can enter a cytoprotective prion state. Resistant papilla were re-
passaged on galactose containing media followed by six restreakings on glucose media to repress
Nup100-EGFP expression. When replated to galactose, five of twelve isolates retained increased
viability, indicating that resistance to Nup100-toxicity can be stably maintained for hundreds of
generations in the absence of continued selection, and without continuous Nup100-EGFP over-
expression.
All known amyloid-based yeast prions are eliminated by temporary inactivation of Hsp104.
To test for Hsp104-dependence of resistance to Nup100-EGFP over-expression, we chose a
representative stable isolate and temporarily inactivated Hsp104 by passaging on GdnHCl-
containing media, followed by retesting for Nup100-toxicity. Indeed, GdnHCl treatment restored
susceptibility to over-expressed Nup100-EGFP (Fig. 6A). We conclude that resistance to Nup100EGFP is associated with a prion form of an endogenous protein.
To determine if the prion is, in fact, a GLFG nucleoporin, we subjected stable resistant
isolates to SDD-AGE analysis with anti-GLFG antisera. Indeed, the prion-containing cells had an
increased amount of SDS-resistant high-molecular weight aggregates of endogenous GLFG nups
(Fig. 6B). Treatment of these cells with GdnHCl eliminated these aggregates, demonstrating that
they represent a self-propagating, Hsp104-dependent state. These results strongly indicate that
Nup100 can form prions in S. cerevisiae.
161
In keeping with standard prion nomenclature, we will refer to this state as [NUP100+], and
the original susceptible state as [nup100-]. Additional experiments will be necessary to establish
whether this self-propagating amyloid state has all the genetic properties of yeast prions, such as
dominant, non-Mendelian inheritance. Further understanding of the biological consequences of
prion formation by Nup100, and potentially other GLFG nucleoporins, will also require the
identification of phenotypes that do not involve the over-expression of the prion-forming protein
itself.
DISCUSSION
Protein misfolding and aggregation have diverse cellular consequences. On the one hand,
the toxicity generally caused by protein aggregation has driven the evolution of numerous
mechanisms to avoid it. On the other hand, a growing number of examples demonstrate that cells
can also take advantage of protein aggregation. This is particularly true when the aggregates are
highly-ordered, self-templating amyloids.
We have shown that the Nup100 protein is capable of forming a self-perpetuating prion
state that detoxifies over-expressed Nup100 by converting it from a toxic amorphous species to a
nontoxic amyloid. This work joins a growing body of evidence that amyloid formation is often
cytoprotective, rather than toxic (Treusch et al., 2009).
In yeast, prion formation by information-processing proteins like transcription factors and
mRNA-binding proteins generates abundant phenotypic diversity that may be advantageous in
rapidly fluctuating microbial environments (True and Lindquist, 2000; Halfmann et al., 2010). Prion
formation by GLFG nups is likely to be no exception. These proteins are gate-keepers to
macromolecular transport between the cytoplasm and nucleus, giving them tremendous control
over both transcriptional and post-transcriptional gene expression (Strambio-De-Castillia et al.,
2010).
Our early attempts to detect nuclear pore-associated phenotypic changes in yeast
containing cytoplasmic GLFG nup aggregates were largely unsuccessful. The yeast showed no
significant growth or morphological defect, no defect in the NPC permeability barrier, no defect in
Crm1-mediated export, no defect in mRNA export, and only a slight increase in the rate of nuclear
import (data not shown). However, as confirmed prion states were not yet available for these
experiments, they relied on the sequestration of endogenous nups by over-expressed Q/N rich nup
162
fragments, and we reason that the extent of sequestration may have been insufficient to
compromise NPC function.
Intriguingly, yeast’s repertoire of GLFG nups is five-fold larger, and much more Q/N-rich
than that of humans (which only have one GLFG nup), despite a much larger and more complex NPC
in the latter. The cellular machinery necessary for the efficient propagation of most yeast prions,
such as Hsp104, is not conserved in humans. We speculate that the expansion of the GLFG nup
family, with its concomitant increase in predicted prion propensity, may reflect an increased
capacity of yeast to utilize self-templating amyloids, both for inheritance, and possibly, structural
functions.
It was recently demonstrated that a different prion-like FG nup, Nsp1, forms amyloid-like
interactions within a self-assembling gel-like matrix, which was proposed to mimic the functional
state of FG nups at the NPC (Ader et al., 2010). Presumably, the kinetic stability imparted by
amyloid-like cross-links would increase the sieve’s resilience to the constant flux of transiting
cargo. We now know that a subset of FG nups is indeed capable of sustained intracellular amyloid
formation. The consequences of this property for NPC function, and that of protein-based
inheritance, remain to be seen.
MATERIALS AND METHODS
Strains and plasmids
BY4741 was used throughout the paper; derivatives of YRS100 was used for nonsense suppression
assays as in (Alberti et al., 2009); and YJW584 (Osherovich et al., 2004) was used for toxicity
analyses. Strains generated in this work are listed in Table 1. All yeast strains initially contained the
prion element [RNQ+]. Elimination of prions by GdnHCl was as described (Chernoff et al., 2002).
Chromosomal integrations of GFP and 3xHA, and deletions of HSP104 and RNQ1 were
accomplished by homologous recombination using PCR-based strategies (Baudin et al., 1993; Wach
and Philippsen, 1997; Longtine et al., 1998; Goldstein and McCusker, 1999). Experiments in Fig. 1B-
D and 2A-B utilized Nup constructs cloned as CFP-fusions into pVT102-U, which allows constitutive
expression from an ADH1-promoter (Vernet et al., 1987; Patel et al., 2007). Other experiments
utilized Gateway® plasmids. Stopless entry clones for NUP100 and NUP100Mf were generated by
PCR and recombination of the PCR products into pDONR221 (Invitrogen, CA) as described (Alberti
et al., 2009). Oligos for amplification of NUP100 and NUP100Mf were:
163
Attb1NUP100
GGGGACAAGTTTGTACAAAAAAGCAGGCTACATGTTTGGCAACAATAGACCAATGT
Attb2NUP100
GGGGACCACTTTGTACAAGAAAGCTGGGTCAGTTAAAACTGGGTGATCTATGGTG
NUP100Mf_GW5
AGGAGATAACAAAATGGTATTTGGACAAAACAATAATCAAATG
NUP100_GW3
CAAGAAAGCTGGGTCACATGCTGGTTTGGCTCC.
The PCR product from the latter two oligos was re-amplified in a second PCR using oligos “GWuniv-sense” and “GW-univ-antisense”, as described (Alberti et al., 2009). Sequence-verified entry
clones were then recombined into pAG415ADH-ccdB-SUP35C (Alberti et al., 2009) for heritable
nonsense suppression assays, pAG424Gal-ccdB-EYFP (Alberti et al., 2007) for prion induction
assays, pAG426Gal-ccdB-EGFP (Alberti et al., 2007) for microscopy and toxicity assays, and pRH1
(Alberti et al., 2009) for bacterial protein expression.
Table 1. Yeast strains.
Name Genotype
YSA329
YSA330
YRH814
YRH821
YRH984
Mata, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100;
[RNQ+]; sup35::HygB; pAG415ADH1-NUP100Mf-SUP35C
Mata, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100;
[RNQ+]; sup35::HygB; pAG415ADH1-NUP100Mf-SUP35C; [100Mf+]
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-];
[RNQ+]; pAG426Gal-NUP100-EGFP
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-];
[RNQ+]; pAG426Gal-NUP100-EGFP; [NUP100+]
MATa, leu2-3,112; his3-11,-15; trp1-1; ura3-1; ade1-14; can1-100; [psi-];
[RNQ+]; [NUP100+]
Construction
plasmid shuffle using YRS100
(Alberti et al., 2009)
YSA329, Ade+
transformation of YJW584
(Osherovich et al., 2004)
YRH814, selection on SGal-ura
YRH821, selected on 5-FOA
Yeast procedures
Standard media and growth conditions were used throughout (Alberti et al., 2009). For prion
induction, cells were grown overnight in galactose- prior to plating on glucose- containing media.
For toxicity, cells were grown overnight in glucose- prior to plating on either galactose- or glucosecontaining media. Plates were incubated at 30°C.
Microscopy
Yeast expressing fluorescent proteins were imaged live under a Nikon Eclipse 80i fluorescence
microscope, with a Nikon Plan Apo 100X / 1.4 aperture objective. Photos were taken using a
Hamamatsu Orca ER camera and Phylum Improvision software. For transmission electron
164
microscopy, aggregates were negatively stained with uranyl acetate and imaged with a Phillips
EM410 electron microscope.
Recombinant protein purification and amyloid assembly
Nup100Mf was expressed as a Trp-7xHis fusion in pRH1 and purified as described (Alberti et al.,
2009). Methanol-precipitated proteins were resuspended in 10-50 µl of resuspension buffer (7M
GdnHCl; 100 mM K2HPO4, pH 5.0; 300 mM NaCl, 5 mM EDTA, 5 mM TCEP). Protein concentrations
were determined by measuring absorption at 280 nm using calculated extinction coefficients.
Protein stocks were heated for 5 min at 95°C before being diluted to 20 µM in assembly buffer (5
mM K2HPO4, pH 6.6; 150 mM NaCl; 5 mM EDTA; 2 mM TCEP) plus 0.5 mM ThT. Seeded ThT
reactions included 5% (w/w) sonicated (10 seconds with probe at setting 1 on a Branson Sonifier
250 sonicator) fibers of WT Nup100Mf. Assembly reactions were performed in black nonbinding
microplates (Corning, NY) with 100 µl per well, with medium orbital shaking at 30°C on a Sapphire
II plate reader (Tecan, NC). Fluorescence measurements were taken at 450 nm excitation, 482 nm
emission.
SDD-AGE
Detection of low abundance endogenously tagged Nup100 by SDD-AGE was aided by the use of a
modified lysis buffer consisting of 100 mM Tris-HCl pH8, 20 mM NaCl, 2 mM MgCl2, 50 mM βmercapto-ethanol, 1% Triton X-100, 2% Halt protease inhibitor cocktail (Thermo Scientific), 30 mM
N-ethyl-maleimide, and 100 U/ml Benzonase (Novagen). For Fig. 2C and 5D, cultures were grown
over-night in glucose containing media, and then washed and resuspended in galactose containing
media for 24 hrs for over-expression of Nup100Mf-EYFP or Nup100-EGFP, respectively, prior to
lysis. For Fig. 6B, individual colonies were grown overnight in 25 ml YPD prior to lysis. Samples
were lysed and processed as described (Alberti et al., 2009). Briefly, washed cell pellets were lysed
by glass-bead disruption followed by removal of cell-debris by centrifugation at 2000 rcf for 2 min.
Supernatants were combined with sample buffer to achieve a concentration of 2% SDS and
incubated for 5 min at room temperature prior to loading on 1.5% agarose gels containing 0.1%
SDS.
165
REFERENCES
Abramova, N., Sertil, O., Mehta, S., and Lowry, C.V. (2001). Reciprocal regulation of anaerobic and
aerobic cell wall mannoprotein gene expression in Saccharomyces cerevisiae. Journal of
bacteriology 183, 2881-2887.
Ader, C., Frey, S., Maas, W., Schmidt, H.B., Gorlich, D., and Baldus, M. (2010). Amyloid-like
interactions within nucleoporin FG hydrogels. Proc Natl Acad Sci U S A 107, 6281-6285.
Aguzzi, A., Baumann, F., and Bremer, J. (2008). The prion's elusive reason for being. Annual review
of neuroscience 31, 439-477.
Aguzzi, A., and Calella, A.M. (2009). Prions: protein aggregation and infectious diseases. Physiol Rev
89, 1105-1152.
Aigle, M., and Lacroute, F. (1975). Genetical aspects of [URE3], a non-mitochondrial, cytoplasmically
inherited mutation in yeast. Mol Gen Genet 136, 327-335.
Alber, F., Dokudovskaya, S., Veenhoff, L.M., Zhang, W., Kipper, J., Devos, D., Suprapto, A., KarniSchmidt, O., Williams, R., Chait, B.T., et al. (2007). The molecular architecture of the nuclear pore
complex. Nature 450, 695-701.
Alberti, S., Gitler, A.D., and Lindquist, S. (2007). A suite of Gateway cloning vectors for highthroughput genetic analysis in Saccharomyces cerevisiae. Yeast 24, 913-919.
Alberti, S., Halfmann, R., King, O., Kapila, A., and Lindquist, S. (2009). A systematic survey identifies
prions and illuminates sequence features of prionogenic proteins. Cell 137, 146-158.
Alexandrov, I.M., Vishnevskaya, A.B., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2008). Appearance
and propagation of polyglutamine-based amyloids in yeast: tyrosine residues enable polymer
fragmentation. J Biol Chem 283, 15185-15192.
Avery, S.V. (2006). Microbial cell individuality and the underlying sources of heterogeneity. Nature
reviews 4, 577-587.
Bacolla, A., Larson, J.E., Collins, J.R., Li, J., Milosavljevic, A., Stenson, P.D., Cooper, D.N., and Wells, R.D.
(2008). Abundance and length of simple repeats in vertebrate genomes are determined by their
structural properties. Genome Res 18, 1545-1553.
Bagriantsev, S.N., Kushnirov, V.V., and Liebman, S.W. (2006). Analysis of amyloid aggregates using
agarose gel electrophoresis. Methods Enzymol 412, 33-48.
Balch, W.E., Morimoto, R.I., Dillin, A., and Kelly, J.W. (2008). Adapting proteostasis for disease
intervention. Science 319, 916-919.
Baskakov, I.V., and Breydo, L. (2007). Converting the prion protein: what makes the protein
infectious. Biochim Biophys Acta 1772, 692-703.
Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F., and Cullin, C. (1993). A simple and
efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21, 33293330.
Bossdorf, O., Richards, C.L., and Pigliucci, M. (2008). Epigenetics for ecologists. Ecol Lett 11, 106115.
Boye-Harnasch, M., and Cullin, C. (2006). A novel in vitro filter trap assay identifies tannic acid as an
amyloid aggregation inducer for HET-s. J Biotechnol 125, 222-230.
Brachmann, A., Baxa, U., and Wickner, R.B. (2005). Prion generation in vitro: amyloid of Ure2p is
infectious. Embo J 24, 3082-3092.
Brachmann, A., Toombs, J.A., and Ross, E.D. (2006). Reporter assay systems for [URE3] detection
and analysis. Methods (San Diego, Calif 39, 35-42.
Bradley, M.E., Edskes, H.K., Hong, J.Y., Wickner, R.B., and Liebman, S.W. (2002). Interactions among
prions and prion "strains" in yeast. Proc Natl Acad Sci U S A 99 Suppl 4, 16392-16399.
Brown, C.A., Murray, A.W., and Verstrepen, K.J. (2010). Rapid expansion and functional divergence
of subtelomeric gene families in yeasts. Curr Biol 20, 895-903.
166
Brown, J.C., and Lindquist, S. (2009). A heritable switch in carbon source utilization driven by an
unusual yeast prion. Genes Dev 23, 2320-2332.
Buchan, J.R., Muhlrad, D., and Parker, R. (2008). P bodies promote stress granule assembly in
Saccharomyces cerevisiae. J Cell Biol 183, 441-455.
Chen, S., Ferrone, F.A., and Wetzel, R. (2002). Huntington's disease age-of-onset linked to
polyglutamine aggregation nucleation. Proc Natl Acad Sci U S A 99, 11884-11889.
Chernoff, Y.O. (2007). Stress and prions: lessons from the yeast model. FEBS Lett 581, 3695-3701.
Chernoff, Y.O., Galkin, A.P., Lewitin, E., Chernova, T.A., Newnam, G.P., and Belenkiy, S.M. (2000).
Evolutionary conservation of prion-forming abilities of the yeast Sup35 protein. Mol Microbiol 35,
865-876.
Chernoff, Y.O., Lindquist, S.L., Ono, B., Inge-Vechtomov, S.G., and Liebman, S.W. (1995). Role of the
chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+]. Science 268, 880884.
Chernoff, Y.O., Uptain, S.M., and Lindquist, S. (2002). Analysis of Prion Factors in Yeast. Methods in
Enzymology 351, 499-538.
Chiti, F., and Dobson, C.M. (2006). Protein misfolding, functional amyloid, and human disease. Annu
Rev Biochem 75, 333-366.
Cox, B., Ness, F., and Tuite, M. (2003). Analysis of the generation and segregation of propagons:
entities that propagate the [PSI+] prion in yeast. Genetics 165, 23-33.
Cox, B.S., Tuite, M.F., and Mundy, C.J. (1980). Reversion from suppression to nonsuppression in
SUQ5 [psi+] strains of yeast: the classificaion of mutations. Genetics 95, 589-609.
Decker, C.J., Teixeira, D., and Parker, R. (2007). Edc3p and a glutamine/asparagine-rich domain of
Lsm4p function in processing body assembly in Saccharomyces cerevisiae. J Cell Biol 179, 437-449.
Denning, D.P., Patel, S.S., Uversky, V., Fink, A.L., and Rexach, M. (2003). Disorder in the nuclear pore
complex: The FG repeat regions of nucleoporins are natively unfolded. Proc Natl Acad Sci U S A.
Derkatch, I.L., Bradley, M.E., Hong, J.Y., and Liebman, S.W. (2001). Prions affect the appearance of
other prions: the story of [PIN(+)]. Cell 106, 171-182.
Derkatch, I.L., Bradley, M.E., Masse, S.V., Zadorsky, S.P., Polozkov, G.V., Inge-Vechtomov, S.G., and
Liebman, S.W. (2000). Dependence and independence of [PSI(+)] and [PIN(+)]: a two-prion system
in yeast? Embo J 19, 1942-1952.
Derkatch, I.L., Chernoff, Y.O., Kushnirov, V.V., Inge-Vechtomov, S.G., and Liebman, S.W. (1996).
Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae. Genetics 144, 1375-1386.
Diaz-Avalos, R., King, C.Y., Wall, J., Simon, M., and Caspar, D.L. (2005). Strain-specific morphologies
of yeast prion amyloid fibrils. Proc Natl Acad Sci U S A 102, 10165-10170.
Dong, J., Bloom, J.D., Goncharov, V., Chattopadhyay, M., Millhauser, G.L., Lynn, D.G., Scheibel, T., and
Lindquist, S. (2007). Probing the role of PrP repeats in conformational conversion and amyloid
assembly of chimeric yeast prions. J Biol Chem 282, 34204-34212.
Douglas, P.M., Treusch, S., Ren, H.Y., Halfmann, R., Duennwald, M.L., Lindquist, S., and Cyr, D.M.
(2008). Chaperone-dependent amyloid assembly protects cells from prion toxicity. Proc Natl Acad
Sci U S A 105, 7206-7211.
Dowell, R.D., Ryan, O., Jansen, A., Cheung, D., Agarwala, S., Danford, T., Bernstein, D.A., Rolfe, P.A.,
Heisler, L.E., Chin, B., et al. (2010). Genotype to phenotype: a complex problem. Science 328, 469.
Dranginis, A.M., Rauceo, J.M., Coronado, J.E., and Lipke, P.N. (2007). A biochemical guide to yeast
adhesins: glycoproteins for social and antisocial occasions. Microbiol Mol Biol Rev 71, 282-294.
Du, Z., Park, K.W., Yu, H., Fan, Q., and Li, L. (2008). Newly identified prion linked to the chromatinremodeling factor Swi1 in Saccharomyces cerevisiae. Nat Genet 40, 460-465.
Dueholm, M.S., Petersen, S.V., Sonderkaer, M., Larsen, P., Christiansen, G., Hein, K.L., Enghild, J.J.,
Nielsen, J.L., Nielsen, K.L., Nielsen, P.H., et al. (2010). Functional amyloid in Pseudomonas. Mol
Microbiol.
167
Duennwald, M.L., Jagadish, S., Giorgini, F., Muchowski, P.J., and Lindquist, S. (2006). A network of
protein interactions determines polyglutamine toxicity. Proc Natl Acad Sci U S A 103, 11051-11056.
Eaglestone, S.S., Cox, B.S., and Tuite, M.F. (1999). Translation termination efficiency can be
regulated in Saccharomyces cerevisiae by environmental stress through a prion-mediated
mechanism. Embo J 18, 1974-1981.
Edskes, H.K., Gray, V.T., and Wickner, R.B. (1999). The [URE3] prion is an aggregated form of Ure2p
that can be cured by overexpression of Ure2p fragments. Proc Natl Acad Sci U S A 96, 1498-1503.
Edskes, H.K., Naglieri, B.M., and Wickner, R.B. (2006). Nitrogen source and the retrograde signalling
pathway affect detection, not generation, of the [URE3] prion. Yeast (Chichester, England) 23, 833840.
Eigen, M. (1996). Prionics or the kinetic basis of prion diseases. Biophys Chem 63, A1-18.
Engh, R.A., and Huber, R. (1991). Accurate Bond and Angle Parameters for X-Ray Protein-Structure
Refinement. Acta Crystallographica Section A 47, 392-400.
Fabre, E., Muller, H., Therizols, P., Lafontaine, I., Dujon, B., and Fairhead, C. (2005). Comparative
genomics in hemiascomycete yeasts: evolution of sex, silencing, and subtelomeres. Mol Biol Evol 22,
856-873.
Feinberg, A.P., and Irizarry, R.A. (2010). Evolution in health and medicine Sackler colloquium:
Stochastic epigenetic variation as a driving force of development, evolutionary adaptation, and
disease. Proc Natl Acad Sci U S A 107 Suppl 1, 1757-1764.
Fernandez-Bellot, E., Guillemet, E., and Cullin, C. (2000). The yeast prion [URE3] can be greatly
induced by a functional mutated URE2 allele. The EMBO journal 19, 3215-3222.
Fernandez-Escamilla, A.M., Rousseau, F., Schymkowitz, J., and Serrano, L. (2004). Prediction of
sequence-dependent and mutational effects on the aggregation of peptides and proteins. Nat
Biotechnol 22, 1302-1306.
Ferreira, P.C., Ness, F., Edwards, S.R., Cox, B.S., and Tuite, M.F. (2001). The elimination of the yeast
[PSI+] prion by guanidine hydrochloride is the result of Hsp104 inactivation. Mol Microbiol 40,
1357-1369.
Fleming, A.B., and Pennings, S. (2001). Antagonistic remodelling by Swi-Snf and Tup1-Ssn6 of an
extensive chromatin region forms the background for FLO1 gene regulation. EMBO J 20, 5219-5231.
Fowler, D.M., Koulov, A.V., Balch, W.E., and Kelly, J.W. (2007). Functional amyloid--from bacteria to
humans. Trends Biochem Sci 32, 217-224.
Frey, S., and Gorlich, D. (2009). FG/FxFG as well as GLFG repeats form a selective permeability
barrier with self-healing properties. EMBO J 28, 2554-2567.
Ganusova, E.E., Ozolins, L.N., Bhagat, S., Newnam, G.P., Wegrzyn, R.D., Sherman, M.Y., and Chernoff,
Y.O. (2006). Modulation of prion formation, aggregation, and toxicity by the actin cytoskeleton in
yeast. Mol Cell Biol 26, 617-629.
Giacomelli, M.G., Hancock, A.S., and Masel, J. (2007). The conversion of 3' UTRs into coding regions.
Mol Biol Evol 24, 457-464.
Gietz, D., St Jean, A., Woods, R.A., and Schiestl, R.H. (1992). Improved method for high efficiency
transformation of intact yeast cells. Nucleic Acids Res 20, 1425.
Gietz, R.D., Schiestl, R.H., Willems, A.R., and Woods, R.A. (1995). Studies on the transformation of
intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11, 355-360.
Gimeno, C.J., Ljungdahl, P.O., Styles, C.A., and Fink, G.R. (1992). Unipolar cell divisions in the yeast S.
cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68, 1077-1090.
Glover, J.R., Kowal, A.S., Schirmer, E.C., Patino, M.M., Liu, J.J., and Lindquist, S. (1997). Self-seeded
fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S.
cerevisiae. Cell 89, 811-819.
Goldschmidt, L., Teng, P.K., Riek, R., and Eisenberg, D. (2010). Identifying the amylome, proteins
capable of forming amyloid-like fibrils. Proc Natl Acad Sci U S A 107, 3487-3492.
168
Goldstein, A.L., and McCusker, J.H. (1999). Three new dominant drug resistance cassettes for gene
disruption in Saccharomyces cerevisiae. Yeast 15, 1541-1553.
Gore, J., Youk, H., and van Oudenaarden, A. (2009). Snowdrift game dynamics and facultative
cheating in yeast. Nature 459, 253-256.
Green, S.R., and Johnson, A.D. (2004). Promoter-dependent roles for the Srb10 cyclin-dependent
kinase and the Hda1 deacetylase in Tup1-mediated repression in Saccharomyces cerevisiae.
Molecular biology of the cell 15, 4191-4202.
Griffith, J.S. (1967). Self-replication and scrapie. Nature 215, 1043-1044.
Grimminger, V., Richter, K., Imhof, A., Buchner, J., and Walter, S. (2004). The prion curing agent
guanidinium chloride specifically inhibits ATP hydrolysis by Hsp104. J Biol Chem 279, 7378-7383.
Grishin, A.V., Rothenberg, M., Downs, M.A., and Blumer, K.J. (1998). Mot3, a Zn finger transcription
factor that modulates gene expression and attenuates mating pheromone signaling in
Saccharomyces cerevisiae. Genetics 149, 879-892.
Griswold, C.K., and Masel, J. (2009). Complex adaptations can drive the evolution of the capacitor
[PSI], even with realistic rates of yeast sex. PLoS Genet 5, e1000517.
Gsponer, J., Futschik, M.E., Teichmann, S.A., and Babu, M.M. (2008). Tight regulation of unstructured
proteins: from transcript synthesis to protein degradation. Science 322, 1365-1368.
Gueldener, U., Heinisch, J., Koehler, G.J., Voss, D., and Hegemann, J.H. (2002). A second set of loxP
marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res 30,
e23.
Guldener, U., Heck, S., Fielder, T., Beinhauer, J., and Hegemann, J.H. (1996). A new efficient gene
disruption cassette for repeated use in budding yeast. Nucleic Acids Res 24, 2519-2524.
Halfmann, R., Alberti, S., and Lindquist, S. (2010). Prions, protein homeostasis, and phenotypic
diversity. Trends Cell Biol 20, 125-133.
Halfmann, R., and Lindquist, S. (2008). Screening for amyloid aggregation by semi-denaturing
detergent-agarose gel electrophoresis. J Vis Exp.
Halfmann, R., and Lindquist, S. (2010). Epigenetics in the extreme: prions and the inheritance of
environmentally acquired traits. Science 330, 629-632.
Hammer, N.D., Wang, X., McGuffie, B.A., and Chapman, M.R. (2008). Amyloids: friend or foe? J
Alzheimers Dis 13, 407-419.
Harrison, P., Kumar, A., Lan, N., Echols, N., Snyder, M., and Gerstein, M. (2002). A small reservoir of
disabled ORFs in the yeast genome and its implications for the dynamics of proteome evolution. J
Mol Biol 316, 409-419.
Harrison, P.M., and Gerstein, M. (2003). A method to assess compositional bias in biological
sequences and its application to prion-like glutamine/asparagine-rich domains in eukaryotic
proteomes. Genome Biol 4, R40.
Haynes, C., Oldfield, C.J., Ji, F., Klitgord, N., Cusick, M.E., Radivojac, P., Uversky, V.N., Vidal, M., and
Iakoucheva, L.M. (2006). Intrinsic disorder is a common feature of hub proteins from four
eukaryotic interactomes. PLoS Comput Biol 2, e100.
He, B., Wang, K., Liu, Y., Xue, B., Uversky, V.N., and Dunker, A.K. (2009). Predicting intrinsic disorder
in proteins: an overview. Cell Res 19, 929-949.
Heiman, M.G., and Walter, P. (2000). Prm1p, a pheromone-regulated multispanning membrane
protein, facilitates plasma membrane fusion during yeast mating. J Cell Biol 151, 719-730.
Hillenmeyer, M.E., Fung, E., Wildenhain, J., Pierce, S.E., Hoon, S., Lee, W., Proctor, M., St Onge, R.P.,
Tyers, M., Koller, D., et al. (2008). The chemical genomic portrait of yeast: uncovering a phenotype
for all genes. Science 320, 362-365.
Hogan, D.J., Riordan, D.P., Gerber, A.P., Herschlag, D., and Brown, P.O. (2008). Diverse RNA-binding
proteins interact with functionally related sets of RNAs, suggesting an extensive regulatory system.
PLoS Biol 6, e255.
169
Hongay, C., Jia, N., Bard, M., and Winston, F. (2002). Mot3 is a transcriptional repressor of ergosterol
biosynthetic genes and is required for normal vacuolar function in Saccharomyces cerevisiae. Embo
J 21, 4114-4124.
Jablonka, E., and Raz, G. (2009). Transgenerational epigenetic inheritance: prevalence, mechanisms,
and implications for the study of heredity and evolution. Q Rev Biol 84, 131-176.
Jenkins, J., and Pickersgill, R. (2001). The architecture of parallel beta-helices and related folds. Prog
Biophys Mol Biol 77, 111-175.
Jung, G., and Masison, D.C. (2001). Guanidine hydrochloride inhibits Hsp104 activity in vivo: a
possible explanation for its effect in curing yeast prions. Curr Microbiol 43, 7-10.
Kabsch, W., and Sander, C. (1983). Dictionary of Protein Secondary Structure - Pattern-Recognition
of Hydrogen-Bonded and Geometrical Features. Biopolymers 22, 2577-2637.
Kaminski, G.A., Friesner, R.A., Tirado-Rives, J., and Jorgensen, W.L. (2001). Evaluation and
reparametrization of the OPLS-AA force field for proteins via comparison with accurate quantum
chemical calculations on peptides. Journal of Physical Chemistry B 105, 6474-6487.
Karlin, S., Brocchieri, L., Bergman, A., Mrazek, J., and Gentles, A.J. (2002). Amino acid runs in
eukaryotic proteomes and disease associations. Proc Natl Acad Sci U S A 99, 333-338.
Kawai-Noma, S., Pack, C.G., Kojidani, T., Asakawa, H., Hiraoka, Y., Kinjo, M., Haraguchi, T., Taguchi, H.,
and Hirata, A. (2010). In vivo evidence for the fibrillar structures of Sup35 prions in yeast cells. J
Cell Biol 190, 223-231.
Kayed, R., Head, E., Thompson, J.L., McIntire, T.M., Milton, S.C., Cotman, C.W., and Glabe, C.G. (2003).
Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis.
Science 300, 486-489.
King, C.Y., and Diaz-Avalos, R. (2004). Protein-only transmission of three yeast prion strains. Nature
428, 319-323.
King, O.D., and Masel, J. (2007). The evolution of bet-hedging adaptations to rare scenarios. Theor
Popul Biol 72, 560-575.
Kodali, R., and Wetzel, R. (2007). Polymorphism in the intermediates and products of amyloid
assembly. Curr Opin Struct Biol 17, 48-57.
Koonin, E.V., and Wolf, Y.I. (2009). Is evolution Darwinian or/and Lamarckian? Biol Direct 4, 42.
Kozlowski, P., de Mezer, M., and Krzyzosiak, W.J. (2010). Trinucleotide repeats in human genome
and exome. Nucleic Acids Res 38, 4027-4039.
Kreil, D.P., and Kreil, G. (2000). Asparagine repeats are rare in mammalian proteins. Trends
Biochem Sci 25, 270-271.
Krishnan, R., and Lindquist, S.L. (2005). Structural insights into a yeast prion illuminate nucleation
and strain diversity. Nature 435, 765-772.
Krobitsch, S., and Lindquist, S. (2000). Aggregation of huntingtin in yeast varies with the length of
the polyglutamine expansion and the expression of chaperone proteins. Proc Natl Acad Sci U S A 97,
1589-1594.
Kryndushkin, D.S., Alexandrov, I.M., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2003). Yeast [PSI+]
prion aggregates are formed by small Sup35 polymers fragmented by Hsp104. J Biol Chem 278,
49636-49643.
Kushnirov, V.V., Kochneva-Pervukhova, N.V., Chechenova, M.B., Frolova, N.S., and Ter-Avanesyan,
M.D. (2000). Prion properties of the Sup35 protein of yeast Pichia methanolica. The EMBO journal
19, 324-331.
Kushnirov, V.V., and Ter-Avanesyan, M.D. (1998). Structure and replication of yeast prions. Cell 94,
13-16.
Kussell, E., Kishony, R., Balaban, N.Q., and Leibler, S. (2005). Bacterial persistence: a model of
survival in changing environments. Genetics 169, 1807-1814.
Kyte, J., and Doolittle, R.F. (1982). A simple method for displaying the hydropathic character of a
protein. J Mol Biol 157, 105-132.
170
Lancaster, A.K., Bardill, J.P., True, H.L., and Masel, J. (2009). The Spontaneous Appearance Rate of
the Yeast Prion [PSI+] and Its Implications For the Evolution of the Evolvability Properties of the
[PSI+] System. Genetics, DOI: 10.1534/genetics.1109.110213 (http://www.genetics.org).
Lancaster, A.K., Bardill, J.P., True, H.L., and Masel, J. (2010). The spontaneous appearance rate of the
yeast prion [PSI+] and its implications for the evolution of the evolvability properties of the [PSI+]
system. Genetics 184, 393-400.
Larsen, P., Nielsen, J.L., Dueholm, M.S., Wetzel, R., Otzen, D., and Nielsen, P.H. (2007). Amyloid
adhesins are abundant in natural biofilms. Environ Microbiol 9, 3077-3090.
LeVine, H., 3rd (1993). Thioflavine T interaction with synthetic Alzheimer's disease beta-amyloid
peptides: detection of amyloid aggregation in solution. Protein Sci 2, 404-410.
LeVine, H., 3rd (1997). Stopped-flow kinetics reveal multiple phases of thioflavin T binding to
Alzheimer beta (1-40) amyloid fibrils. Arch Biochem Biophys 342, 306-316.
Li, L., and Lindquist, S. (2000). Creating a protein-based element of inheritance. Science 287, 661664.
Liebman, S.W., and Sherman, F. (1979). Extrachromosomal psi+ determinant suppresses nonsense
mutations in yeast. Journal of bacteriology 139, 1068-1071.
Liti, G., Carter, D.M., Moses, A.M., Warringer, J., Parts, L., James, S.A., Davey, R.P., Roberts, I.N., Burt,
A., Koufopanou, V., et al. (2009). Population genomics of domestic and wild yeasts. Nature 458, 337341.
Liu, J.J., and Lindquist, S. (1999). Oligopeptide-repeat expansions modulate 'protein-only'
inheritance in yeast. Nature 400, 573-576.
Liu, J.J., Sondheimer, N., and Lindquist, S.L. (2002). Changes in the middle region of Sup35
profoundly alter the nature of epigenetic inheritance for the yeast prion [PSI+]. Proc Natl Acad Sci U
S A 99 Suppl 4, 16446-16453.
Llorente, B., Durrens, P., Malpertuy, A., Aigle, M., Artiguenave, F., Blandin, G., Bolotin-Fukuhara, M.,
Bon, E., Brottier, P., Casaregola, S., et al. (2000). Genomic exploration of the hemiascomycetous
yeasts: 20. Evolution of gene redundancy compared to Saccharomyces cerevisiae. FEBS Lett 487,
122-133.
Lo, W.S., and Dranginis, A.M. (1998). The cell surface flocculin Flo11 is required for pseudohyphae
formation and invasion by Saccharomyces cerevisiae. Mol Biol Cell 9, 161-171.
Longtine, M.S., McKenzie, A., 3rd, Demarini, D.J., Shah, N.G., Wach, A., Brachat, A., Philippsen, P., and
Pringle, J.R. (1998). Additional modules for versatile and economical PCR-based gene deletion and
modification in Saccharomyces cerevisiae. Yeast 14, 953-961.
Lopez de la Paz, M., and Serrano, L. (2004). Sequence determinants of amyloid fibril formation. Proc
Natl Acad Sci U S A 101, 87-92.
Luheshi, L.M., Tartaglia, G.G., Brorsson, A.C., Pawar, A.P., Watson, I.E., Chiti, F., Vendruscolo, M.,
Lomas, D.A., Dobson, C.M., and Crowther, D.C. (2007). Systematic in vivo analysis of the intrinsic
determinants of amyloid Beta pathogenicity. PLoS Biol 5, e290.
Lund, P.M., and Cox, B.S. (1981). Reversion analysis of [psi-] mutations in Saccharomyces cerevisiae.
Genet Res 37, 173-182.
Maddelein, M.L., Dos Reis, S., Duvezin-Caubet, S., Coulary-Salin, B., and Saupe, S.J. (2002). Amyloid
aggregates of the HET-s prion protein are infectious. Proc Natl Acad Sci U S A 99, 7402-7407.
Maji, S.K., Perrin, M.H., Sawaya, M.R., Jessberger, S., Vadodaria, K., Rissman, R.A., Singru, P.S., Nilsson,
K.P., Simon, R., Schubert, D., et al. (2009). Functional amyloids as natural storage of peptide
hormones in pituitary secretory granules. Science 325, 328-332.
Masel, J. (2006). Cryptic genetic variation is enriched for potential adaptations. Genetics 172, 19851991.
Masel, J., and Siegal, M.L. (2009). Robustness: mechanisms and consequences. Trends Genet 25,
395-403.
Masel, J., and Trotter, M.V. (2010). Robustness and evolvability. Trends Genet 26, 406-414.
171
Masison, D.C., and Wickner, R.B. (1995). Prion-inducing domain of yeast Ure2p and protease
resistance of Ure2p in prion-containing cells. Science 270, 93-95.
Mathur, V., Hong, J.Y., and Liebman, S.W. (2009). Ssa1 overexpression and [PIN(+)] variants cure
[PSI(+)] by dilution of aggregates. Journal of molecular biology 390, 155-167.
Maurer-Stroh, S., Debulpaep, M., Kuemmerer, N., Lopez de la Paz, M., Martins, I.C., Reumers, J.,
Morris, K.L., Copland, A., Serpell, L., Serrano, L., et al. (2010). Exploring the sequence determinants
of amyloid structure using position-specific scoring matrices. Nat Methods 7, 237-242.
Meriin, A.B., Zhang, X., Alexandrov, I.M., Salnikova, A.B., Ter-Avanesian, M.D., Chernoff, Y.O., and
Sherman, M.Y. (2007). Endocytosis machinery is involved in aggregation of proteins with expanded
polyglutamine domains. FASEB J 21, 1915-1925.
Michelitsch, M.D., and Weissman, J.S. (2000). A census of glutamine/asparagine-rich regions:
implications for their conserved function and the prediction of novel prions. Proc Natl Acad Sci U S
A 97, 11910-11915.
Morimoto, R.I. (2008). Proteotoxic stress and inducible chaperone networks in neurodegenerative
disease and aging. Genes & development 22, 1427-1438.
Mrsa, V., Ecker, M., Strahl-Bolsinger, S., Nimtz, M., Lehle, L., and Tanner, W. (1999). Deletion of new
covalently linked cell wall glycoproteins alters the electrophoretic mobility of phosphorylated wall
components of Saccharomyces cerevisiae. Journal of bacteriology 181, 3076-3086.
Mukhopadhyay, S., Krishnan, R., Lemke, E.A., Lindquist, S., and Deniz, A.A. (2007). A natively
unfolded yeast prion monomer adopts an ensemble of collapsed and rapidly fluctuating structures.
Proc Natl Acad Sci U S A 104, 2649-2654.
Mumberg, D., Muller, R., and Funk, M. (1995). Yeast vectors for the controlled expression of
heterologous proteins in different genetic backgrounds. Gene 156, 119-122.
Nakayashiki, T., Ebihara, K., Bannai, H., and Nakamura, Y. (2001). Yeast [PSI+] "prions" that are
crosstransmissible and susceptible beyond a species barrier through a quasi-prion state. Molecular
cell 7, 1121-1130.
Nakayashiki, T., Kurtzman, C.P., Edskes, H.K., and Wickner, R.B. (2005). Yeast prions [URE3] and
[PSI+] are diseases. Proc Natl Acad Sci U S A 102, 10575-10580.
Namy, O., Galopier, A., Martini, C., Matsufuji, S., Fabret, C., and Rousset, J.P. (2008a). Epigenetic
control of polyamines by the prion [PSI(+)]. Nat Cell Biol.
Namy, O., Galopier, A., Martini, C., Matsufuji, S., Fabret, C., and Rousset, J.P. (2008b). Epigenetic
control of polyamines by the prion [PSI+]. Nat Cell Biol 10, 1069-1075.
Nelson, R., and Eisenberg, D. (2006). Recent atomic models of amyloid fibril structure. Curr Opin
Struct Biol 16, 260-265.
Nemecek, J., Nakayashiki, T., and Wickner, R.B. (2009). A prion of yeast metacaspase homolog
(Mca1p) detected by a genetic screen. Proceedings of the National Academy of Sciences of the
United States of America 106, 1892-1896.
Osherovich, L.Z., Cox, B.S., Tuite, M.F., and Weissman, J.S. (2004). Dissection and design of yeast
prions. PLoS Biol 2, E86.
Osherovich, L.Z., and Weissman, J.S. (2001). Multiple Gln/Asn-rich prion domains confer
susceptibility to induction of the yeast [PSI(+)] prion. Cell 106, 183-194.
Pappu, R.V., Wang, X., Vitalis, A., and Crick, S.L. (2008). A polymer physics perspective on driving
forces and mechanisms for protein aggregation. Arch Biochem Biophys 469, 132-141.
Patel, B.K., Gavin-Smyth, J., and Liebman, S.W. (2009a). The yeast global transcriptional corepressor protein Cyc8 can propagate as a prion. Nat Cell Biol.
Patel, B.K., Gavin-Smyth, J., and Liebman, S.W. (2009b). The yeast global transcriptional corepressor protein Cyc8 can propagate as a prion. Nature cell biology 11, 344-349.
Patel, B.K., and Liebman, S.W. (2007). "Prion-proof" for [PIN+]: infection with in vitro-made amyloid
aggregates of Rnq1p-(132-405) induces [PIN+]. J Mol Biol 365, 773-782.
172
Patel, S.S., Belmont, B.J., Sante, J.M., and Rexach, M.F. (2007). Natively unfolded nucleoporins gate
protein diffusion across the nuclear pore complex. Cell 129, 83-96.
Patino, M.M., Liu, J.J., Glover, J.R., and Lindquist, S. (1996). Support for the prion hypothesis for
inheritance of a phenotypic trait in yeast. Science 273, 622-626.
Paushkin, S.V., Kushnirov, V.V., Smirnov, V.N., and Ter-Avanesyan, M.D. (1996). Propagation of the
yeast prion-like [psi+] determinant is mediated by oligomerization of the SUP35-encoded
polypeptide chain release factor. Embo J 15, 3127-3134.
Pedersen, J.S., and Otzen, D.E. (2008). Amyloid-a state in many guises: survival of the fittest fibril
fold. Protein Sci 17, 2-10.
Peng, K., Radivojac, P., Vucetic, S., Dunker, A.K., and Obradovic, Z. (2006). Length-dependent
prediction of protein intrinsic disorder. BMC Bioinformatics 7, 208.
Perrett, S., and Jones, G.W. (2008). Insights into the mechanism of prion propagation. Curr Opin
Struct Biol 18, 52-59.
Perutz, M.F., Pope, B.J., Owen, D., Wanker, E.E., and Scherzinger, E. (2002). Aggregation of proteins
with expanded glutamine and alanine repeats of the glutamine-rich and asparagine-rich domains of
Sup35 and of the amyloid beta-peptide of amyloid plaques. Proc Natl Acad Sci U S A 99, 5596-5600.
Perutz, M.F., and Windle, A.H. (2001). Cause of neural death in neurodegenerative diseases
attributable to expansion of glutamine repeats. Nature 412, 143-144.
Pierce, M.M., Baxa, U., Steven, A.C., Bax, A., and Wickner, R.B. (2005). Is the prion domain of soluble
Ure2p unstructured? Biochemistry 44, 321-328.
Pigliucci, M. (2008). Is evolvability evolvable? Nat Rev Genet 9, 75-82.
Powers, E.T., and Powers, D.L. (2008). Mechanisms of protein fibril formation: nucleated
polymerization with competing off-pathway aggregation. Biophys J 94, 379-391.
Prilusky, J., Felder, C.E., Zeev-Ben-Mordehai, T., Rydberg, E.H., Man, O., Beckmann, J.S., Silman, I., and
Sussman, J.L. (2005). FoldIndex: a simple tool to predict whether a given protein sequence is
intrinsically unfolded. Bioinformatics 21, 3435-3438.
Prusiner, S.B. (1982). Novel proteinaceous infectious particles cause scrapie. Science 216, 136-144.
Prusiner, S.B. (1998). Prions. Proc Natl Acad Sci U S A 95, 13363-13383.
Radivojac, P., Iakoucheva, L.M., Oldfield, C.J., Obradovic, Z., Uversky, V.N., and Dunker, A.K. (2007).
Intrinsic disorder and functional proteomics. Biophys J 92, 1439-1456.
Ram, A.F., Wolters, A., Ten Hoopen, R., and Klis, F.M. (1994). A new approach for isolating cell wall
mutants in Saccharomyces cerevisiae by screening for hypersensitivity to calcofluor white. Yeast
(Chichester, England) 10, 1019-1030.
Rando, O.J., and Verstrepen, K.J. (2007). Timescales of genetic and epigenetic inheritance. Cell 128,
655-668.
Reynolds, T.B., and Fink, G.R. (2001). Bakers' yeast, a model for fungal biofilm formation. Science
291, 878-881.
Rogoza, T., Goginashvili, A., Rodionova, S., Ivanov, M., Viktorovskaya, O., Rubel, A., Volkov, K., and
Mironova, L. (2010). Non-Mendelian determinant [ISP+] in yeast is a nuclear-residing prion form of
the global transcriptional regulator Sfp1. Proc Natl Acad Sci U S A 107, 10573-10577.
Romero, P., Obradovic, Z., Li, X., Garner, E.C., Brown, C.J., and Dunker, A.K. (2001). Sequence
complexity of disordered protein. Proteins 42, 38-48.
Ross, E.D., Baxa, U., and Wickner, R.B. (2004). Scrambled prion domains form prions and amyloid.
Mol Cell Biol 24, 7206-7213.
Ross, E.D., Edskes, H.K., Terry, M.J., and Wickner, R.B. (2005a). Primary sequence independence for
prion formation. Proc Natl Acad Sci U S A 102, 12825-12830.
Ross, E.D., Minton, A., and Wickner, R.B. (2005b). Prion domains: sequences, structures and
interactions. Nature cell biology 7, 1039-1044.
Rutherford, S.L., and Lindquist, S. (1998). Hsp90 as a capacitor for morphological evolution. Nature
396, 336-342.
173
Sabate, R., Baxa, U., Benkemoun, L., Sanchez de Groot, N., Coulary-Salin, B., Maddelein, M.L., Malato,
L., Ventura, S., Steven, A.C., and Saupe, S.J. (2007). Prion and non-prion amyloids of the HET-s prion
forming domain. Journal of molecular biology 370, 768-783.
Salazar, A.M., Silverman, E.J., Menon, K.P., and Zinn, K. (2010). Regulation of synaptic Pumilio
function by an aggregation-prone domain. J Neurosci 30, 515-522.
Salnikova, A.B., Kryndushkin, D.S., Smirnov, V.N., Kushnirov, V.V., and Ter-Avanesyan, M.D. (2005).
Nonsense suppression in yeast cells overproducing Sup35 (eRF3) is caused by its non-heritable
amyloids. J Biol Chem 280, 8808-8812.
Santoso, A., Chien, P., Osherovich, L.Z., and Weissman, J.S. (2000). Molecular basis of a yeast prion
species barrier. Cell 100, 277-288.
Saupe, S.J. (2007). A short history of small s: a prion of the fungus Podospora anserina. Prion 1, 110115.
Saupe, S.J., Clave, C., and Begueret, J. (2000). Vegetative incompatibility in filamentous fungi:
Podospora and Neurospora provide some clues. Curr Opin Microbiol 3, 608-612.
Scherzinger, E., Sittler, A., Schweiger, K., Heiser, V., Lurz, R., Hasenbank, R., Bates, G.P., Lehrach, H.,
and Wanker, E.E. (1999). Self-assembly of polyglutamine-containing huntingtin fragments into
amyloid-like fibrils: implications for Huntington's disease pathology. Proceedings of the National
Academy of Sciences of the United States of America 96, 4604-4609.
Schwimmer, C., and Masison, D.C. (2002). Antagonistic interactions between yeast [PSI(+)] and
[URE3] prions and curing of [URE3] by Hsp70 protein chaperone Ssa1p but not by Ssa2p. Molecular
and cellular biology 22, 3590-3598.
Seger, J., and Brockmann, H.J. (1987). What is bet-hedging? Oxford Surv Evol Biol 4, 192-211.
Senechal, P., Arseneault, G., Leroux, A., Lindquist, S., and Rokeach, L.A. (2009). The
Schizosaccharomyces pombe Hsp104 disaggregase is unable to propagate the [PSI] prion. PLoS One
4, e6939.
Serio, T.R., Cashikar, A.G., Kowal, A.S., Sawicki, G.J., Moslehi, J.J., Serpell, L., Arnsdorf, M.F., and
Lindquist, S.L. (2000). Nucleated conformational conversion and the replication of conformational
information by a prion determinant. Science (New York, NY 289, 1317-1321.
Shkundina, I.S., and Ter-Avanesyan, M.D. (2007). Prions. Biochemistry (Mosc) 72, 1519-1536.
Shorter, J., and Lindquist, S. (2004). Hsp104 catalyzes formation and elimination of self-replicating
Sup35 prion conformers. Science 304, 1793-1797.
Shorter, J., and Lindquist, S. (2005). Prions as adaptive conduits of memory and inheritance. Nature
reviews 6, 435-450.
Shorter, J., and Lindquist, S. (2006). Destruction or potentiation of different prions catalyzed by
similar Hsp104 remodeling activities. Mol Cell 23, 425-438.
Shorter, J., and Lindquist, S. (2008). Hsp104, Hsp70 and Hsp40 interplay regulates formation,
growth and elimination of Sup35 prions. Embo J 27, 2712-2724.
Si, K., Choi, Y.B., White-Grindley, E., Majumdar, A., and Kandel, E.R. (2010). Aplysia CPEB can form
prion-like multimers in sensory neurons that contribute to long-term facilitation. Cell 140, 421-435.
Si, K., Lindquist, S., and Kandel, E.R. (2003). A neuronal isoform of the aplysia CPEB has prion-like
properties. Cell 115, 879-891.
Singh, G.P., Chandra, B.R., Bhattacharya, A., Akhouri, R.R., Singh, S.K., and Sharma, A. (2004). Hyperexpansion of asparagines correlates with an abundance of proteins with prion-like domains in
Plasmodium falciparum. Mol Biochem Parasitol 137, 307-319.
Smukalla, S., Caldara, M., Pochet, N., Beauvais, A., Guadagnini, S., Yan, C., Vinces, M.D., Jansen, A.,
Prevost, M.C., Latge, J.P., et al. (2008). FLO1 is a variable green beard gene that drives biofilm-like
cooperation in budding yeast. Cell 135, 726-737.
Sniegowski, P.D., and Murphy, H.A. (2006). Evolvability. Curr Biol 16, R831-834.
Sondheimer, N., and Lindquist, S. (2000). Rnq1: an epigenetic modifier of protein function in yeast.
Mol Cell 5, 163-172.
174
Sparrer, H.E., Santoso, A., Szoka, F.C., Jr., and Weissman, J.S. (2000). Evidence for the prion
hypothesis: induction of the yeast [PSI+] factor by in vitro- converted Sup35 protein. Science (New
York, NY 289, 595-599.
Stern, D.L., and Orgogozo, V. (2009). Is genetic evolution predictable? Science 323, 746-751.
Storici, F., and Resnick, M.A. (2006). The delitto perfetto approach to in vivo site-directed
mutagenesis and chromosome rearrangements with synthetic oligonucleotides in yeast. Methods
Enzymol 409, 329-345.
Strambio-De-Castillia, C., Niepel, M., and Rout, M.P. (2010). The nuclear pore complex: bridging
nuclear transport and gene regulation. Nat Rev Mol Cell Biol 11, 490-501.
Stratford, M., and Assinder, S. (1991). Yeast flocculation: Flo1 and NewFlo phenotypes and receptor
structure. Yeast 7, 559-574.
Sugita, Y., and Okamoto, Y. (1999). Replica-exchange molecular dynamics method for protein
folding. Chemical Physics Letters 314, 141-151.
Sweeny, E.A., and Shorter, J. (2008). Prion proteostasis: Hsp104 meets its supporting cast. Prion 2,
135-140.
Takahashi, T., Kikuchi, S., Katada, S., Nagai, Y., Nishizawa, M., and Onodera, O. (2008). Soluble
polyglutamine oligomers formed prior to inclusion body formation are cytotoxic. Hum Mol Genet
17, 345-356.
Tanaka, M., Collins, S.R., Toyama, B.H., and Weissman, J.S. (2006). The physical basis of how prion
conformations determine strain phenotypes. Nature 442, 585-589.
Tanaka, M., and Weissman, J.S. (2006). An efficient protein transformation protocol for introducing
prions into yeast. Methods in enzymology 412, 185-200.
Taneja, V., Maddelein, M.L., Talarek, N., Saupe, S.J., and Liebman, S.W. (2007). A non-Q/N-rich prion
domain of a foreign prion, [Het-s], can propagate as a prion in yeast. Molecular cell 27, 67-77.
Tank, E.M., Harris, D.A., Desai, A.A., and True, H.L. (2007). Prion protein repeat expansion results in
increased aggregation and reveals phenotypic variability. Molecular and cellular biology 27, 54455455.
Tartaglia, G.G., and Vendruscolo, M. (2008). The Zyggregator method for predicting protein
aggregation propensities. Chem Soc Rev 37, 1395-1401.
Taylor, K.L., Cheng, N., Williams, R.W., Steven, A.C., and Wickner, R.B. (1999). Prion domain
initiation of amyloid formation in vitro from native Ure2p. Science (New York, NY 283, 1339-1343.
Teixeira, M.C., Monteiro, P., Jain, P., Tenreiro, S., Fernandes, A.R., Mira, N.P., Alenquer, M., Freitas,
A.T., Oliveira, A.L., and Sa-Correia, I. (2006). The YEASTRACT database: a tool for the analysis of
transcription regulatory associations in Saccharomyces cerevisiae. Nucleic Acids Res 34, D446-451.
Ter-Avanesyan, M.D., Dagkesamanskaya, A.R., Kushnirov, V.V., and Smirnov, V.N. (1994). The SUP35
omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant
[psi+] in the yeast Saccharomyces cerevisiae. Genetics 137, 671-676.
Tessier, P.M., and Lindquist, S. (2009). Unraveling infectious structures, strain variants and species
barriers for the yeast prion [PSI+]. Nat Struct Mol Biol 16, 598-605.
Titz, B., Thomas, S., Rajagopala, S.V., Chiba, T., Ito, T., and Uetz, P. (2006). Transcriptional activators
in yeast. Nucleic Acids Res 34, 955-967.
Toombs, J.A., McCarty, B.R., and Ross, E.D. (2009). Compositional determinants of prion formation
in yeast. Mol Cell Biol.
Toombs, J.A., McCarty, B.R., and Ross, E.D. (2010). Compositional determinants of prion formation
in yeast. Mol Cell Biol 30, 319-332.
Treusch, S., Cyr, D.M., and Lindquist, S. (2009). Amyloid deposits: protection against toxic protein
species? Cell Cycle 8, 1668-1674.
Truant, R., Atwal, R.S., Desmond, C., Munsie, L., and Tran, T. (2008). Huntington's disease: revisiting
the aggregation hypothesis in polyglutamine neurodegenerative diseases. FEBS J 275, 4252-4262.
175
True, H.L., Berlin, I., and Lindquist, S.L. (2004). Epigenetic regulation of translation reveals hidden
genetic variation to produce complex traits. Nature 431, 184-187.
True, H.L., and Lindquist, S.L. (2000). A yeast prion provides a mechanism for genetic variation and
phenotypic diversity. Nature 407, 477-483.
Tuite, M., Stojanovski, K., Ness, F., Merritt, G., and Koloteva-Levine, N. (2008). Cellular factors
important for the de novo formation of yeast prions. Biochem Soc Trans 36, 1083-1087.
Tuite, M.F., and Cox, B.S. (2003). Propagation of yeast prions. Nat Rev Mol Cell Biol 4, 878-890.
Turoverov, K.K., Kuznetsova, I.M., and Uversky, V.N. (2010). The protein kingdom extended:
ordered and intrinsically disordered proteins, their folding, supramolecular complex formation, and
aggregation. Prog Biophys Mol Biol 102, 73-84.
Tyedmers, J., Madariaga, M.L., and Lindquist, S. (2008). Prion switching in response to
environmental stress. PLoS biology 6, e294.
Tyedmers, J., Treusch, S., Dong, J., McCaffery, J.M., Bevis, B., and Lindquist, S. (2010). Prion induction
involves an ancient system for the sequestration of aggregated proteins and heritable changes in
prion fragmentation. Proc Natl Acad Sci U S A 107, 8633-8638.
Uversky, V.N. (2008). Amyloidogenesis of natively unfolded proteins. Curr Alzheimer Res 5, 260287.
Uversky, V.N. (2009). Intrinsic disorder in proteins associated with neurodegenerative diseases.
Front Biosci 14, 5188-5238.
Vavouri, T., Semple, J.I., Garcia-Verdugo, R., and Lehner, B. (2009). Intrinsic protein disorder and
interaction promiscuity are widely associated with dosage sensitivity. Cell 138, 198-208.
Vernet, T., Dignard, D., and Thomas, D.Y. (1987). A family of yeast expression vectors containing the
phage f1 intergenic region. Gene 52, 225-233.
Verstrepen, K.J., and Fink, G.R. (2009). Genetic and epigenetic mechanisms underlying cell-surface
variability in protozoa and fungi. Annu Rev Genet 43, 1-24.
Verstrepen, K.J., Jansen, A., Lewitter, F., and Fink, G.R. (2005). Intragenic tandem repeats generate
functional variability. Nat Genet 37, 986-990.
Vinces, M.D., Legendre, M., Caldara, M., Hagihara, M., and Verstrepen, K.J. (2009). Unstable tandem
repeats in promoters confer transcriptional evolvability. Science 324, 1213-1216.
Vitalis, A., Lyle, N., and Pappu, R.V. (2009). Thermodynamics of beta-sheet formation in
polyglutamine. Biophys J 97, 303-311.
Vitalis, A., and Pappu, R.V. (2009). ABSINTH: A New Continuum Solvation Model for Simulations of
Polypeptides in Aqueous Solutions. Journal of Computational Chemistry 30, 673-699.
Vitalis, A., Wang, X., and Pappu, R.V. (2007). Quantitative characterization of intrinsic disorder in
polyglutamine: insights from analysis based on polymer theories. Biophys J 93, 1923-1937.
Vitalis, A., Wang, X., and Pappu, R.V. (2008). Atomistic simulations of the effects of polyglutamine
chain length and solvent quality on conformational equilibria and spontaneous homodimerization. J
Mol Biol 384, 279-297.
Vitrenko, Y.A., Gracheva, E.O., Richmond, J.E., and Liebman, S.W. (2007). Visualization of aggregation
of the Rnq1 prion domain and cross-seeding interactions with Sup35NM. J Biol Chem 282, 17791787.
Wach, A., Brachat, A., Pohlmann, R., and Philippsen, P. (1994). New heterologous modules for
classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793-1808.
Wach, A., and Philippsen, P. (1997). Heterologous HIS3 Marker and GFP REporter Modules for PCRTargeting in Saccharomyces cerevisiae. Yeast 13, 1065-1075.
Walters, R.H., and Murphy, R.M. (2009). Examining polyglutamine peptide length: a connection
between collapsed conformations and increased aggregation. J Mol Biol 393, 978-992.
Wang, X., Hammer, N.D., and Chapman, M.R. (2008). The molecular basis of functional bacterial
amyloid polymerization and nucleation. J Biol Chem 283, 21530-21539.
176
Wang, X., Vitalis, A., Wyczalkowski, M.A., and Pappu, R.V. (2006). Characterizing the conformational
ensemble of monomeric polyglutamine. Proteins 63, 297-311.
Wasmer, C., Lange, A., Van Melckebeke, H., Siemer, A.B., Riek, R., and Meier, B.H. (2008). Amyloid
fibrils of the HET-s(218-289) prion form a beta solenoid with a triangular hydrophobic core.
Science 319, 1523-1526.
Weathers, E.A., Paulaitis, M.E., Woolf, T.B., and Hoh, J.H. (2004). Reduced amino acid alphabet is
sufficient to accurately recognize intrinsically disordered protein. FEBS Lett 576, 348-352.
Weissman, D.B., Desai, M.M., Fisher, D.S., and Feldman, M.W. (2009). The rate at which asexual
populations cross fitness valleys. Theor Popul Biol 75, 286-300.
Wente, S.R., Rout, M.P., and Blobel, G. (1992). A new family of yeast nuclear pore complex proteins.
The Journal of cell biology 119, 705-723.
West-Eberhard, M.J. (2003). Developmental plasticity and evolution (Oxford ; New York, Oxford
University Press).
Wickner, R.B. (1994). [URE3] as an altered URE2 protein: evidence for a prion analog in
Saccharomyces cerevisiae. Science (New York, NY 264, 566-569.
Wickner, R.B., Edskes, H.K., Shewmaker, F., and Nakayashiki, T. (2007a). Prions of fungi: inherited
structures and biological roles. Nat Rev Microbiol 5, 611-618.
Wickner, R.B., Edskes, H.K., Shewmaker, F., Nakayashiki, T., Engel, A., McCann, L., and Kryndushkin,
D. (2007b). Yeast prions: evolution of the prion concept. Prion 1, 94-100.
Williamson, T.E., Vitalis, A., Crick, S.L., and Pappu, R.V. (2010). Modulation of polyglutamine
conformations and dimer formation by the N-terminus of huntingtin. J Mol Biol 396, 1295-1309.
Wilson, M.A., Meaux, S., Parker, R., and van Hoof, A. (2005). Genetic interactions between [PSI+] and
nonstop mRNA decay affect phenotypic variation. Proc Natl Acad Sci U S A 102, 10244-10249.
Xiao, H., and Jeang, K.T. (1998). Glutamine-rich domains activate transcription in yeast
Saccharomyces cerevisiae. J Biol Chem 273, 22873-22876.
Zenthon, J.F., Ness, F., Cox, B., and Tuite, M.F. (2006). The [PSI+] prion of Saccharomyces cerevisiae
can be propagated by an Hsp104 orthologue from Candida albicans. Eukaryot Cell 5, 217-225.
177
A.
Nuclear Pore
Complex
GLFG Nucleoporins
AA (43-113) (196-400)
Nup100
N
M
C
AA (1-200) (201-400) (401-640)
(278-323)(392-560)(692-740)
Nup116
AA (102-108)
(209-261)
Nup49
(204-304)
Nup57
B.
Wild type yeast
hsp104∆ yeast
Nup100-CFP
Nup100-CFP
N
M
C
N
M
C
0%
0%
0%
0%
Nup-CFP
DIC
% cells with
aggregates:
27 ± 1 % 85 ± 1 %
Nup100M-CFP
C.
[RNQ+]
hsp104∆
[rnq-]
rnq1∆
[rnq-]
GdnHCl
[rnq-]
Nup-CFP
DIC
D.
CFPAA
Wild type yeast
hsp104∆ yeast
Nup116 Nup57 Nup49
Nup116 Nup57 Nup49
382-597 204-304 209-310
382-597 204-304 209-310
CFP-nup
DIC
% cells with
aggregates: 50 ± 1 % 36 ± 7 % 15 ± 5 %
0%
0%
0%
178
Figure 1- GLFG Nucleoporins form prion-like aggregates. (A) Diagram of the NPC and of natively unfolded
GLFG nups populating its conduit. Each GLFG nup is shown as a green rectangle (N-terminus at left) and the
location of FG motifs is indicated by vertical ovals. GLFG motifs are yellow, FxFG red, SPFG dark green, FxFx
light gray, SAFG dark blue, PSFG bright green, NxFG light blue, SLFG orange, xxFG white, and FxxFG lime
green. The brackets above each nup mark the boundaries of Q/N rich regions, which are also marked by a
purple rectangle(s). The horizontal gray rectangle in each nup highlights its known or presumed NPC anchor
domain. (B) Nup100N (AA 1-200), Nup100M (AA 200-400) and Nup100C (AA 400-640) were over-expressed
as CFP fusions in WT or hsp104∆ yeast from a constitutive ADH1 promoter. The percentage of cells (n > 400)
with fluorescent Nup-CFP aggregates is indicated; standard deviation is from two independent experiments.
(C) Nup100M-CFP was overexpressed as in (B) in WT ([RNQ+]), or cells that had been converted to [rnq-] by
deletion of HSP104 (hsp104∆) or RNQ1 (rnq1∆), or treated with GdnHCl. (D) The Q/N regions of Nup116,
Nup57, and Nup49 were over-expressed as CFP fusions in WT or hsp104∆ yeast and were analyzed as in (B).
179
A.
Overexpressed Nup100M
Chromosomal Nup-GFP
Nup116
Nup49
Nup100
Nup2
GFP
DIC
% cells with
aggregates:
B.
[rnq-]
T
anti-GFP
anti-GLFG
30 ± 2 %
S
13 ± 3 %
6± 1%
C.
[RNQ+]
P
T
S
0%
Nup100Mf
over-expression: +
P
over-expressed
Nup100M-CFP
Nup116
Nsp1
Nup100
nNup145
Nup57
-
Endogenous
Nup100-HA
aggregates
monomeric
anti-Gsp1
Gsp1
total
Figure 2- The prion-like region of Nup100 forms insoluble aggregates that sequester endogenous GLFG nups.
(A) Yeast containing a chromosomal fusion of Nup100, Nup116, Nup49 or Nup2 with GFP were transformed
with a plasmid that over-expresses Nup100M. The % of cells with aggregates (n > 400) is shown below the
pictures. The arrowheads point to mislocalized endogenous nups. (B) [rnq1-] and [RNQ1+] cells overexpressing Nup100M-CFP were lysed and cleared of unbroken cells by centrifugation at 2,000 x g. The low
speed supernatant fraction (T) was fractionated further at 12,000 x g into medium speed supernatant (S) and
pellet (P) fractions. Proteins in each fraction were resolved by SDS-PAGE, and the presence of Nup100M-CFP,
Gsp1 and endogenous GLFG nups were detected by Western blotting with anti-GFP, anti-Gsp1, or anti-GLFG
nup antibodies. (C) Nup100Mf-EYFP was over-expressed from a high copy galactose inducible plasmid in a
strain in which endogenous Nup100 was tagged with HA. Cells were analyzed by SDD-AGE and endogenous
Nup100 detected with antiHA antibodies.
180
B.
A.
ThT (AFU)
1000
no seed
5% seed
500
0
0
100
200 300
Time (min)
400
500
200 nm
Figure 3 - Nup100Mf forms amyloid under physiological conditions. (A) Nup100Mf-Trp-7xHis was diluted
from denaturant to 20 µM in assembly buffer. The reaction was incubated at 30°C with agitation, in the
absence or presence of 5% pre-formed aggregate seed. Amyloid assembly was monitored by Thioflavin T
fluorescence. (B) Seeded amyloids formed in (A) were negatively stained and examined by transmission
electron microscope. Scale bar, 200 nm.
181
A.
[psi-]
[PSI+]
read-through
stop
Sup35PRDSup35C
Sup35PRDSup35C
[100mf-]
[100Mf+]
read-through
stop
Nup100PRDSup35C
Nup100PRDSup35C
B.
C.
spontaneous
B.
Induced
D.
Figure 4- Nup100Mf is a prion-forming domain. (A) Schematic demonstrating the phenotypic reporter for
Nup100PrD-Sup35C prions. When WT Sup35 forms prion aggregates, it is sequestered away from its role in
translation termination, causing a read through phenotype that converts cells from red [psi-] to white [PSI+]
(top). The Sup35PrD can be substituted for the Nup100PrD, resulting in a fully functional chimeric protein
that recapitulates both the red ([100mf-]) and white ([100Mf+]) states (bottom). (B) [100mf-] [RNQ+] cells
containing a galactose-inducible version of Nup100Mf-EYFP were grown overnight in either glucose- or
galactose-containing media, followed by plating to YPD to assess the appearance of white or pink [100Mf+]
colonies. Red colonies derive from cells that remain [100mf-]. (C) [100mf-] strains containing either [rnq-] or
[RNQ+] are spotted onto YPD next to a [100Mf+] strain before and after GdnHCl treatment. The pink
coloration of the [RNQ+] [100mf-] colony results from the high frequency of spontaneous appearance of
[100Mf+] in this background. (D) RNQ1 was deleted in [100mf-] and [100Mf+] and the resulting strains are
spotted onto YPD beside a [RNQ+] [100Mf+] strain. [100Mf+] does not require [RNQ+] for stable propagation.
182
A.
Nup100-EGFP: EGFP: +
[RNQ+]: +
+
+
+
-
+ GAL (2 days)
B.
Nup100-EGFP: +
[RNQ+]: +
+
+
+
-
- GAL
+
-
- GAL
+ GAL (7 days)
D.
C.
DIC
Nup100-EGFP
[rnq-] [RNQ+]
amyloid
Nup100EGFP
[RNQ+]
soluble
[rnq-]
Figure 5- Over-expressed Nup100 forms toxic non-amyloid conformers. (A) Yeast containing Nup100-EGFP
or EGFP on a high copy galactose-inducible plasmid were grown overnight in glucose media, washed, then
plated. Cells were photographed after 2 days on galactose media (+GAL) or 1 day on glucose media (-GAL).
(B) As in (A), except that galactose plates were allowed to incubate for 7 days prior to being photographed.
Papilla with suppressed toxicity appear among cells that contain [RNQ+]. (C) [rnq-] or [RNQ+] yeast
containing Nup100-EGFP on a high copy galactose-inducible plasmid were grown overnight in galactose
media. Full length Nup100-EGFP forms fluorescent foci in both backgrounds. (D) [rnq-] or [RNQ+] yeast
expressing Nup100-EGFP as in (C) were analyzed by SDD-AGE. The blot was probed with anti-GFP, revealing
SDS-resistant aggregates of Nup100-EGFP in [RNQ+] cells.
183
A.
[NUP100+]
Nup100-EGFP (GAL)
-
+
+ GAL
(5 days)
-
- GAL
+
-
+
+
+
GLFG nups
amyloid
soluble
GdnHCl:
B.
[NUP100+]: GdnHCl: -
Figure 6- Nup100 forms a cytoprotective prion state. (A) A spontaneous suppressor of Nup100-EGFP toxicity
([NUP100+]) was passaged 6 times on glucose media with or without GdnHCl, and then retested for toxicity
by replating to galactose (+GAL) or gluocose (-GAL) media. (B) [nup100-] and [NUP100+] isolates that were
allowed to lose the inducing plasmid (Nup100-EGFP) were grown overnight in YPD and analyzed by SDDAGE. Endogenous GLFG nups were detected with an antiGLFG nup antibody. [NUP100+] lysate contains an
increased amount of SDS-resistant GLFG nups.
184
Appendix C
Specific Author Contributions
Chapter 2:
Simon Alberti performed the intracellular amyloid-formation experiments (Figure 2C), all
experiments with Sup35C fusion proteins (Figures 4, 5, S1, S4-S10), experiments with Swi1 (Figure
7D-E), and did most of the molecular cloning. I performed all of the biochemical investigations
(Figure 3) and experiments with Mot3 (Figure 6, 7A-C). Oliver King created the computational
algorithm and performed the sequence analyses (Figure 1A, Figure S11, Tables S1, S5).
Fluorescence microscopy was performed by Simon Alberti and Atul Kapila (Figures 2A-B, S2).
Chapter 3:
I performed the amyloid assembly experiments (Figures 1F, 2D, 6B-C, S4A, S5A-B, S6-7) and yeast
toxicity experiments (Figure 4B-C). Simon Alberti performed the intracellular amyloid-formation
experiments (Figures 1E, 2C, 3E, 3G, S1), experiments with Sup35C fusions (Figures 1B-D, 2B, 3B-D,
S2-3, S4B) and microscopy (Figure 4A). Rajaraman Krishnan performed the amyloid oligomer
assembly experiment (Figure 6A), aggregate fractionation (Figure 5A), and mammalian cell toxicity
experiments (Figure 5B-C, S5C). Nicholas Lyle and Rohit Pappu performed the molecular
simulations (Figure 7). Bioinformatic analyses were performed by Charles O’Donnell (Figures S8,
S9) and Oliver King (Figure S10).
Appendix A:
I devised and performed all experiments. Alex Lancaster performed the bioinformatic
investigations.
Appendix B:
I identified and characterized the prion state of Nup100 (Figures 5 and 6) and performed the
biochemical investigations in Figures 2C and 3. Jessica Wright performed the microscopy in Figures
1 and 2A, and performed the sedimentation assay in Figure 2B. Simon Alberti performed the
genetic characterizations of Sup35C fusions (Figure 4).
185
Curriculum Vitae
Randal A. Halfmann
EDUCATION
Massachusetts Institute of Technology, 2004 – 2010
Ph.D. candidate, Biology
Texas A&M University, 2000-2004
B.S., Genetics, summa cum laude
HONORS
Best poster, GSA Yeast Genetics and Molecular Biology Meeting, July 2010
National Science Foundation Graduate Research Fellowship, 2004-2007
Sigma Genosys Award for Undergraduate Research, 2004
University Undergraduate Research Fellow, 2003-2004
Honors Thesis: Improved cell cycle synchronization and chromosome doubling methods in cotton.
University Scholar, 2001-2004
Lechner Honors Scholar, 2000-2004
PUBLICATIONS
Halfmann, R.*, Alberti, S.*, Krishnan, R., Lyle, N., Pappu, R., Lindquist, S. Opposing effects of glutamine
and asparagine dictate prion formation by intrinsically disordered proteins. Submitted.
Halfmann, R., Lindquist, S. (2010). Epigenetics in the extreme: Prions and the inheritance of
environmentally acquired traits. Science 330(6004), 629-32.
Alberti, S., Halfmann, R., and Lindquist, S. (2010). Biochemical, cell biological and genetic assays to
analyze amyloid and prion aggregation in yeast. For: Guide to Yeast Genetics: Functional Genomics,
Proteomics, and Other Systems Analysis, 2nd Ed. Methods in Enzymology 470, 709-731.
Halfmann, R., Alberti, S., Lindquist, S. (2010). Prions, protein homeostasis, and phenotypic diversity.
Trends in Cell Biology 20, 125-33.
Alberti, S.*, Halfmann, R.*, King, O., Kapila, A., and Lindquist, S. (2009). S. A systematic survey identifies
prions and illuminates sequence features of prionogenic proteins. Cell 137, 146-58.
Halfmann, R. and Lindquist, S. (2008). Screening for Amyloid Aggregation by Semi-Denaturing
Detergent-Agarose Gel Electrophoresis. Journal of Visualized Experiments 17.
http://www.jove.com/index/details.stp?ID=838&sn=BID21
Douglas, P., Treusch, S., Ren, H., Halfmann, R., Duennwald, M., Lindquist, S., and Cyr, D. (2008).
Chaperone-dependent amyloid assembly protects cells from prion toxicity. Proc. Natl. Acad. Sci. USA
105, 7206-7211.
Halfmann, R., Stelly, D., and Young, D. (2007). Towards Improved Cell Cycle Synchronization and Chromosome
Preparation Methods in Cotton. Journal of Cotton Science 11, 60-67.
*These authors contributed equally.
186
SELECTED ORAL PRESENTATIONS
Futures in Biotech 57: Mechanisms Of Non-Mendelian Inheritance In Evolution. Guest speaker
for podcast on The TWiT Netcast Network, http://www.twit.tv/fib57. 6 Apr. 2010
Discovery of a large repertoire of prions in yeast: A system for evolutionary capacitance? Invited
Lecture, Brooklyn College. Brooklyn, NY. 20 Nov. 2009
High throughput protein purification using the BioRobot 8000. Invited Seminar, Boston
Automation Symposium. Cambridge, MA. 26 Sep. 2008
A systematic screen for prions in yeast. Lecture, 63th Harden Conference – Protein folding and
assembly in vitro and in vivo. Ambleside, UK. 21 Aug. 2007
RESEARCH EXPERIENCE
Whitehead Institute for Biomedical Research, 2005-present
Laboratory of Susan Lindquist, Ph.D.
• Cell and evolutionary biology of prions and prion-regulation in S. cerevisiae
• Biochemistry of amyloidogenic proteins
Texas A&M University, 2002-2004
Laboratory of David Stelly, Ph.D.
• Plant cytogenetics
• Novel techniques for cell cycle manipulation
University of Texas M.D. Anderson Cancer Center -Science Park, 2001
Laboratory of Joe Angel, Ph.D.
• carcinogenesis in a mouse model
• complex trait genetics
TEACHING EXPERIENCE
iBioSeminars (www.ibioseminars.org): 8/2009
• Authored freely available educational tools (lecture notes, questions, assignments) to
accompany Susan Lindquist’s lecture: “The Surprising World of Prion Biology – A New
Mechanism of Inheritance.”
Mentor, Undergraduate Research Opportunities Program: MIT, 2/2008 – 12/2008
• Provided guidance and training in molecular biology for a biology undergraduate
Teaching Assistant: The Protein Folding Problem, MIT, fall 2007
• Prepared and delivered lectures and accompanying assignments on protein folding experimental
techniques to undergraduate and graduate students.
Teaching Assistant: Experimental Molecular Biology: Biotechnology III, MIT, spring 2006
• Provided guidance and technical expertise for undergraduates while they developed
independent semester-long projects in a molecular biology lab
187