Cell-to-Cell Variability and Culture Conditions during Self-Renewal
Reversibly Affect Subsequent Differentiation of
Mouse Embryonic Stem Cells
by
Jit Hin Tan
Bachelor of Science in Chemical Engineering
Cornell University, Ithaca, NY, 2003
Master of Science in Chemical Engineering Practice
Massachusetts Institute of Technology, Cambridge, MA, 2004
Submitted to the Department of Chemical Engineering
in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy in Chemical Engineering Practice
at the
Massachusetts Institute of Technology
June 2013
© 2013 Massachusetts Institute of Technology
All Rights Reserved
Signature of Author………………………………………………………………………………
Department of Chemical Engineering
September 6, 2011
Certified by………………………………………………………………………………………...
Clark K. Colton
Professor of Chemical Engineering
Thesis Supervisor
Accepted
by…………………………………………………………………………………………………...
William M. Deen
Professor of Chemical Engineering
Chairman, Committee for Graduate Students
1
-Page Intentionally Left Blank-
2
Cell-to-Cell Variability and Culture Conditions during Self-Renewal Reversibly
Affect Subsequent Differentiation of Mouse Embryonic Stem Cells
by
Jit Hin Tan
Submitted to the Department of Chemical Engineering on September 6, 2011
in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy in Chemical Engineering Practice
Cell-to-cell variability in clonal populations is reflected in a distribution of mRNA and
protein levels among individual cells, including those of key transcription factors
governing embryonic stem cell (ESC) pluripotency and differentiation. This may be a
source of heterogeneity resulting in mixtures of cell types in differentiated populations
despite efforts to control the differentiation conditions and the use of a clonal starting
population. In addition, this distribution may be affected by the cell microenvironment
during self-renewal. Prior studies on self-renewal culture of ESC, however, focused on
long term proliferation and pluripotency. The effects of culture conditions during selfrenewal on the effectiveness of subsequent differentiation protocols remains
understudied.
Using a mouse ESC line harboring a GFP reporter, we examined cell-to-cell variability
in clonal undifferentiated populations and how such variability affects subsequent
differentiation. Subpopulations sorted according to their levels of Oct4-GFP expression
displayed distinctly different expression levels of pluripotency and early differentiation
markers and differentiated into cardiomyocytes at different efficiencies. However, when
allowed to self-renew after sorting, the subpopulations regenerated the parental
distributions of Oct4-GFP and subsequent differentiation after regeneration did not show
differences.
In addition to differences between cells in a clonal population, self-renewal conditions
affecting Oct4 expression on the population-level were examined. Changes in culture
conditions during self-renewal by low oxygen culture or small molecule dual inhibition (2i)
of mitogen-activated protein kinase and glycogen synthase kinase reversibly affected
levels of Oct4 expression in cells that were otherwise pluripotent. Effects of different
self-renewal conditions immediately preceding differentiation are manifested by
changes in subsequent differentiation to cardiomyocytes.
This study demonstrates that manipulation of self-renewal culture conditions can lead to
changes in the outcomes of defined differentiation protocols, a novel dimension to
explore for directed differentiation of pluripotent stem cells.
Thesis Supervisor: Clark K. Colton
Title: Professor of Chemical Engineering
3
-Page Intentionally Left Blank-
4
Acknowledgements
The single name on the front page belies the generous contributions of many, without
whom this thesis would not have been possible. When I returned to MIT for the PhD
program, a research area heavily underpinned by biology was not on my radar, due to a
lack of prior training. In spite of this, I was welcomed with open arms into the research
group by my advisor, Professor Clark Colton. As Clark mentioned during a tribute to his
graduate advisor Ed Merrill, he “did not know that a graduate student was supposed to
do the research that his advisor chooses for him”, and I am very grateful that Clark has
allowed me the same ignorance during my thesis work to explore questions of my own
choice. I must also thank the members of my thesis committee: Professor William Deen,
for his invaluable advice in navigating the ins and outs of the doctoral process, and for
reminding me of the value of my training in Chemical Engineering; Professor Rudolf
Jaenisch, whom, despite his busy schedule, never refused a meeting, and is able, in a
short discussion, to open up new horizons to explore; and Professor Narendra Maheshri,
who has been generous in his suggestions on both experiments worth doing, and
perhaps more importantly, not worth doing.
To the members of the Colton Lab – Kevin Brower, Anna Coclite, Amanda DiIenno,
Amy Johnson, Clarke Low, Michelle Miller, Jeff Millman: No one else understands the
journey we all undertake as well as all of you do, and I am extremely grateful for your
fellowship and for allowing me to commiserate during my time here. Also, I offer sincere
thanks to Kellie Young, my UROP, who remained enthusiastic despite some of the
mundane tasks I had assigned during her time with the lab. In particular, I am deeply
indebted to Jeff, who had been instrumental in showing me the ropes and also holding
long discussions on practically every aspect of my work throughout the entire time. Jeff
inspires me with his insight and enthusiasm for research, and has taught by example
hard work and perseverance in the face of fickle cell cultures and impenetrable
protocols. I leave the lab in Amanda’s very capable hands, and am confident that she
will take the research ever further. Many thanks must also go to the underappreciated
Val Grimm, our administrative assistant, who has skillfully helped me to wrangle
schedules and untangle paperwork.
I would like to thank the many facilities and laboratories who have offered assistance,
expertise and equipment that we were lacking and were essential to the completion of
this work: Dr Malgorzata Borowiak (Melton Lab, Harvard University), for providing the
Oct4-GFP mESC reporter line that made this work possible; Glenn Paradis, Michael
Jennings, and Michele Griffin of the Koch Institute Flow Cytometry Core Facility, whose
expertise and patience I have taken advantage of repeatedly; Han-Hwa Hung and Linda
Bragman of the Centre of Biomedical Engineering’s qPCR Facility for allowing me to
hog the equipment on many occasions, and T.L To, formerly of the Maheshri lab, for
generously sharing equipment and expertise in the many common biological assays
and protocols that I was regretfully short of.
As Michael Mosley opined, “Science is a human endeavor. It’s been shaped as much by
what’s outside the laboratory as inside.” To ignore the people who have been a part of
5
my life outside of research would be to ignore those who have provided an equal,
though indirect, contribution to this thesis. I have been extremely blessed to be part of
two warm and welcoming groups outside of the laboratory, who have provided safe
haven and sanity when I have needed it most, shared in the highs and provided
unquestioning support during the lows – my fellow Singaporeans, who I have subjected
to many culinary experiments and hijacked conversations steered towards research;
and the graduate community of Sidney-Pacific, who have given me free reign over the
kitchen without the obligation of responsibility. When you are away from home, your
friends become your family – as you all have. I will always be impressed and humbled
by your great achievements and diverse abilities, honest humility and generous spirits.
Sometimes things do not go according to plan, and the journey takes an unexpected
detour. Looking back, I see a path that I may not have chosen at the start, but I am
happy that I have taken, because of the people I would not have met, lessons I would
not have learnt, and experiences I would have not have gained had I not done so.
Half a world away, there are four people who continue to shower me with their
unconditional love and support - my parents, Michael and Doreen, and my siblings Jit
Quan and Michelle, who, despite not fully understanding why this process has taken me
away from home for so long, remain patient and understanding. Sometimes the most
important things are the hardest to say and I find myself at a loss for words, except
Thank you.
6
Dedicated to my parents, whose unconditional love made this possible
7
-Page Intentionally Left Blank-
8
Table of Contents
Chapter 1 Introduction ............................................................................................................................. 15
1.1
Pluripotent stem cells............................................................................................................... 15
1.2
Self-renewal and propagation in the pluripotent state ........................................................ 16
1.3
Directed differentiation............................................................................................................. 18
1.4
Cell-to-cell variability in clonal undifferentiated PSC populations ..................................... 20
1.5
Effects of oxygen on the undifferentiated phenotype ......................................................... 21
1.5.1 Derivation of new embryonic stem cell lines ...................................................................... 22
1.5.2 Pluripotency ............................................................................................................................ 23
1.5.3 Proliferation ............................................................................................................................. 26
1.5.4 Clonal recovery ....................................................................................................................... 26
1.5.5 Reprogramming ...................................................................................................................... 27
1.5.6 Control of pO2cell ..................................................................................................................... 27
1.5.7 Effects on subsequent differentiation .................................................................................. 29
1.6
Use of 2i in PSC derivation and propagation ....................................................................... 30
1.7
Objectives .................................................................................................................................. 31
1.8
Overview .................................................................................................................................... 32
Chapter 2 Cell-to-cell variability within an undifferentiated clonal population affects subsequent
differentiation of mouse embryonic stem cells ..................................................................................... 35
2.1 Abstract ........................................................................................................................................... 35
2.2 Introduction ..................................................................................................................................... 37
2.3 Methods .......................................................................................................................................... 40
2.3.1 Self-renewing culture of mESC ............................................................................................ 40
2.3.2 Cell cycle analysis .................................................................................................................. 40
2.3.3 Fluorescence-Activated Cell Sorting (FACS) of undifferentiated O4G cells ................. 41
2.3.4 Flow cytometric analysis of Oct4-GFP expression ........................................................... 41
2.3.5 Differentiation of mESC to cardiomyocytes ....................................................................... 42
2.3.6 Real-time polymerase chain reaction (PCR) ..................................................................... 43
2.3.7 Cell enumeration .................................................................................................................... 44
2.3.8 Flow cytometric analysis of MF20+ cells ............................................................................ 44
2.3.9 Statistics .................................................................................................................................. 45
2.4 Results ............................................................................................................................................ 46
2.4.1 Large cell-to-cell variability in Oct4-GFP expression in undifferentiated mESC which
corresponds to Oct4 mRNA expression ....................................................................................... 46
2.4.2 Distribution of Oct4-GFP is not entirely cell cycle dependent ......................................... 46
9
2.4.3 Levels of Oct4-GFP mark undifferentiated subpopulations with different levels of
pluripotency and early differentiation markers ............................................................................. 47
2.4.4 Populations differentiated from cells with higher initial Oct4-GFP levels had a greater
fraction and number of cardiomyocytes ........................................................................................ 47
2.4.5 Sorted subpopulations recapitulate the parental Oct4-GFP distribution when allowed
to propagate in self-renewing culture ............................................................................................ 49
2.4.6 Recapitulation of the parental Oct4-GFP distribution erases subpopulation differences
in pluripotency and early differentiation markers......................................................................... 50
2.4.7 Recapitulation of the parental Oct4-GFP distribution removes the differences in
subsequent differentiation to cardiomyocytes ............................................................................. 50
2.5 Discussion....................................................................................................................................... 52
2.6 Future Work .................................................................................................................................... 55
2.7 Tables and Figures........................................................................................................................ 56
Chapter 3 Culture oxygen levels and use of small molecule inhibitors during self-renewal
reversibly affect subsequent differentiation of mouse embryonic stem cells .................................. 68
3.1 Abstract ........................................................................................................................................... 69
3.2 Introduction ..................................................................................................................................... 71
3.3 Methods .......................................................................................................................................... 73
3.3.1 Self-renewing culture of mESC ............................................................................................ 73
3.3.2 Flow cytometric analysis of Oct4-GFP expression ........................................................... 74
3.3.3 Differentiation of mESC to cardiomyocytes ....................................................................... 74
3.3.4 Control of culture oxygen levels (pO2cell) ............................................................................ 75
3.3.5 Real-time polymerase chain reaction (PCR) ..................................................................... 75
3.3.6 Cell enumeration .................................................................................................................... 76
3.3.7 Flow cytometric analysis of MF20+ cells ............................................................................ 76
3.3.8 Estimation of spontaneously contracting areas ................................................................. 77
3.3.9 Statistics .................................................................................................................................. 77
3.4 Results ............................................................................................................................................ 78
3.4.1 Self-renewal of mESC at low oxygen reduces expression of Oct4-GFP but does not
increase rates of spontaneous differentiation .............................................................................. 78
3.4.2 Reduction of Oct4-GFP expression by low oxygen culture is reversed by continued
self-renewal in 20% oxygen............................................................................................................ 78
3.4.3 Low oxygen preconditioning decreases subsequent differentiation of mESC to
cardiomyocytes ................................................................................................................................. 79
3.4.4 Total cell number and fraction of residual undifferentiated Oct4-GFP+ cells are not
affected by preconditioning, but by oxygen conditions during differentiation ......................... 80
3.4.5 Reduction in efficiency of cardiomyogenesis due to low oxygen preconditioning is
reversible by self-renewal in 20% oxygen before differentiation .............................................. 81
10
3.4.6 2i use during self-renewal increases expression of naïve pluripotency markers,
decreases early differentiation markers synergistically with high oxygen, and is reversible
by subsequent self-renewing culture without 2i........................................................................... 82
3.4.7 High oxygen and 2i use during preconditioning separately, synergistically, and
reversibly increases subsequent differentiation to cardiomyocytes ......................................... 84
3.4.8 Fraction of MF20+ cells in differentiated populations correlates positively with mean
Oct-GFP levels of the starting populations................................................................................... 86
3.5 Discussion and future work .......................................................................................................... 88
3.6 Figures ............................................................................................................................................ 91
Chapter 4 Integrative Perspective Paper: Opportunities and Obstacles in the Commercialization
of Pluripotent Stem Cell-Based Products and Services ................................................................... 114
4.1 Executive Summary .................................................................................................................... 115
4.2 Introduction ................................................................................................................................... 116
4.3 Pluripotent Stem Cell Research and Diagnostic Consumables and Equipment ............... 117
4.4 Pluripotent Stem Cell-Derived Tools for Disease Modelling, Drug Discovery, and
Toxicology ........................................................................................................................................... 120
4.5 Replacement Cell Therapies Derived from Pluripotent Stem Cells ..................................... 124
4.6 Discussion..................................................................................................................................... 130
References .............................................................................................................................................. 132
11
-Page Intentionally Left Blank-
12
List of Figures
Figure 2-1 Characterization of Oct4-GFP (O4G) mESC reporter line demonstrates large cell-tocell variability in Oct4-GFP expression which corresponds to Oct4 mRNA levels ......................... 56
Figure 2-2 Oct4-GFP variability cannot be explained by differences in cell cycle stage .............. 57
Figure 2-3 Real-time PCR analysis of sorted O4G mESC subpopulations reveal that levels of
Oct4-GFP mark undifferentiated subpopulations with different levels of pluripotency and early
differentiation markers ............................................................................................................................. 58
Figure 2-4 Populations differentiated from cells with higher initial Oct4-GFP levels had a greater
fraction and number of cardimyocytes .................................................................................................. 60
Figure 2-5 Oct4-GFP fluorescence distributions of sorted subpopulations cultured in selfrenewing conditions for up to 30 days after initial sorting demonstrate recapitulation of the
parental Oct4-GFP distribution over time. ............................................................................................ 62
Figure 2-6 Time course of mean Oct4-GFP fluorescence of the subpopulations relative to the All
subpopulation............................................................................................................................................ 63
Figure 2-7 Effects of regeneration of parental Oct4-GFP expression on gene expression of
subpopulations.......................................................................................................................................... 64
Figure 2-8 Recapitulation of the parental Oct4-GFP distribution removes the differences in
subsequent differentiation to cardiomyocytes...................................................................................... 66
Figure 3-1 Effects of culture O2 in self-renewing culture on distributions of Oct4-GFP expression
in O4G mESC. .......................................................................................................................................... 91
Figure 3-2 Mean Oct4-GFP fluorescence and fraction of Oct4-GFP+ cells from self-renewal at
different O2. ............................................................................................................................................... 92
Figure 3-3 Effects of O2 preconditioning on subsequent differentiation. ......................................... 94
Figure 3-4 Effects of O2 preconditioning on total cell number and fraction of residual Oct4-GFP+
cells after differentiation. ......................................................................................................................... 96
Figure 3-5 Reversibility of O2 preconditioning. .................................................................................... 97
Figure 3-6 Correlation between mean Oct4-GFP fluorescence of the starting undifferentiated
populations and the fraction of MF20+ cells in the resulting differentiated populations................ 99
Figure 3-7 Experimental design and nomenclature for preconditioning with O2 modulation and 2i
supplementation. .................................................................................................................................... 100
Figure 3-8 Effects of 2i supplementation and O2 during self-renewal on Oct4-GFP fluorescence
distributions of undifferentiated mESC. .............................................................................................. 101
Figure 3-9 Effects of 2i supplementation and culture O2 on mean Oct4-GFP fluorescence and
fraction of Oct4-GFP+ cells during self-renewal................................................................................ 102
Figure 3-10 Effects of 2i supplementation and culture O2 on gene expression of mESC after 18
days in self-renewing culture. ............................................................................................................... 104
Figure 3-11 Effects of 2i supplementation and culture O2 on gene expression of mESC after 24
days in self-renewing culture. ............................................................................................................... 106
Figure 3-12 Effects of 2i supplementation and culture O2 on subsequent differentiation after 18
days of preconditioning. ........................................................................................................................ 108
Figure 3-13 Effects of 2i supplementation and culture O2 on subsequent differentiation after 24
days of preconditioning. ........................................................................................................................ 109
13
Figure 3-14 Correlation between the fraction of MF20+ cells in the resulting differentiated
populations for cells preconditioned for 18 (red triangles) and 24 days (blue circles) before
differentiation and the mean Oct4-GFP fluorescence of the starting undifferentiated populations.
Cells were differentiated at 20% O2. For cells preconditioned for 18d, <R2>= 0.63; for cells
preconditioned for 24d, <R2>= 0.93, both from a linear least squares regression....................... 111
Figure 3-15 Linear and semi-log correlations between mean Oct4-GFP fluorescence of starting
undifferentiated populations and the fraction of MF20+ cells in the resulting differentiated
populations for all cells differentiated at 20% O2. .............................................................................. 112
Figure 3-16 Model fit for correlation between mean Oct4-GFP fluorescence of starting
undifferentiated populations and the fraction of MF20+ cells in the resulting differentiated
populations for all cells differentiated at 20% O2. .............................................................................. 113
14
Chapter 1 Introduction
1.1 Pluripotent stem cells
First isolated from mouse [1], then more recently human blastocysts [2], pluripotent
embryonic stem cells (ESC) have the ability to self-renew in the undifferentiated state
indefinitely and differentiate into all cell types of the adult organism. They hold immense
clinical and research potential for drug screening, disease modeling, as a model to
study mammalian development, and to generate replacement cells for application in
regenerative medicine [3–9]. Cardiomyocytes [10], bone marrow [11], dopamine
neurons [12], and β-cells [13] have been differentiated from ESC as potential therapies
for cardiac infarctions, leukemia, Parkinson’s disease, and diabetes respectively. Other
studies have also demonstrated the ability to generate self-organized tissues [14] and to
perform gene and cell therapy using ESC [15].
The discovery of another source of pluripotent cells, induced pluripotent stem cells
(iPSC) [16–18] gave further hope for personalized therapies by autologous
transplantation of cells and tissues differentiated from iPSC derived from the patients
themselves [19], and for recapitulation of disease development by generating disease
specific iPSC [20], in addition to all of the potential applications of ESC [21–25]. iPSC
and ESC have shown similar potential to differentiate into cell types of interest and fulfill
other criteria for pluripotency [26–28], however, some differences remain [29].
For pluripotent stem cells (PSC) of both types, many obstacles remain before their
immense potential can be fulfilled. This includes removing the danger of tumorigenicity
15
of residual undifferentiated cells [30], immunogenicity of the transplanted cells [31], the
development of methods for propagation in their undifferentiated state, and efficient
protocols for directed differentiation in order to generate sufficient numbers and purities
of the desired cell types [32].
1.2 Self-renewal and propagation in the pluripotent state
In order to generate sufficient numbers of cells, PSC can be propagated in their
undifferentiated state until differentiation is initiated. For mouse ESC (mESC), this is
usually accomplished by either co-culture on mouse embryonic fibroblasts (MEFs) or
the addition of leukemia inhibitory factor (LIF) [33], a cytokine which acts by activating
the JAK-STAT3 pathway [34]. Human ESC (hESC) can be kept in the pluripotent state
by culture medium supplemented with basic Fibroblast Growth Factor (bFGF) [35] on a
layer of various feeder cells [36] or an animal-derived protein matrix [37], although
recently a fully defined self-renewal culture system has been discovered [38].
The main concern of undifferentiated PSC culture is to ensure the maintenance of the
pluripotent state and prevent spontaneous differentiation while sustaining normal
karyotype and cell viability. To do so, it must support the highly complex cellular
machinery for maintaining pluripotency that is underpinned at its core by three
pluripotency genes – Oct4, Sox2, and Nanog [39–43]. Disruption of these core
transcription factors caused spontaneous differentiation of PSC and loss of the
pluripotent state.
16
An ectopic increase in Oct4 expression in mESC directed spontaneous differentiation
down the mesodermal lineage [44, 45] while a decrease in Oct4, or increase in Cdx2
expression relative to Oct4, directed differentiation to trophectoderm [45, 46]. Similar
behavior occurred in hESC with an ectopic decrease in Oct4 expression resulting in
spontaneous differentiation to ectoderm and mesoderm, while an ectopic increase
caused differentiation to endoderm [47]. Both Oct4 and Sox2 determine germ layer fate
decisions during early differentiation in opposite directions, with Oct4 promoting
differentiation down the mesodermal and endodermal lineages, while Sox2 promoted
differentiation down the ectodermal lineage, and each suppressed the promoted lineage
of the other [48]. Expression of Nanog prevented differentiation, and mESC can exhibit
transient down-regulation of Nanog expression. This down-regulation has been
hypothesized to generate a necessary intermediate state between maintaining
pluripotency and differentiation [49, 50]. In hESC, Nanog affected cell fate choice, with
an extended expression of Nanog during differentiation leading to increased
mesendodermal specification [51].
Recent studies demonstrated that multiple metastable pluripotent states for PSC exist
as distinct subpopulations within a clonal population. In addition to Nanog, Rex1 [52]
and Stella [53] are also heterogeneously expressed in mESC. These subpopulations
were able to reversibly interconvert when the population was kept in conditions
supporting self-renewal of the pluripotent state. Given that the culture conditions that
maintain pluripotency can also affect the transition of mESC between the different
pluripotent states, and that pluripotency factors can specify differentiation to different
17
cell fates [48, 54], it is thus important to assess the effects of the self-renewal conditions
on PSC and on the efficiency of subsequent differentiation to different lineages. Two
aspects in particular – culture oxygen levels, and the use of small molecule inhibitors
supporting undifferentiated culture – are discussed in greater detail in sections 1.5 and
1.6.
1.3 Directed differentiation
The design of directed differentiation protocols for pluripotent stem cells has employed
many different strategies to enrich the resulting differentiated population with the
desired cell type [55, 56]. To direct differentiation to cardiomyocytes from both mouse
and human PSC [57], for example, protocols have included the use of growth factors
such as Activin or Nodal and BMP4 [58], the use of small molecules 5-aza-2’deoxycytidine [59] or ascorbic acid [60], genetic manipulation to ectopically express a
cytokine, TNF-α [61], co-culture with a visceral endoderm-like cell line (END-2) [62], or,
most recently, synthetic mRNA transfection [63]. Combinations of techniques, such as
the addition of stauprimide with Activin A for directed differentiation to definitive
endoderm [64], or the step-wise protocol of sorting Flk1+ cells differentiated from
miPSC, then co-culturing the purified intermediate population on OP9 stroma cells to
obtain cardiomyocytes [65], have also been documented.
The designs of directed differentiation protocols have grown in sophistication, inspired in
part by insights from developmental biology. Strict temporal control of the cellular
microenvironment in order to mimic developmental cues, optimizing concentrations of
18
growth factors (Activin A for example, can induce both endodermal and mesodermal
specification depending on concentration), and optimizing levels of growth factors
depending on the stage of differentiation have yielded success [13, 58, 66]. The focus,
however, has been predominantly on the time period and process during which the cells
are already differentiating, and much remains unknown about how the culture conditions
before the initiation of differentiation affects the cells subsequently. This is in spite of the
many studies (summarized above in section 1.2) showing that pluripotency factors,
which are highly active when PSCs are in their undifferentiated state, can play roles in
specifying cell fate during differentiation.
The focus of this thesis is on cell-to-cell variability (population heterogeneity), culture
oxygen levels, and the use of small molecules during self-renewing culture on
subsequent differentiation. It examines the relationship between starting undifferentiated
state of the ESC and the resulting differentiated population, an aspect of self-renewal
that has not received much attention. Experiments on cell-to-cell variability examine
differences between clonal undifferentiated cells within a population, while studies
combining culture oxygen levels and the use of small molecules in self-renewal culture
examine their effects on self-renewal and the efficiency of subsequent directed
differentiation of undifferentiated populations as a whole. More detailed treatments of
these topics follow.
19
1.4 Cell-to-cell variability in clonal undifferentiated PSC populations
Cell-to-cell variability or cellular heterogeneity in clonal populations has received
increasing attention with the development of methods to measure characteristics of
single cells, rather than traditional methods yielding population-averaged results.
Studies showing heterogeneity in single mammalian cells of a clonal population in
mRNA [67, 68] and protein levels [69] that can have important biological functions
suggest that traditional ensemble measurements insufficiently capture the
characteristics of single cells [70, 71].
Numerous studies have reported heterogeneity in clonal stem cell populations that
correlate with differences in subsequent cell fate choice. Hematopoietic stem cells have
transcriptome-wide differences in subpopulations sorted by expression of a surface
antigen, Sca-1, despite being clones generated from a single cell [72], and levels of
Sca-1 correlated to differentiation efficiencies to different cell lineages. Within clonal
populations of mESC, there were heterogeneities in expression of Nanog [50], Rex1
[52], and Stella [53], all normally associated with pluripotency, and in an early
endodermal marker Hex [73]. Subpopulations exhibiting high or low levels of expression
of these genes exhibited different differentiation proclivities when allowed to differentiate.
Levels of these genes in mESC allowed to self-renew in the undifferentiated state,
however, are dynamic, and single cells can switch between high and low levels of
expression. In both human ESC and iPSC, heterogeneities occurred in mRNA levels of
multiple genes, although single hiPSC exhibited higher levels of heterogeneity than
hESC [74]. The multitude of metastable pluripotent states has led to a proposal that
20
pluripotency is not a set of distinct states, but instead a continuum of states [75]. This
heterogeneity, however, is viewed as undesirable in directed differentiation protocols
because it can lead to heterogeneity in the differentiated population, which can be
detrimental to the production of clinically useful cells and tissues [76].
Cell-to-cell variability in mRNA expression levels can occur due to gene expression
noise, arising from transcription occurring in bursts, rather than at a continuous steady
rate [68, 77, 78]. Together with a positive feedback loop, for example, a gene that
activates its own transcription, such stochastic gene expression is able to generate
stable distinct phenotypes [79]. Many theories have been put forward to describe the
mechanisms behind such cell-to-cell variability, and it has been proposed that the large
interconnected network of genes and epigenetic states in mammalian systems, together
with transcriptional noise, create multiple stable gene expression profiles that clonal
single cells may inhabit [80]. More importantly, as evidenced by effects on subsequent
differentiation of cells in different “states”, such cell-to-cell variability can have important
developmental functions.
1.5 Effects of oxygen on the undifferentiated phenotype
Adapted and updated from Millman, J.R., J.H. Tan, and C.K. Colton, The effects of low
oxygen on self-renewal and differentiation of embryonic stem cells. Current Opinions in
Organ Transplantation, 2009. 14(6): p. 694-700 with permission from Lippincott Williams
& Wilkins
21
One aspect of the culture microenvironment that has mostly been ignored in
conventional cell culture is the oxygen partial pressure experienced by the cells. All cells
of the developing embryo are exposed to oxygen levels in vivo far below that of
atmospheric levels, and they differentiate and undergo organogenesis in a low oxygen
environment [81–87]. The local oxygen environment is potentially an important variable
for manipulation by researchers hoping to recapitulate specific differentiation pathways
in vitro.
Mammalian cellular responses to oxygen levels are predominantly mediated by Hypoxia
Inducible Factors (HIFs), a family of heteromeric transcription factors. HIF-α subunits
are constitutively expressed but are post-translationally regulated through rapid
degradation in the presence of oxygen levels higher than 5% [88–90]. The HIF-1β
subunit (also known as the aryl hydrocarbon receptor nuclear translocator or ARNT) is
oxygen insensitive, but is only active as a transcription factor when dimerized with the
appropriate stabilized HIF-α subunit under sufficient cellular hypoxia. The mammalian
hypoxic response includes up-regulation of a large number of genes, including the
vascular endothelial growth factor (VEGF), the adipose differentiation related protein
(ADRP), and RTP801, which is known to be regulated in development, amongst others
[91].
1.5.1 Derivation of new embryonic stem cell lines
Derivation of new ES cell lines, both mouse [92, 93] and human [38, 94], benefit from
being performed in low oxygen levels. Studies examining the establishment of new ES
22
cell lines from blastocysts under 5% oxygen have had greater success than under the
20% more commonly used. The benefits of low oxygen conditions included an increase
in the number of individual colonies exhibiting alkaline phosphatase activity [93], an
increase in the number of proliferating cells [92], and removal of the need for undefined
animal-derived products such as serum or matrices in the process [38], the last of which
can be crucial in the applicability of these derived cells to clinical applications. Most
recently, it has been found that maintenance of constant low oxygen during derivation of
hESC enables the establishment of pre-X inactivated cells, which are similar to mESC,
and exposure to 20% oxygen or oxidative stress irreversibly causes X inactivation [94].
1.5.2 Pluripotency
Low oxygen affected the pluripotent phenotype of mESCs when they were cultured with
LIF [33]. Normally, mESC colonies have smooth edges, but this morphological
phenotype was lost with low oxygen exposure, instead causing the colonies to have
fibroblast-like morphologies [95] or to form jagged edges [96], both signs of early
differentiation despite the presence of LIF. These morphological changes were also
associated with reduced levels of alkaline phosphatase activity and pluripotency gene
(Oct4, Nanog, and Sox2) expression [95, 96]. One study [95] proposed that HIF-1α
protein, the concentration of which increases at low oxygen, mediated suppression of
the LIF-STAT3 pathway as evidenced by a reduction in the expression of the LIF
receptor under hypoxia. Interestingly despite these observations, the cells maintained
some potential to differentiate into cells of all three germ layers [96].
23
In contrast to mESCs, expression of Oct4, Nanog, and Sox2 in hESCs were apparently
not affected by hypoxic culture (2% to 5% oxygen) [94, 97, 98]. In one study, however,
Nanog and Notch1 mRNA expression increased in hESCs cultured over a four-week
period at 5% oxygen compared to those cultured under 20% oxygen. This difference
was not maintained after long term culture under the hypoxic condition, since there was
no significant difference in Nanog and Notch1 mRNA levels between cells cultured for
18 months under either 5% or 20% oxygen. Consistent with earlier results, no
differences in Oct4 expression were observed under both oxygen conditions with either
short or long term culture [99]. However, a recent report showed down-regulation of
Oct4, Nanog and Sox2 in HIF-2α silenced hESC, together with reduced proliferation
[100].
Hypoxic culture resulted in wide-spread transcriptome differences in hESCs when
compared to culture under ambient oxygen conditions, including downstream targets of
the core pluripotency network Oct4, Nanog, Sox2. Genes marking early differentiation to
all cell lineages were upregulated at 20% oxygen [94, 98]. In addition, Lefty2, a member
of the TGFβ family of proteins, which is hypothesized to play a role in preventing
differentiation, was down-regulated at 20% oxygen compared to culture at 4% [98]. This
may lead to a greater proclivity for the hESC to differentiate. In studies on the
transcriptome-wide effects of hypoxic culture on hESCs kept under self-renewing
conditions, culture at 20% O2 resulted in greater heterogeneity amongst different hESC
lines than when cultured under hypoxic (2-4% oxygen) conditions [101]. This
24
heterogeneity may arise from subpopulations of cells already undergoing early
differentiation when cultured at 20% oxygen.
While low oxygen appears not to affect pluripotency gene expression directly,
differentiated areas of each colony expressing SSEA-1, a marker of early differentiation
for hESCs, were reduced when cultured under 3% and 1% oxygen compared to culture
under 20% oxygen [102]. In a different study, however, culture at 2% oxygen did not
affect expression of either SSEA-4 or SSEA-1 in hESCs when compared to ambient
oxygen conditions [97].
HIF-1α has been investigated as an important gene mediating ESC hypoxic response.
One study [103] suggests a possible link connecting HIF-1α action with Notch signaling.
In mouse embryonic teratocarcinoma cells and neural stem cells, hypoxia allowed for
the accumulation of HIF-1α, which stabilized the Notch intracellular domain, in turn
promoting the undifferentiated phenotype. The action of Notch in promoting self-renewal
appears to be conserved in hESCs in view of a recent demonstration that self-renewal
is mediated by activation of the Notch pathway and that benefits of hypoxic culture were
eliminated with inhibition of Notch signaling [99]. Interestingly, although another
hypoxia-inducible factor in the same family as HIF1α, HIF-2α has not been shown to be
active in mESC [91], other studies have shown that it is the HIF-2α heterodimer and not
HIF-1α that can induce transcription of Oct4 [104], providing a potential link between
culture oxygen levels and pluripotency gene expression in ESC. Several studies
suggested that the hypoxic response mediated by HIF-1α is transient and not sustained
25
with chronic hypoxia or normoxia [94, 99]. However, it is the HIF-2α response that may
influence pluripotency gene expression after long-term continuous culture under hypoxic
conditions [100].
1.5.3 Proliferation
Many studies have found that low oxygen affects proliferation, but this effect varied
between studies and cell lines. In one study [93], proliferation of mESCs increased
under 5% compared to 20% oxygen, while in another [96], no difference was observed
in one cell line and a small increase in another. Culture at 1% oxygen or lower, however,
reduced the rate of proliferation compared to 20% [95, 96]. mESCs were able to adapt
and continue to proliferate under anoxia, albeit with a longer doubling time compared to
20% oxygen, and had the ability to utilize anaerobic respiration exclusively for their
energy requirements [96]. Similarly disparate results have been reported for hESCs: In
one study, proliferation rates at 5% oxygen were reduced compared to 20% [99], in
another, no differences in the rates were observed at 5% and 3% and only a slight
reduction at 1% [102]. A conflicting recent report showed that low oxygen culture
increased proliferation of hESC [100].
1.5.4 Clonal recovery
Low oxygen culture improved clonal recovery after passaging. mESCs passaged at 5%
oxygen [34] and hESCs at 2% [101, 105] had improved clonal survival. Cytogenetic
instability at high passages for mESCs was not reduced in culture at 5% oxygen [92],
and further reductions in oxygen to even 0% did not affect the amount of oxidative DNA
26
damage incurred by the cells [96]. In contrast for hESCs, 2% oxygen reduced
chromosomal abnormalities after multiple passages [101], suggesting a further benefit
of hypoxic culture.
1.5.5 Reprogramming
Moderate hypoxic conditions improved reprogramming of somatic cells to iPSC for both
mouse and human lines. Performing reprogramming at 5% oxygen increased the
number of iPSC colonies generated over both 20% and 1% oxygen conditions [106]. It
is possible that this increase in reprogramming efficiency may be due to increased
proliferation under 5% oxygen, as reprogramming is a stochastic process that can be
accelerated by increasing rates of cell division [107].
1.5.6 Control of pO2cell
Most of the studies reviewed in this section implicitly make the assumption that the
oxygen levels in the bulk gas phase (pO2gas) was equal to the actual levels of oxygen
experienced by the cell (pO2cell). However, pO2cell can differ drastically from
pO2gas,depending on the cell density, medium height, cellular oxygen consumption rate,
and oxygen permeability of the culture substrate [108]. Furthermore, step changes in
pO2gas due to removal of culture dishes from the incubators may result in transient
changes in pO2cell with long time scales for equilibration. These problems are
ameliorated by culturing the cells on the surface of a membrane with very high oxygen
permeability, such as silicone rubber.
27
Differences in pO2cell between different experiments carried out at the same pO2gas
provide a possible explanation for the inconsistencies in data reported. For instance,
one study [99] reported reduced proliferation of hESCs cultured at 5% oxygen, and
another [102] reported no reduction in proliferation at the same oxygen condition. In the
first study, there were four weeks between passages (initial and final cell numbers not
reported). In the second study, 6x105 cells were plated per well of standard six-well
tissue culture plates, and there were only two weeks between passages, with final cell
numbers of 1.5-2.5x106 cells per well. It is possible that the pO2cell of the first study was
significantly lower than the pO2gas because of higher cell densities, in particular after
extended culture without passage, while pO2cell in the latter study was closer to pO2gas.
This would help explain the differences in results because the authors of the second
study report a reduced proliferation at 1% gas phase oxygen level, which may be closer
in cellular oxygen level to the 5% gas phase oxygen level of the first study that also
demonstrated a reduced proliferation rate. Moreover, the first group used the Xvivo
system (BioSpherix, Lacona, NY), which allowed for continuous culture low pO2gas
without interruption for media changes and passaging. The second group used a
conventional sealed chamber from which cells were periodically removed for media
changes and passaging, allowing for periods where pO2gas is at ambient levels,
disrupting the low pO2cell conditions. Without information regarding the experimental
conditions, especially the media heights and cell densities, it is impossible to draw any
conclusions.
28
The lack of recognition that pO2cell is often different from pO2gas, sometimes by a
substantial amount, is exacerbated because values of cell density and media height
necessary for retrospective estimation of pO2cell are often not reported. Knowledge of
pO2cell is necessary for interpreting the results of studies and comparing them to data
from other studies. Efforts to estimate or control pO2cell are essential for rational
advancement of this field.
1.5.7 Effects on subsequent differentiation
Given that low oxygen partial pressure (pO2) is an important physiological cue during
development [109], it is not surprising that low pO2 during differentiation markedly
influences resulting cell fates [110–116]. One example is the increase in fraction and
number of cardiomyocytes by low oxygen culture during the first 6 days of differentiation
[117]. However, despite the many studies on the effects of oxygen levels employed
during self-renewal culture, its effect on subsequent differentiation of PSC is largely
unknown. A naïve hypothesis based on the previous two observations may be that
since low oxygen is beneficial to cardiomyogenesis in early differentiation, low oxygen
culture during self-renewal immediately before differentiation would have a synergistic
positive effect as well. Given the effects of oxygen levels on self-renewal culture, it is
important to study the effects of modulating oxygen on subsequent differentiation, since
it is the differentiated cells that are of therapeutic importance.
29
1.6 Use of 2i in PSC derivation and propagation
Small molecules that are able to target specific signaling pathways or proteins have
been invaluable in advancing stem cell culture. They allowed for defined conditions and
media to be used in the generation, propagation, and differentiation of the desired cell
types [118]. In particular, this thesis focuses on the use of a pair of small molecule
inhibitors – PD0325901, a Mitogen-Activated Protein Kinase (MEK) inhibitor [119], and
CHIR99021, a Glycogen Synthase Kinase 3β (GSK3β) inhibitor [120], together known
as ‘2i’ [121].
PD0325901 acts as a MEK1/2 inhibitor that prevents the phosphorylation of ERK1/2, a
kinase that can activate transcriptional activity associated with activation of the RTK
(Receptor Tyrosine Kinase) signal transduction pathway associated with the Fibroblast
Growth Factor (FGF). CHIR99021 acts as a GSK3β inhibitor that mimics the activation
of the canonical Wnt pathway. Activation of the Wnt pathway or application of
CHIR99021 prevents the degradation of β-catenin and allows for its translocation to the
nucleus, dimerization with LEF/TCF, and subsequent transcriptional activity [122].
2i was first identified as a replacement for LIF to allow for undifferentiated propagation
of mESC [34]. It improves the efficiency of reprogramming of mouse iPSC to the naïve
state when used together with LIF [121]. Along the same vein, 2i use in culture of
mouse epiblast stem cells (mEpiSC), considered a “primed” state of pluripotency, can
convert the cells to a “mESC-like” naïve state [123]. More recently, 2i, when used with
ectopic gene expression, LIF, and Forskolin, is able to convert hESC to become a naïve
30
LIF-responsive state [124]. Furthermore, a cocktail of 2i with PD173074, a Fibroblast
Growth Factor Receptor (FGFR) inhibitor, and Y27632, a Rho Kinase (ROCK) inhibitor,
was able to maintain the undifferentiated state of hESC without feeder cells with singlecell passaging [125].
The increasing use of highly specific small molecules in defined stem cell culture, in
particular, in propagating undifferentiated cells, raises the question about their
downstream effects on subsequent differentiation of the cells. Studies have shown
effects on expression of core pluripotency genes including Oct4, which affect cell fate
during differentiation. It is thus not inconceivable that small molecule use during selfrenewal would have effects on cell fate after subsequent differentiation.
1.7 Objectives
In order for PSC to fulfill their immense clinical and research potential, there must exist
efficient methods for directing differentiation to the desired cell types. Two aspects that
have been largely ignored have been differences within a clonal population that may
exist due to cell-to-cell variation, and differences between clonal populations that have
been subjected to different culture conditions that support undifferentiated PSC selfrenewal but may manifest differences in subsequent differentiation. The central
hypothesis behind this thesis is that the starting “state” of a mESC affects the resulting
cell fate after subsequent differentiation, despite using undifferentiated mESC from the
same cell line that were also subjected to the same differentiation protocol. The
objectives of this research were to identify effects of cell-to-cell variability and self-
31
renewing culture conditions (including culture oxygen levels and the use of small
molecule inhibitors) immediately before the initiation of differentiation on the efficiency of
established directed differentiation protocols in order to further improve them. This
research would establish a novel dimension to explore in the design of future directed
differentiation protocols.
1.8 Overview
Chapter 2: Cell-to-cell variability within an undifferentiated clonal population affects
subsequent differentiation of mouse embryonic stem cells
This chapter describes the effects of differences within cells of an undifferentiated
population of mESC, specifically Oct4 expression in single cells, on their efficiency of
subsequent differentiation to cardiomyocytes. Using a mESC line harboring a GFP
reporter driven by the Oct4 distal enhancer, subpopulations of mESC with high, medium,
or low Oct4-GFP levels were sorted by FACS and assessed for pluripotency and early
differentiation markers. Sorted cells were differentiated immediately or allowed to selfrenew before subsequent differentiation. (1) Differentiation immediately after sorting
examined the effects of the initial levels of Oct4 expression on the differentiated cell fate;
(2) self-renewal after sorting examined if the subpopulations are stably distinct or if the
differences are transient; and (3) differentiation after the subpopulations have been
allowed to self-renew examines if subpopulations with different differentiation
efficiencies as found in (1) could be stably isolated and propagated. Differentiated cells
were assessed for fractions of residual undifferentiated Oct4-GFP+ cells,
32
immunostained with MF20 antibodies for presence of sacromeric myosin heavy chain,
and assessed for cardiac gene expression by qRT-PCR.
Chapter 3: Culture oxygen levels and use of small molecule inhibitors during selfrenewal reversibly affect subsequent differentiation of mouse embryonic stem cells
This chapter describes the effects of culture oxygen levels and use of a small molecule
inhibitor cocktail (‘2i’) during self-renewal (termed ‘preconditioning’) on subsequent
differentiation of mESC. mESC were kept in undifferentiated culture with strict control of
cellular oxygen levels using silicone rubber membrane-based culture plates in
conditions of 20%, 5%, or 1% oxygen, with or without addition of 2i in LIF supplemented
medium. Cells self-renewed under different conditions were assessed for levels of Oct4GFP expression and gene expression of pluripotency and early lineage markers. Cells
were subsequently differentiated and assessed for efficiency of differentiation to
cardiomyocytes by immunostaining for sacromeric myosin heavy chain protein, qRTPCR assessment of cardiac gene expression, and semi-quantitative assessments of
spontaneously contracting cells. In addition, the reversibility of different preconditioning
effects was examined – for cells that received low oxygen preconditioning, further selfrenewal at 20% oxygen before differentiation; and for cells that received 2i
supplementation during the initial 9 day preconditioning, further self-renewal without 2i
supplementation before differentiation. In addition, the synergistic effects of combining
preconditioning that produces the most efficient differentiation to cardiomyocytes with
low oxygen during differentiation that has previously been shown to improve
33
differentiation were examined. Finally, a mathematical model describing the relationship
between the fraction of cardiomyocytes in the differentiated populations with the initial
mean Oct4-GFP levels was developed.
34
Chapter 2 Cell-to-cell variability within an undifferentiated clonal
population affects subsequent differentiation of mouse embryonic
stem cells
2.1 Abstract
Differentiation of embryonic stem cells (ESC) typically results in a mixture of cell types
despite use of a clonal starting population of genetically identical undifferentiated cells
and of efforts to control the culture microenvironment. One cause may be cell-to-cell
variability in gene expression, which results in a distribution of mRNA and protein levels,
including those of key transcription factors governing ESC pluripotency and
differentiation. Here we investigate how different levels of Oct4 expression resulting
from cell-to-cell variation in a clonal undifferentiated population of mouse ESC (mESC)
affect their proclivities to differentiate into cardiomyocytes, chosen here as a model
system. Using a mESC line harboring a GFP reporter driven by the distal Oct4
enhancer, we found large cell-to-cell variability in Oct4-GFP expression in a clonal
population of undifferentiated cells. These differences could not be attributed to cell
cycle variation alone. Subpopulations with different levels of Oct4-GFP exhibited large
differences in expression of pluripotency and early differentiation markers.
Subpopulations sorted through FACS with higher starting Oct4-GFP levels differentiated
into populations with greater fractions and numbers of cardiomyocytes. However, if the
sorted populations were allowed to self-renew, they recapitulated the parental
distribution of Oct4-GFP expression over a time period measured in days, and this
erased the differences in expression of pluripotency and early differentiation markers
35
found immediately after sorting. Sorted populations that were allowed to recapitulate the
parental Oct4-GFP distribution before subsequent differentiation did not exhibit
differences in the resulting differentiated populations. These results indicate that cell-tocell variation within a clonal population during self-renewal prior to differentiation of
mESC can affect the outcome of differentiation.
36
2.2 Introduction
Pluripotent stem cells (PSC), including embryonic stem cells (ESC) and induced
pluripotent stem cells (iPSC), with their ability to differentiate into all cell types of the
adult organism, have enormous potential as a source of replacement tissue for
regenerative medicine [4, 24], for studying disease development [22], and for drug
screening [126]. One of the main obstacles to their successful application, however, is
the need to produce sufficient quantities and purities of viable terminally differentiated or
progenitor cells of the desired type [5].
Differentiation of PSC in vitro typically results in a heterogeneous mixture of different
cell types [49], despite a starting population of genetically-identical cells and efforts to
control the culture microenvironment. Prior studies on directing differentiation of PSC
have focused on the process of differentiation, with much effort going to optimizing
cellular microenvironments during differentiation [127]. However, heterogeneity in the
resulting differentiated cells may have been caused by cell-to-cell variability in the
undifferentiated population, even before differentiation had been initiated. This cell-tocell variability manifests as a distribution of mRNA and protein levels, including those of
key transcription factors governing ESC pluripotency and differentiation.
Indeed, this has shown to be true in clonal hematopoietic stem cells which exhibit cellto-cell transcriptome-wide differences and also correspondingly different proclivities to
differentiate into different cell lineages [72]. Studies with ESC have shown that there is
heterogeneous expression of Nanog within a clonal undifferentiated population, and its
37
transient down-regulation allows for cells to differentiate [49], [50]. More recently,
heterogeneous expression of Rex1 and Stella have also been shown in mESC, and
mESC when kept in the undifferentiated state, can interconvert between Rex1+ and
Rex1-, and Stella+ and Stella- states. More significantly, when these subpopulations are
differentiated, Oct4+/Rex1- mESC showed increased efficiency in differentiation to
somatic cells of mesodermal and ectodermal lineages, while Oct4+/Rex1+ mESC
differentiated more efficiently to primitive endoderm [52]. Similarly, Oct4+/Stella/Pecam- mESC showed increased efficiency in neuronal and trophectodermal
differentiation compared to Oct4+/Stella+/Pecam+ mESC [53].
Prior studies have noted the role of Oct4 in fate choice in differentiating ESC. Ectopic,
quantitative increases or decreases in expression of Oct4 control lineage commitment
[45, 46, 128]. In addition, the interplay of Oct4, Sox2 and Sox17 during early
differentiation affects hESC differentiation to cardiomyocytes [129]. Finally, upon
initiation of differentiation, Oct4 and Sox2 play significant roles in germ layer
determination [48].
Here, we investigate how different levels of Oct4 expression resulting from cell-to-cell
variation at the initiation of differentiation of a clonal mouse ESC (mESC) population
affect their proclivities to differentiate into cardiomyocytes, chosen here as a model
system. We use a transgenic mESC reporter line harboring a GFP sequence driven by
the Oct4 distal enhancer, active in the naïve pluripotent state [130, 131], to allow for
non-invasive measurements of Oct4 expression levels. We also study the behavior of
38
subpopulations within a clonal undifferentiated population with different measured levels
of Oct4-GFP expression when these subpopulations were allowed to self-renew in order
to determine if cell-to-cell variations in Oct4-GFP are fixed or transient and if they retain
their differences in affecting subsequent differentiation.
39
2.3 Methods
2.3.1 Self-renewing culture of mESC
A transgenic R1 mESC reporter line harboring a GFP sequence driven by the Oct4
distal promoter (O4G) [132], generously donated by Professor Douglas Melton (Harvard
University, Cambridge, MA, USA), was used for the experiments. Undifferentiated O4G
mESC were propagated as previously described [96] in Dulbecco’s modified Eagles
medium optimized for ES cells (ES-DMEM; SCRR-2010; American Type Culture
Collection (ATCC), Manassas, VA, USA) supplemented with 10% (v/v) ES cell qualified
fetal bovine serum (FBS; SCRR 30-2020; ATCC), 2 mM L-alanyl-L-glutamine (SCRR
30-2115; ATCC), 100 units/mL penicillin and 100 µg/mL streptomycin (30-002-CI;
Mediatech, Manassas, VA, USA), 1x MEM non-essential amino acids (30-2116; ATCC),
100 µM 2-mercaptoethanol (M7522; Sigma-Aldrich, St. Louis, MO, USA), and 103
units/mL Leukemia Inhibitory Factor (ESGRO mLIF; ESG1106; Millipore, Billerica, MA,
USA) on standard cell culture polystyrene plates (353043; BD Biosciences, Bedford, MA,
USA) or flasks (353014; BD Biosciences) that have been previously treated for 30 min
with a sterile 0.1% (w/v) solution of Type A gelatin (G-2500; Sigma-Aldrich) in tissue
culture water (25-055-CM; Mediatech). Cells were plated at a density of 12,000
cells/cm2. Medium was replaced daily, and cells were detached with 0.25% trypsin (302101, ATCC) every 3 days and replated at 12,000 cells/cm2.
2.3.2 Cell cycle analysis
Undifferentiated O4G mESC were detached and incubated as a single cell suspension
at a concentration of 106 cells/mL in undifferentiated culture media supplemented with
40
fumitremorgin C to a final concentration of 10 µM (F9054; Sigma-Aldrich) for 30 min
before live cell staining of cellular DNA content was performed using Vybrant DyeCycle
Violet Stain (V35003; Molecular Probes, Eugene, OR, USA) according to the
manufacturer’s instructions. Samples were analyzed using a FACS LSR HTS-2
(Beckton Dickinson) using 405 nm and 488 nm excitation sources (Koch Institute (KI),
MIT, Cambridge, MA, USA). All flow cytometry data was analyzed using FlowJo (Tree
Star, Ashland, OR, USA). Fluorescence was taken to be proportional to DNA content in
individual cells, and the population distribution of DNA content was fitted to a Watson
cell cycle model [133] in FlowJo, allowing for separation of the cell population into
subpopulations of cells in G1, S, or G2 phases.
2.3.3 Fluorescence-Activated Cell Sorting (FACS) of undifferentiated O4G cells
Undifferentiated O4G mESC were sorted according to Oct4-GFP fluorescence in
individual cells using a FACS Aria (Beckton Dickinson) or MoFlo (Beckman Coulter) into
the highest 15% (‘High’), middle 15% (‘Mid’), and lowest 15% (‘Low’). As a control, cells
were also passed through the sorter and all Oct4-GFP-positive cells were collected
(‘All’). R1 mESC without the reporter transgene were used as the negative gating
control for Oct4-GFP expression.
2.3.4 Flow cytometric analysis of Oct4-GFP expression
Oct4-GFP fluorescence in individual cells was measured using a FACScan (Beckton
Dickson). The fraction of Oct4-GFP positive cells was calculated as the number of cells
above the negative gating threshold as defined above, divided by the number of cells in
41
the entire population at each specific measurement time and condition. For
undifferentiated cells, the mean Oct4-GFP fluorescence was determined from all Oct4GFP positive cells in the population.
2.3.5 Differentiation of mESC to cardiomyocytes
Cells were differentiated as previously described [108]. Briefly, embryoid bodies (EBs)
were formed with 500 mESC per drop in 20µL of cell culture medium as used in selfrenewing culture but without LIF and including 0.2 mM ascorbic acid (A4034; SigmaAldrich). After 2 days, 30 EBs were transferred per well into fibronectin-coated (F1141;
Sigma-Aldrich) silicone rubber membrane-based plates [108] filled with 2mL of the EB
medium. After an additional 3 days, medium was replaced with 2.5mL of serum-free
medium, consisting of 50% (v/v) DMEM (90-133-PB; Mediatech) in tissue culture water
and 50% (v/v) Ham’s F-12 (10-080-CV; Mediatech) supplemented with 0.75% (w/v)
sodium bicarbonate (25-035-CI; Mediatech), 9mM glucose (G8769; Sigma-Aldrich), 5
µg/mL human insulin (I9278; Sigma-Aldrich), 100 units/mL penicillin, 100 µg/mL
streptomycin, and 0.2 mM ascorbic acid. Cells were differentiated at either 20% or 1%
O2 throughout the entire protocol for 10 days with oxygen conditions maintained by
flowing premixed gases containing 5% O2, and 20% or 1% O2 with a balance of N2
(certified medical gas from Airgas, Hingham, MA, USA), which corresponded under
humidified conditions to 142 and 7 mmHg pO2gas inside chambers maintained at 37oC
[108].
42
2.3.6 Real-time polymerase chain reaction (PCR)
Samples were collected as single cell suspensions and stored at 4oC in RNAprotect Cell
Reagent (76526; Qiagen, Valencia, CA, USA) according to manufacturer’s instructions
for no longer than 7 days before RNA isolation. Total RNA was isolated using the
RNeasy Plus Mini Kit (74134; Qiagen), cDNA synthesized using the High Capacity
cDNA Reverse Transcription Kit (4368814, Applied Biosystems, Foster City, CA, USA).
Real-time PCR was performed on a Fast Real-Time PCR System (7900HT, Applied
Biosystems), at the Center for Biomedical Engineering (MIT) using Power SYBR Green
PCR Master Mix (4367659, Applied Biosystems) or Taqman Gene Expression Master
Mix (43669016, Applied Biosystems) as appropriate. 18S ribosomal RNA (rRNA) was
used as an endogenous control. Primer sequences used for Nanog, Oct4, Sox2, and
Sox17 have been previously reported [96]. Additional primer sequences used (in order
of forward and reverse primer, and 5’ to 3’) were cardiac α-Actin
GCTTCCGCTGTCCAGAGACT and TGCCAGCAGATTCCATACCA, cardiac Troponin T
(cTnT) AGATGCTGAAGAAGGTCCAGTAGAG and CACCAAGTTGGGCATGAAGA,
Cdx2 TCACCATCAGGAGGAAAAGTGA and GCTCTGCGGTTCTGAAACCA, and GFP
CTGCTGCCCGACAACCA and TGTGATCGCGCTTCTCGTT. Commercially available
primers for 18S rRNA (Hs99999901_s1, Applied Biosystems) and Nestin
(Mm03053244_s1, Applied Biosystems) were also used. A standard curve was
constructed with cDNA pooled from all time points and conditions then serially diluted.
43
2.3.7 Cell enumeration
Enumeration of viable cells in undifferentiated culture was performed by staining with
Guava Viacount (4000-0041; Millipore) and data acquired using a Guava PCA flow
cytometer (Millipore) according to manufacturer’s instructions. For differentiated cells,
nuclei enumeration was performed by exposing dispersed cells to a lysis solution of 1%
(v/v) Triton X-100 and 0.1 M citric acid (0627; Mallinckrodt Specialty Chemicals, Paris,
KY, USA), then vortexed to obtain nuclei samples. Samples were then stained with
Guava Viacount and data acquired [96].
2.3.8 Flow cytometric analysis of MF20+ cells
The fraction of MF20+ cells in dispersed cells was acquired with flow cytometry as
previously described [96]. Briefly, samples were fixed by a 20 min incubation in 1% (w/v)
paraformaldehyde (36606; Alfa Aesar, Ward Hill, MA, USA) in PBS. Fixed cells were
permeabilized in 0.5% saponin (S-4521; Sigma-Aldrich) for 10 min, non-specific binding
blocked by a 30 min incubation in 2% (v/v) FBS in PBS, and then incubated at room
temperature with primary antibodies against sarcomeric myosin heavy chain (MF20;
MF20 supernatant; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) diluted
1:10 in 2% FBS solution for 1 hr. Samples were then incubated with goat anti-mouse
phycoerythin-conjugated secondary antibodies (115-116-146; Jackson
ImmunoResearch; West Grove, PA, USA) diluted 1:250 in 2% FBS solution for 30 min
at room temperature in the dark, washed 3x in 2% FBS solution, then data acquired
using a FACScan.
44
2.3.9 Statistics
Statistical analysis was performed with unpaired two-tailed t-tests, with p<0.05
considered statistically significant. Error bars are ± 1 standard deviation calculated from
biological replicates.
45
2.4 Results
2.4.1 Large cell-to-cell variability in Oct4-GFP expression in undifferentiated
mESC which corresponds to Oct4 mRNA expression
Flow cytometric analysis of Oct4-GFP fluorescence in a clonal population of
undifferentiated O4G mESC revealed a large range of Oct4-GFP fluorescence
intensities in individual cells, much larger the broadening attributable to instrument
errors or resolution limitations as shown by measurements with reference fluorescence
beads (SPHERO Rainbow Calibration Particles; RCP-30-5; Spherotech, Lake Forest, IL)
(Figure 2-1A). Using FACS, cells were sorted into high, med, and low subpopulations
(Figure 2-1B). Oct4-GFP fluorescence intensity, and Oct4 and GFP mRNA levels of the
subpopulations correlated positively (Figure 2-1C & D). A clonal population of O4G
mESC expressed cell-to-cell variation in Oct4-GFP fluorescence intensities that
spanned over two orders of magnitude, which was reflected by the 60x difference in
Oct4 mRNA levels between the high and low subpopulations.
2.4.2 Distribution of Oct4-GFP is not entirely cell cycle dependent
We next tested the hypothesis that this variation is cell cycle dependent by analysis of
DNA content and corresponding Oct4-GFP fluorescence intensity in individual cells
(Figure 2-2). Fractions of cells in G1, S, and G2/M phases were similar to other
published data for mESC [134]. The Oct4-GFP fluorescence profiles for cells in each
cell cycle phase exhibited the same large range of intensities as the whole population
with large overlap amongst all three phases. Although peak intensity for cells in G2 was
1.2x higher than cells in S phase, and both the aforementioned were higher than cells in
46
G1 (G2 by 1.5x, S by 1.2x), the differences in peak intensities were much smaller than
the range of fluorescence intensities for cells in all three phases, which spanned more
than 2 orders of magnitude. These differences between the subpopulations in different
phases of the cell cycle were not significant at the 95% confidence interval.
2.4.3 Levels of Oct4-GFP mark undifferentiated subpopulations with different
levels of pluripotency and early differentiation markers
mRNA expression analysis by real-time PCR revealed cell-to-cell variability in
expression of pluripotency and early lineage markers within the clonal undifferentiated
population. The sorted subpopulations showed that expression of pluripotency
associated genes Oct4, Nanog, and Sox2 [39–41] correlated positively with each other,
with each gene showing a greater than an order of magnitude difference in expression
between the high and low subpopulations (Figure 2-3A-C). Trophectodermal marker
Cdx2 [135], early endodermal marker Sox17 [136] and neural stem cell marker Nestin
[137] showed the reverse trend, with higher expression in the Low subpopulation.
Expression of Cdx2 was 200x higher, Sox17 20x higher, and Nestin 10x higher in the
Low subpopulation than in the High subpopulation (Figure 2-3D-F), despite all cells
being Oct4-GFP+.
2.4.4 Populations differentiated from cells with higher initial Oct4-GFP levels had
a greater fraction and number of cardiomyocytes
Prior studies have shown that ectopically increasing levels of Oct4 in ESC cause
spontaneous differentiation into the mesodermal lineage [45] and that Oct4 plays a role
47
in fate specification during early differentiation [48], [129]. We hypothesized that natural
cell-to-cell variations in clonal mESC can affect the proclivity of individual cells in the
population to differentiate into cells of different lineages, specifically that cells with
higher Oct4-GFP at the initiation of differentiation would differentiate into
cardiomyocytes with greater efficiency. To test this, we sorted the cells as described
above and immediately initiated differentiation by EB formation. In addition, as a control,
a 4th population of cells that had simply been passed through the FACS instrument and
all Oct4-GFP+ cells collected (‘All’) was differentiated in the same manner as well to
control for the effects of FACS. Each subpopulation was differentiated separately at 20%
and 1% O2 throughout the entire differentiation protocol (Figure 2-4).
Despite the clonal nature of the starting cells, the subpopulations differentiated into cells
positively stained for MF20 (anti-sacromeric myosin heavy chain, a cardiac specific
antibody [112], [138], [139]) with different efficiencies. Cells differentiated at 20% O2
from the high subpopulation were 8.6% MF20+ compared to 4.2% from the low
subpopulation, and when differentiated at 1% O2, the high subpopulation produced 21.7%
MF20+ compared to 14.1% MF20+ from the low subpopulation (Figure 2-4A). Following
the trend, the med and all subpopulations both produced fractions in between the high
and low subpopulations in both cases. These results also replicated earlier studies that
low oxygen during differentiation increased cardiomyocyte formation [117], [140].
The positive correlation between initial Oct4-GFP fluorescence and differentiated
MF20+ fractions was retained within each oxygen level by the total number of MF20+
48
cells produced (Figure 2-4B), which was calculated by multiplying the fraction of MF20+
cells by the total number of cells in each differentiated subpopulation (Figure 2-4C).
There were no statistically significant differences in the total cell numbers in the
populations that were differentiated at the same O2, although differentiation at 1% O2
produced less than 50% of the total cell number than differentiation at 20% O2. In
addition, the fraction of residual Oct4-GFP+ cells (Figure 2-4D) and average
fluorescence of these cells (data not shown) in each subpopulation were also only
dependent on the differentiation O2 (with low O2 decreasing residual fraction of
undifferentiated cells as previously shown [139, 140]). Finally, the trend of increasing
MF20+ cells with increasing initial Oct4-GFP fluorescence were also corroborated by
real-time PCR analysis (Figure 2-4E&F) of expression of cardiac genes Cardiac α-Actin
[142] and cTnT [143].
2.4.5 Sorted subpopulations recapitulate the parental Oct4-GFP distribution when
allowed to propagate in self-renewing culture
To investigate the stability of the cell-to-cell variation in Oct4-GFP expression intensities,
we cultured the sorted subpopulations in self-renewing conditions and measured Oct4GFP fluorescence for up to 30 days (Figure 2-5 & 6). Within 12 hr of sorting, the cells
repopulated the entire range of fluorescence intensities of the parental population, and
the high and med subpopulations had similar peak intensities 3 days after the sorting.
However, the low subpopulation took much longer to reconstitute the parental
distributions, and still exhibited small differences (not statistically significant) up to 30
49
days after sorting with a broader distribution and proportionally more cells at lower
intensities.
2.4.6 Recapitulation of the parental Oct4-GFP distribution erases subpopulation
differences in pluripotency and early differentiation markers
We then hypothesized that the regeneration of parental Oct4-GFP levels would also
remove differences in pluripotency and early differentiation markers observed in the
subpopulation immediately after sorting. RNA was isolated from cells allowed to selfrenew for 30 days after sorting and levels of pluripotency and early differentiation genes
were analyzed with real time PCR (Figure 2-7). The large differences in expression of
all genes observed immediately after sorting (Figure 2-3) no longer existed in the
subpopulations.
2.4.7 Recapitulation of the parental Oct4-GFP distribution removes the
differences in subsequent differentiation to cardiomyocytes
Finally, we tested the efficiency of differentiation to cardiomyocytes of the regenerated
subpopulations by differentiation at 1% O2 (Figure 2-8) There were no significant
differences in the differentiated cells of the subpopulations in terms of fraction and
number of MF20+ cells, and in the expression of Cardiac α-Actin and cTnT.
In addition, the fraction of MF20+ cells (averaging 23.7%) differentiated from cells that
had undergone the 30d regeneration after sorting (Figure 2-8A) was higher than those
differentiated immediately after FACS (Figure 2-4A). The fraction of MF20+ cells was
50
higher than in the cells differentiated from cells simply passed through FACS without
sorting (all population) (14.1%) and comparable to the high subpopulation (21.7%). We
postulate that this difference could be due to the harsh treatment of cells during FACS
and the extended period that the cells were kept outside the incubators at the initiation
of differentiation.
51
2.5 Discussion
Using an Oct4-GFP reporter driven by the distal enhancer active when mESC are in the
naïve pluripotent state, we studied Oct4 expression in single cells of clonal populations
of mESC, and observed large cell-to-cell variations in Oct4 within the undifferentiated
populations. Levels of Oct4-GFP expression correlated positively with pluripotency gene
expression and negatively with early differentiation markers. These differences
translated into a greater fraction and number of cardiomyocytes after differentiation from
cells with higher Oct4 expression at the initiation of differentiation. The cell-to-cell
variation in Oct4 was transient, and sorted subpopulations with different levels of Oct4GFP expression reconstituted the parental distributions when allowed to self-renew over
a period of 30 days. Allowing reconstitution of the parental distributions of Oct4-GFP
also erased differences in pluripotency and early differentiation marker expression and
in efficiency of subsequent cardiomyocyte differentiation.
The differences in differentiation efficiencies of the sorted subpopulations were not due
to greater cell survival or proliferation of select subpopulations because the total cell
numbers after the differentiation were not significantly different. It also cannot be
attributed to a resistance to or slower differentiation by the low subpopulation because
the fraction of undifferentiated cells were the same in all populations differentiated at the
same O2. Prior studies have shown that levels of Oct4 during early differentiation can
influence the differentiation pathway of both human and mouse ESC, on some
occasions by ectopically increasing or decreasing expression levels [45, 128, 129]. This
study has shown that differences in Oct4 within undifferentiated clonal populations do
52
occur without intervention and, significantly, affect differentiation proclivities in the same
manner. It may seem that the results of this study contradict those of an early work
which showed the heavy dependence of the pluripotent state of mESC on strict control
over Oct4 expression [45], whereas this study has shown large variation in Oct4
expression in mESC. An explanation could be the coordinated expression of Sox2 with
Oct4 [144] in this study, rather than an ectopic change in Oct4 expression alone, that
allows the mESC to retain the pluripotent state, thereby suggesting that future
experiments of such a nature would benefit from studies of multiple genes
simultaneously, as it may be their relative expressions that are significant.
The observed cell-to-cell variation in Oct4 expression cannot be attributed entirely to the
normal passage of cells through the cell cycle due to two observations – the small
differences in Oct4-GFP of cells in different phases of the cell cycle, and the long time
scale (up to 30 days or 60 cell divisions) required for the regeneration of the parental
Oct4-GFP expression after FACS. We also note the significantly longer time required for
the low subpopulation to recapitulate the parental distribution, and postulate that
transitions to and from a low Oct4 state is slow.
There have been many recent studies on sources of heterogeneities within clonal
populations (reviewed in [80]). While studies have shown the mechanisms behind gene
expression noise and their relationship to phenotypic differences [68, 78, 79, 144], the
time scale for relaxation observed in this study suggests another source for the
heterogeneity, in addition to noise. These slow fluctuations (such as the >18 day period
53
for regeneration of the sorted low population in this study) in mammalian cells remain
poorly understood. It has been proposed that this heterogeneity in gene expression is
based in epigenetics, influenced by (yet unidentified) non-stochastic factors; and most
importantly, appears to have a role in development [80].
Prior studies of hematopoietic stem cells have shown transcriptome-wide differences in
subpopulations sorted by expression of a surface antigen [72] which correlated to
differentiation efficiencies to different cell lineages. Earlier studies have shown
heterogeneous expression of Nanog [50], Rex1 [52], and Stella [53] in mESC which
corresponded to effects on subsequent fate choice. This study has demonstrated a
similar phenomenon based on levels of Oct4 gene expression in undifferentiated mESC,
which may be correlated with the heterogeneous behaviors of the aforementioned
genes.
54
2.6 Future Work
Future studies could focus on further characterization of the sorted subpopulations of
mESC, which could illuminate processes and mechanisms of early cell fate decisions
during which different levels of pluripotency factors affect induction of different germ
layers as demonstrated by a recent publication [48]. We hypothesize that the different
starting levels of pluripotency factors at the initiation of differentiation ‘carry over’ into
early differentiation, hence causing heterogeneity in germ layer induction. Other
possibilities include the study of differentiation to other cell types of different lineages,
such as neurons; improving the resolution of the sorted subpopulation by decreasing
the range of Oct4-GFP intensities within each subpopulation, perhaps even down to the
single cell level; simultaneous evaluation of multiple markers [146] to measure the ratios
of two markers, such as Oct4 and Sox2 as suggested previously; elimination of cell
cycle differences in the undifferentiated populations, perhaps by reversibly trapping the
cells in one phase before sorting and differentiation [134]; and non-transgenic methods
for non-destructive single cell measurements, perhaps by identifying the appropriate
surface antigens suitable for translation to human pluripotent stem cell studies (e.g.
SSEA4). Much about the dynamics of genome-wide interactions in such complex
systems on the single cell level for both the maintenance of pluripotency and during
differentiation remains to be studied. These studies could lead to a better understanding
of the sources of heterogeneity within populations differentiated in vitro and improve
yields of desired cell products from directed differentiation protocols.
55
2.7 Tables and Figures
250
O4G
beads
B
200
Med
Cell Count
200
Count
250
A
150
100
150
100
High
Low
50
50
0
102
103
104
GFP Fluorescence [AU]
C
High
1
Med
Low
0.1
103
104
102
Oct4-GFP Fluorescence [AU]
105
Relative GFP mRNA Expression
Relative Mean Oct4-GFP Fluorescence
0
101
D
Med
0.1
Low
0.01
0.1
1
Relative Oct4 mRNA Expression
High
1
0.1
1
Relative Oct4 mRNA Expression
Figure 2-1 Characterization of Oct4-GFP (O4G) mESC reporter line demonstrates large
cell-to-cell variability in Oct4-GFP expression which corresponds to Oct4 mRNA levels
(A) Comparison of distribution of Oct4-GFP fluorescence and reference fluorescence
beads. (B) Undifferentiated O4G mESC sorted by FACS into High, Med, and Low
subpopulations. (C) Correlation between Oct4 mRNA expression (real-time PCR) and
mean Oct4-GFP fluorescence (flow cytometry) [High = 1]. (D) Correlation between Oct4
and GFP mRNA expressions (real-time PCR) [High = 1].
56
A
Watson
Model
Cell Count
1200
G1
900
S
600
G2
300
0
100
0
50
DNA Content (DyeCycle Violet) [AU]
100
B
G1
Cell Counts
80
S
G2
60
40
20
0
104
102
103
Oct4-GFP Fluorescence [AU]
Figure 2-2 Oct4-GFP variability cannot be explained by differences in cell cycle stage
(A) Cell cycle analysis of undifferentiated and unsorted O4G mESC by fitting to a
Watson cell cycle model [133] to identify cells in different cell cycle phases. (B) Oct4GFP distribution of undifferentiated O4G mESC at G1, S, and G2 phases of the cell
cycle.
57
100
A
103
Oct4
D
Cdx2
E
Sox17
F
Nestin
102
101
Expression Relative to High Subpopulation
10-1
100
10-2
100
10-1
102
Nanog
B
101
10-1
100
10-1
10-2
100
Sox2
C
101
10-1
100
10-2
10-1
Low
Med
Low
High
Med
High
Sorted Subpopulation
Figure 2-3 Real-time PCR analysis of sorted O4G mESC subpopulations reveal that
levels of Oct4-GFP mark undifferentiated subpopulations with different levels of
pluripotency and early differentiation markers
58
Cells were sorted as described in Figure 2-1B into High, Med, or Low subpopulations.
Relative expression of pluripotency-associated genes (A) Oct4, (B) Nanog, and (C)
Sox2, and trophectodermal marker (D) Cdx2, and early differentiation markers (E)
Sox17 and (F) Nestin [High = 1] (N = 3).
59
*
Number MF20+ Cells (x10-5)
Fraction MF20+ Cells [%]
A Starting
Subpopulation
All
20
Low
Med
15
High
25
*
*
*
10
5
6
*
*
*
4
2
D
100
6
4
10-1
2
10-2
0
Expression Relative to
Undifferentiated mESC (x10-4)
*
Fraction Residual
Oct4-GFP+ Cells [%]
Total Cell Number (x10-6)
C
B
*
0
101
0
8
8
E
3
2
*
Cardiac
α-Actin
F
*
6
*
4
*
1
0
cTnT
*
2
20
0
1
20
1
Differentiation O2 [%]
Figure 2-4 Populations differentiated from cells with higher initial Oct4-GFP levels had a
greater fraction and number of cardimyocytes
Cells were sorted as described in Figure 2-1B into High, Med, or Low subpopulations, or
simply passed through FACS without selection (All subpopulation) as a control, and
60
immediately differentiated using the cardiomyocyte protocol at 20% or 1% O2 for 10
days, then analyzed.
(A) Fraction of MF20+ cells. (B) Final number of MF20+ cells. (C) Total cell count. (D)
Fraction of residual Oct4-GFP+ cells. Real-time PCR analysis of cardiac markers (E)
cardiac α-Actin, and (F) cTnT relative to undifferentiated mESC.(Error bars = standard
deviation; N = 3; * indicates statistical differences at 95% confidence.)
61
150
100
4H
12H
1D
2D
3D
4D
6D
9D
12D
15D
18D
30D
Low
Med
High
All
50
0
150
100
Number of Cells
50
0
150
100
50
0
150
100
50
0
102
103
102
103
104
104
Oct4-GFP Fluorescence [AU]
102
103
104
Figure 2-5 Oct4-GFP fluorescence distributions of sorted subpopulations cultured in
self-renewing conditions for up to 30 days after initial sorting demonstrate recapitulation
of the parental Oct4-GFP distribution over time.
62
Mean Oct4-GFP Fluorescence relative to All Subpopulation
2
High
Med
Low
All
1.5
1
0.5
0
5
10
15
20
Period of Regeneration [Days]
25
30
Figure 2-6 Time course of mean Oct4-GFP fluorescence of the subpopulations relative
to the All subpopulation.
63
101
A
Oct4
D
Cdx2
B
Nanog
E
Sox17
C
Sox2
F
Nestin
Expression Relative to All Subpopulation
100
10-1
101
100
10-1
101
100
10-1
All
All Low Med High
Low Med High
Sorted and Regenerated Subpopulation
Figure 2-7 Effects of regeneration of parental Oct4-GFP expression on gene
expression of subpopulations.
64
Cells sorted as described in Figure 2-1B were grown in self-renewing conditions for 30
days before real-time PCR analysis of gene expression.
Relative expression of pluripotency-associated genes (A) Oct4, (B) Nanog, and (C)
Sox2, and trophectodermal marker (D) Cdx2, and early differentiation markers (E)
Sox17 and (F) Nestin [High = 1]. (Error bars = standard deviation; N = 3; No statistically
significant differences between gene expression of the regenerated subpopulations
were found).
65
8
30
Number MF20+ Cells (x10-5)
Fraction MF20+ Cells [%]
A
20
10
Expression Relative to
Undifferentiated mESC (x10-4)
6
4
2
0
6
0
C
B
Cardiac α-Actin
D
cTnT
3
4
2
2
1
0
All
Low
0
All Low Med
Med High
Sorted and Regenerated Subpopulation
High
Figure 2-8 Recapitulation of the parental Oct4-GFP distribution removes the differences
in subsequent differentiation to cardiomyocytes
Cells were sorted and allowed to grow in self-renewing conditions for 30 days as
described in Figure 2-7 were then subjected to cardiomyocyte differentiation for 10 days
at 1% O2, then analyzed.
(A) Fraction and (B) Number of MF20+ cells in the final differentiated populations. Realtime PCR analysis of cardiac markers (C) cardiac α-Actin and (D) cTnT in the
66
differentiated populations relative to undifferentiated mESC. (Error bars = standard
deviation; N = 3)
67
-Page Intentionally Left Blank-
68
Chapter 3 Culture oxygen levels and use of small molecule inhibitors
during self-renewal reversibly affect subsequent differentiation of
mouse embryonic stem cells
3.1 Abstract
Prior studies on self-renewal culture of embryonic stem cells (ESC) which had focused
on long term proliferation and pluripotency, with assessment by differentiation to
derivatives of the three germ layers, include the discovery of different states of
pluripotency, some achieved by small molecule inhibition of signaling pathways. The
effects of culture conditions during self-renewal, (which we term preconditioning), on the
effectiveness of subsequent differentiation has not been examined. Here we show that
changes preconditioning by low oxygen culture or small molecule dual inhibition (2i) of
mitogen-activated protein kinase (using MEK inhibitor PD0325901) and glycogen
synthase kinase (with GSK inhibitor CHIR99021) (1) reversibly affect levels of Oct4
expression in cells that are otherwise pluripotent, and (2) alters the efficiency of
subsequent differentiation to cardiomyocytes (CM). Using a mESC line harboring a GFP
reporter driven by the distal Oct4 enhancer, we performed preconditioning at different
oxygen levels, with or without 2i supplementation. Under all conditions, the fraction of
Oct4-GFP+ cells remained relatively constant (>90%) but the mean Oct4-GFP
expression increased with 2i supplementation and decreased with low oxygen culture.
Changes in preconditioning cells produced large differences in the resulting number and
fraction of CM, despite use of identical differentiation protocols. Preconditioned cells
that expressed higher Oct4-GFP levels before differentiation produced more CM after
69
differentiation. Low oxygen culture reduced Oct4-GFP expression during self-renewal
and subsequent efficiency of CM differentiation while 2i supplementation increased both
Oct4-GFP expression and subsequent efficiency of CM differentiation. These changes
were reversed by continued self-renewal at high oxygen or removal of 2i
supplementation respectively. Finally, the enhancement in CM generation from high
oxygen culture and 2i supplementation during preconditioning is synergistic with low
oxygen culture during differentiation, which had earlier been shown to improve
differentiation of mESC to cardiomyocytes, demonstrating the importance of strict
oxygen control during all aspects of ESC culture and differentiation. These results
demonstrate that the manipulation of self-renewing culture conditions can lead to
changes in the outcomes of defined differentiation protocols, a novel dimension to
explore for directed differentiation of pluripotent stem cells.
70
3.2 Introduction
In order to realize the immense clinical potential of pluripotent stem cells (PSC), which
include both embryonic stem cells and induced pluripotent stem cells (iPSC), efficient
protocols to differentiate these PSC into sufficient numbers and purities of the desired
terminally differentiated or progenitor cell types are required. Much work in this area of
directed differentiation has focused on the period during which differentiation is already
occurring, and this includes differentiating ESC by co-culture with stromal cell lines [62],
differentiation with various small molecule growth factors [60], and genetic
manipulations [147]. However, the effects of the self-renewal culture environment used
to propagate the undifferentiated cells before the initiation of differentiation on the
effectiveness of subsequent differentiation protocols have not been examined.
Most prior studies on self-renewal culture of embryonic stem cells (ESC) focused on
long term proliferation and pluripotency and were assessed by differentiation to
derivatives of the three germ layers. One recent study highlighted the importance of
pluripotency factors Oct4 and Sox2 in germ layer determination during early
differentiation [48]. Another study revealed that low oxygen levels during self-renewing
culture decreased population-averaged levels of Oct4 mRNA expression, although cells
remained pluripotent [96]. Taken together, this would suggest that different culture
conditions can affect key pluripotency marker expression while still maintaining
pluripotency, and these differences may affect the subsequent differentiation of the cells.
71
We are thus interested in examining different pluripotency maintaining culture conditions
that result in changes in pluripotency marker expression. Two variables of interest are
(1) culture oxygen levels, and (2) the use of two small molecule inhibitors (known
together as ‘2i’) which have been shown to able to replace leukemia inhibitory factor
(LIF) in self-renewing culture of mESC [34]. Would changes in oxygen levels or 2i use
during self-renewal affect subsequent differentiation of mESC? In addition, would such
changes affect cells permanently or were they reversible?
In this study, we examined the self-renewing culture conditions for mouse ESC that
affect the expression of Oct4, a key pluripotency marker, using a transgenic mESC
reporter cell line harboring a GFP sequence driven by the Oct4 distal enhancer. In
addition, we studied how different culture conditions during self-renewal immediately
before differentiation, which we termed ‘preconditioning’, affect the efficiency of
differentiation to cardiomyocytes, chosen here as a model system. Finally, we examined
if changes in Oct4 expression due to different self-renewing conditions continued to be
plastic when self-renewal conditions were changed. This work explored a novel
dimension that had been previously ignored in designing directed differentiation
protocols, resulting in an enhanced differentiation protocol which could be used in
conjunction with and enhance the efficiency of other existing differentiation protocols.
72
3.3 Methods
3.3.1 Self-renewing culture of mESC
A transgenic R1 mESC reporter line harboring a GFP sequence driven by the Oct4
distal promoter (O4G) [132], generously donated by Professor Douglas Melton (Harvard
University, Cambridge, MA, USA), was used for the experiments. Undifferentiated O4G
mESC were propagated as previously described [96] in Dulbecco’s modified Eagles
medium optimized for ES cells (ES-DMEM; SCRR-2010; American Type Culture
Collection (ATCC), Manassas, VA, USA) supplemented with 10% (v/v) ES cell qualified
fetal bovine serum (FBS; SCRR 30-2020; ATCC), 2 mM L-alanyl-L-glutamine (SCRR
30-2115; ATCC), 100 units/mL penicillin and 100 µg/mL streptomycin (30-002-CI;
Mediatech, Manassas, VA, USA), 1x MEM non-essential amino acids (30-2116; ATCC),
100 µM 2-mercaptoethanol (M7522; Sigma-Aldrich, St. Louis, MO, USA), and 103
units/mL Leukemia Inhibitory Factor (ESGRO mLIF; ESG1106; Millipore, Billerica, MA,
USA) on plates with wells whose bottoms have been replaced by silicone rubber
membranes [108] and previously treated for 30 min with a sterile 0.1% (w/v) solution of
Type A gelatin (G-2500; Sigma-Aldrich) in tissue culture water (25-055-CM; Mediatech).
In some cases, the medium was further supplemented with 1µM PD0325901 and 3 µM
CHIR99021 (‘+2i’). Cells were plated at a density of 12,000 cells/cm2. Medium was
replaced daily, and cells were detached with 0.25% trypsin (30-2101, ATCC) every 3
days and replated at 12,000 cells/cm2.
73
3.3.2 Flow cytometric analysis of Oct4-GFP expression
Oct4-GFP fluorescence in individual cells was measured using a FACScan (Beckton
Dickson). The fraction of Oct4-GFP positive cells was calculated as the number of cells
above the negative gating threshold as defined above, divided by the number of cells in
the entire population at each specific measurement time and condition. For
undifferentiated cells, the mean Oct4-GFP fluorescence was determined from all Oct4GFP positive cells in the population.
3.3.3 Differentiation of mESC to cardiomyocytes
Cells were differentiated as previously described [108]. Briefly, embryoid bodies (EBs)
were formed with 500 mESC per drop in 20µL of cell culture medium as used in selfrenewing culture but without LIF and including 0.2 mM ascorbic acid (A4034; SigmaAldrich). After 2 days, 30 EBs were transferred per well into fibronectin-coated (F1141;
Sigma-Aldrich) silicone rubber membrane-based plates [108] filled with 2mL of the EB
medium. After an additional 3 days, medium was replaced with 2.5mL of serum-free
medium, consisting of 50% (v/v) DMEM (90-133-PB; Mediatech) in tissue culture water
and 50% (v/v) Ham’s F-12 (10-080-CV; Mediatech) supplemented with 0.75% (w/v)
sodium bicarbonate (25-035-CI; Mediatech), 9mM glucose (G8769; Sigma-Aldrich), 5
µg/mL human insulin (I9278; Sigma-Aldrich), 100 units/mL penicillin, 100 µg/mL
streptomycin, and 0.2 mM ascorbic acid.
74
3.3.4 Control of culture oxygen levels (pO2cell)
Cells were self-renewed and differentiated at combinations of 20%, 5%, or 1% O2 as
specified, with oxygen conditions maintained by flowing premixed gases containing 5%
O2, and 20%, 5%, or 1% O2 with a balance of N2 (certified medical gas from Airgas,
Hingham, MA, USA), which corresponded under humidified conditions to 142, 36, and 7
mmHg pO2gas inside chambers maintained at 37oC. Control of pO2cell equal to pO2gas
was accorded by culture on custom-made silicone rubber membrane-based wells as
previously described [108].
3.3.5 Real-time polymerase chain reaction (PCR)
Samples were collected as single cell suspensions and stored at 4oC in RNAprotect Cell
Reagent (76526; Qiagen, Valencia, CA, USA) according to manufacturer’s instructions
for no longer than 7 days before RNA isolation. Total RNA was isolated using the
RNeasy Plus Mini Kit (74134; Qiagen), cDNA synthesized using the High Capacity
cDNA Reverse Transcription Kit (4368814, Applied Biosystems, Foster City, CA, USA).
Real-time PCR was performed on a Fast Real-Time PCR System (7900HT, Applied
Biosystems), at the Center for Biomedical Engineering (MIT) using Power SYBR Green
PCR Master Mix (4367659, Applied Biosystems) or Taqman Gene Expression Master
Mix (43669016, Applied Biosystems) as appropriate. 18S ribosomal RNA (rRNA) was
used as an endogenous control. Primer sequences used for Nanog and Sox17 have
been previously reported [96]. Additional primer sequences used (in order of forward
and reverse primer, and 5’ to 3’) were cardiac α-Actin GCTTCCGCTGTCCAGAGACT
and TGCCAGCAGATTCCATACCA and cardiac Troponin T (cTnT)
75
AGATGCTGAAGAAGGTCCAGTAGAG and CACCAAGTTGGGCATGAAGA, and Cdx2
TCACCATCAGGAGGAAAAGTGA and GCTCTGCGGTTCTGAAACCA. Commercially
available primers for 18S rRNA (Hs03928990_g1, Applied Biosystems), Blimp1
(Mm00476128_m1, Applied Biosystems), Dusp6 (Mm00518185_m1, Applied
Biosystems), Fgf5 (Mm00438918_m1, Applied Biosystems), Rex1 (Mm03053975_g1,
Applied Biosystems), Stella (Mm01184198_g1, Applied Biosystems), Titin
(Mm00621005_m1, Applied Biosystems), and Wnt3a (Mm00437337, Applied
Biosystems) were also used. A standard curve was constructed with cDNA pooled from
all time points and conditions then serially diluted.
3.3.6 Cell enumeration
Enumeration of viable cells in undifferentiated culture was performed by staining with
Guava Viacount (4000-0041; Millipore) and data acquired using a Guava PCA flow
cytometer (Millipore) according to manufacturer’s instructions. For differentiated cells,
nuclei enumeration was performed by exposing dispersed cells to a lysis solution of 1%
(v/v) Triton X-100 and 0.1 M citric acid (0627; Mallinckrodt Specialty Chemicals, Paris,
KY, USA), then vortexed to obtain nuclei samples. Samples were then stained with
Guava Viacount and data acquired with a Guava PCA flow cytometer as previously
described [96].
3.3.7 Flow cytometric analysis of MF20+ cells
The fraction of MF20+ cells in dispersed cells was acquired with flow cytometry as
previously described [96]. Briefly, samples were fixed by a 20 min incubation in 1% (w/v)
76
paraformaldehyde (36606; Alfa Aesar, Ward Hill, MA, USA) in PBS. Fixed cells were
permeabilized in 0.5% saponin (S-4521; Sigma-Aldrich) for 10 min, non-specific binding
blocked by a 30 min incubation in 2% (v/v) FBS in PBS, and then incubated at room
temperature with primary antibodies against sarcomeric myosin heavy chain (MF20;
MF20 supernatant; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) diluted
1:10 in 2% FBS solution for 1 hr. Samples were then incubated with goat anti-mouse
phycoerythin-conjugated secondary antibodies (115-116-146; Jackson
ImmunoResearch; West Grove, PA, USA) diluted 1:250 in 2% FBS solution for 30 min
at room temperature in the dark, washed 3x in 2% FBS solution, then data acquired
using a FACScan.
3.3.8 Estimation of spontaneously contracting areas
The fraction of well coverage by spontaneously contracting cells was averaged from
measurements in 15 random 2 mm2 spots within each well by visual estimation as
previously described [108].
3.3.9 Statistics
Statistical analysis was performed with unpaired two-tailed t-tests, with p<0.05
considered statistically significant. All data presented as mean ± standard deviation of
biological replicates.
77
3.4 Results
3.4.1 Self-renewal of mESC at low oxygen reduces expression of Oct4-GFP but
does not increase rates of spontaneous differentiation
To examine the effect of low oxygen on self-renewing culture of mESC, we cultured
O4G mESC under 20%, 5%, and 1% O2 with self-renewal media on silicone rubberbased plates for 9 days and measured their distributions of Oct4-GFP fluorescence at
each cell passage (Figure 3-1). Culture at low O2 shifted the distribution of Oct4-GFP
fluorescence towards reduced (but still Oct4-GFP+) values (Figure 3-2A and B) and
reduced the population averaged value (Figure 3-2A). However, under all conditions the
fraction of Oct4-GFP+ cells remained relatively constant and >90% (Figure 3-2B).
A prior study reported a reduction in Oct4 mRNA expression in mESC cultured under
low oxygen [96] but did not identify if it resulted from a reduction across individual cells
in the population, or an increase in fraction of Oct4-negative cells. Our results indicate
that there have not been increased differentiation (which would have resulted in an
increase in the fraction of Oct4-GFP-negative cells) due to reduced oxygen culture, but
rather, a reduction in the levels of Oct4-GFP in individual cells.
3.4.2 Reduction of Oct4-GFP expression by low oxygen culture is reversed by
continued self-renewal in 20% oxygen
We next tested if the reduction in Oct4-GFP expression was reversible by subsequent
self-renewal cultured at 20% O2 (Figure 3-1C and 3-2) Cells that were cultured at 5% or
1% O2 for 9 days were cultured under self-renewing conditions for an additional 9 days
78
at either 20% O2 (indicated as 5 20 or 1 20) or the same low oxygen condition as
the first 9 days. The additional 9-day self-renewing culture at 20% O2 reversed the
reduction in Oct4-GFP expression caused by low O2 culture during the first 9 days and
restored the Oct4-GFP distribution to that of cells that had been continuously cultured at
20% O2 for all 18 days. Cells continuously cultured under low O2 conditions did not
undergo reversal of the reduction.
3.4.3 Low oxygen preconditioning decreases subsequent differentiation of mESC
to cardiomyocytes
We hypothesized that conditions of self-renewing culture immediately before
differentiation (termed preconditioning) at different O2 would change the efficiency of
differentiation of clonal mESC to different cell types. To test this, we preconditioned
clonal mESC at 20%, 5% and 1% O2 for 9 days before differentiating each population of
preconditioned cells at 20%, 5%, and 1% O2 for 10 days, for a total of 9 different
combinations of preconditioning and differentiation conditions (Figure 3-3).
At each differentiation condition, low oxygen preconditioning reduced the fraction and
number of cells positively immunostained for MF20 (anti-sarcomeric myosin heavy
chain, a cardiac specific antibody [112, 138, 139]). For cells differentiated at 5% O2, for
example, about 15, 25, and 29% of the population were MF20+ in differentiated cells
preconditioned at 1, 5, and 20% O2 respectively (Figure 3-3A).
79
These results are further supported by similar trends in cardiac gene expression
(cardiac α-Actin [142], cTnT [143] and Titin [148]) by the differentiated populations, as
well as semi-quantitative estimations of the fraction of spontaneously contracting tissue
(Figure 3-3C to E).
3.4.4 Total cell number and fraction of residual undifferentiated Oct4-GFP+ cells
are not affected by preconditioning, but by oxygen conditions during
differentiation
To investigate the possibility that the reduction in cardiomyogenesis in low oxygen
preconditioned cells was due to changes in cell proliferation or a ‘resistance’ to any
differentiation, we examined the total cell number and the fraction of residual
undifferentiated mESC (identified by Oct4-GFP fluorescence) in differentiated
populations (Figure 3-4). Total cell number after differentiation did not exhibit significant
differences among populations differentiated at the same O2, but showed differences
between populations preconditioned at the same O2 and differentiated at different O2.
For cells preconditioned at 20% O2, for example, (white bars in Figure 3-4A), cells
differentiated at 20% produced 5.6x106, 4.1x106, and 2.2x106 total cells when
differentiated at 20, 5, and 1% O2 respectively.
While changes in preconditioning O2 produced differences in the fraction of residual
Oct4-GFP+ cells for populations differentiated at 20% O2, such differences were not
observed for those differentiated at 5% or 1% O2. Differences between populations
preconditioned at the same O2 but differentiated at either 20% O2 or low (5% or 1%) O2
80
were significant in all cases. For example, cells preconditioned at 1% (black bars in
Figure 3-4B) had about 7.5%, 0.8%, and 1.1% of the differentiated population remaining
as Oct4-GFP+ when differentiated at 20, 5, and 1% O2 respectively. Similar behavior
observed for cells preconditioned at 20% and 5% O2.
3.4.5 Reduction in efficiency of cardiomyogenesis due to low oxygen
preconditioning is reversible by self-renewal in 20% oxygen before differentiation
To investigate if the change in differentiation efficiency of clonal mESC to
cardiomyocytes by low oxygen preconditioning was reversible, we cultured cells under
self-renewing conditions at either 20%, 5%, or 1% O2 for 18 days, or 5% or 1% for the
first 9 days and then 20% for the next 9 days, before subjecting all five populations to
cardiomyocyte differentiation at 5% O2 (Figure 3-5).
We found that the changes produced by low oxygen preconditioning could be largely
reversed by subsequent self-renewing culture at 20% O2 before differentiation. The
fraction and number of MF20+ cells in the populations differentiated from either 20%,
520%, or 120% preconditioned cells were not significantly different, and this trend is
also seen in cardiac α-Actin gene expression analysis and estimations of spontaneously
contracting areas. The cells that were preconditioned at 5% and 1% O2 for all 18 days,
however, continued to exhibit the reduced differentiation efficiencies to cardiomyocytes.
81
3.4.6 2i use during self-renewal increases expression of naïve pluripotency
markers, decreases early differentiation markers synergistically with high oxygen,
and is reversible by subsequent self-renewing culture without 2i
The fraction of MF20+ cells in the differentiated populations correlated positively with
the mean Oct4-GFP fluorescence of the starting populations (Figure 3-6). This
correlation suggested that preconditioning mESC to increase their Oct4-GFP levels
before differentiation would increase the yield in subsequent differentiation to
cardiomyocytes. Prior work [96] had shown that increasing O2 levels in self-renewing
culture above 20% did not further increase pluripotency gene expression but instead
decreased them, possibly due to increased cell death due to increased reactive oxygen
species (ROS). We then explored an alternative strategy of using small molecule
inhibitors known to support the undifferentiated state and identified the combination of
two small molecules: PD0325901, an inhibitor of Mitogen-Activated Protein Kinase
(MEK), and CHIR99021, an inhibitor of Glycogen Synthase Kinase (GSK), referred
together as ‘2i’, as a possibility. 2i has been used previously to maintain the
undifferentiated state of mESC without LIF, and to improve the establishment of ESC
and iPSC lines. Its use is thought to promote entry into the naïve or ground state of
pluripotency [34, 149]. However, their effects during self-renewing culture on ESC’s
subsequent differentiation have not been studied. We hypothesize that 2i
supplementation in self-renewal media would increase Oct4 expression in
undifferentiated mESC and consequently increase the efficiency of subsequent
differentiation to cardiomyocytes.
82
To study the effects of 2i in self-renewing culture of mESC, we cultured O4G mESC
under four different self-renewing conditions – 20% O2, with (20/2iL) or without 2i (20/L),
or 1% O2 with (1/2iL) or without 2i (1/L) for 9 days (See Figure 3-7 for nomenclature for
the different conditions). 2i supplementation increased the Oct4-GFP expression without
significant changes in the fraction of Oct4-GFP+ cells compared to self-renewal without
2i supplementation at either O2. 2i supplementation acted synergistically with high
oxygen during self-renewal to increase Oct4-GFP expression beyond levels of cells
cultured at 1% O2 with 2i. After 9 days of culture, 20% O2 with 2i supplementation
produced cells with a population-averaged Oct4-GFP fluorescence of nearly 3x higher
than cells self-renewed with LIF only at 20% O2, while 1% O2 with 2i supplementation
achieved an increase of 2x over the 20% O2 condition with LIF only, and a 4x increase
over cells self-renewed at 1% O2 with LIF alone (Figure 3-8A, 3-9A).
To study the reversibility of the increases in Oct4-GFP expression due to 2i
supplementation during self-renewal, cells cultured with 2i at 20% or 1% O2 were then
subcultured with or without 2i supplementation for up to an additional 15 days at the
same oxygen level for a total of six culture conditions. The increase in Oct4-GFP
expression was reversed by subsequent self-renewal culture without 2i supplementation
(Figure 3-8C,E & 9A). In all cases, the fraction of Oct4-GFP+ cells were relatively
constant and >90% (Figure 3-9B). Therefore, changes in mean Oct4-GFP levels
resulted from changes in the levels of Oct4-GFP expression in individual cells rather
than in the fraction of Oct4-GFP+ cells in the populations (Figure 3-8).
83
We further characterized the cell populations that had been self-renewed under different
conditions for 18 (Figure 3-10) and 24 days (Figure 3-11 Effects of 2i supplementation
and culture O2 on gene expression of mESC after 24 days in self-renewing culture. by
real-time PCR analysis. Expression of Nanog and Rex1, genes marking the naïve
pluripotent state [52, 149], were increased in self-renewing cultures supplemented with
2i at either O2 level, compared to the culture with the same O2 but without 2i. Markers of
primordial germ cells Stella [150] and Blimp1 [151] were downregulated in the presence
of 2i in self-renewal culture. Similarly, early lineage markers Fgf5 [152] and Sox17 [136]
exhibited reduced expression in the presence of 2i during self-renewal. As a check, we
also analyzed behaviors of Dusp6, a marker of functional ERK activity, which would be
downregulated by MEK (Mitogen-activated protein kinase kinase) inhibitor PD035901
[119, 153, 154], and Wnt3a, which would be upregulated by use of CHIR99021
[120,155]; and found the expression behaviors were consistent with 2i activity.
3.4.7 High oxygen and 2i use during preconditioning separately, synergistically,
and reversibly increases subsequent differentiation to cardiomyocytes
To study the effects on subsequent differentiation of oxygen and 2i supplementation
during preconditioning, we self-renewed the cells as described above for 18 (Figure
3-12) and 24 days (Figure 3-13) and performed subsequent differentiation at 20% O2 for
all preconditioning conditions (& 13). We measured the fraction and number of MF20+
cells, the relative expression of cardiac associated genes cardiac α-Actin, cTnT, and
Titin, and estimated the area fraction of wells covered by spontaneously contracting
cells in the differentiated populations.
84
Similar trends were observed for both rounds of differentiation at 20% initiated after 18
and 24 days of preconditioning. In cell populations differentiated after 18 days of
preconditioning, the fraction of MF20+ cells in the population with 2i (20/2iL) was about
26%, 2.4x higher than the control population that was preconditioned at 20% O2 without
2i for the entire preconditioning period (20/L, 11%). The population that received 2i
supplementation for the first 9 days, and then only LIF for the next 9 days (20/(2iL/L))
generated 12% MF20+ cells, which was not significantly different from the 20/L control
population. Preconditioning at 1% O2 (1/L) reduced the fraction of MF20+ cells in the
differentiated population compared to 20% O2 preconditioning (20/L). As in the case
with 20% O2 preconditioning, low oxygen with 2i supplementation (1/2iL) increased the
fraction of the MF20+ cells compared to both the 1/L and 20/L conditions, and cells
differentiated from the 1/(2iL/L) preconditioned cells did not show a significant difference
in the fraction of MF20+ cells from the 1/L preconditioned cells. These trends are
corroborated by the number of MF20+ cells generated, the fraction of contracting areas,
and gene expression analyses of cardiac genes, as well as again by the results from
differentiation of cells preconditioned for 24 days before initiation of differentiation
(Figure 3-13).
Prior work [117, 140] has established that low oxygen during differentiation increases
cardiomyogenesis. We hypothesize that low oxygen during differentiation acts
synergistically with high oxygen and 2i supplementation during precondition to further
increase cardiomyogenesis. We tested this by differentiating 20/2iL preconditioned cells
85
after 24 days of preconditioning at 5% O2 (blue bars in Figure 3-13). Indeed, low oxygen
further increased all aspects assessed – fraction and number of MF20+, fraction of
spontaneously contracting areas, and gene expression of cardiac-associated genes.
20/2iL preconditioned cells produced about 31% MF20+ cells when differentiated at 5%
O2, which was higher than the same cells differentiated at 20% O2 by 30%, 20/L
preconditioned cells differentiated at 20% O2 by 160%.
3.4.8 Fraction of MF20+ cells in differentiated populations correlates positively
with mean Oct-GFP levels of the starting populations
For cells differentiated at 20% O2, the fraction of MF20+ cells correlated linearly with the
mean Oct4-GFP fluorescence of the starting (Figure 3-14) with correlation coefficients
<R2> of 0.63 and 0.93 for cells differentiated after 18 and 24 days of preconditioning
respectively. When data from all differentiation experiments at 20% O2 were pooled into
a single analysis, the correlation remained strong (<R2> = 0.84) in linear form (Figure
3-15A), and with a logarithmic dependence on the initial mean Oct4-GFP fluorescence
(<R2> = 0.88) (Figure 3-15B). Both regressions predict >100% MF20+ cells if the
starting Oct4-GFP fluorescence is sufficiently high, which is physically impossible. We
therefore investigated a saturable function of the form
𝑦 = 𝑦𝑚𝑎𝑥 (1 − exp�𝐴(𝑥 − 𝑥𝑚𝑖𝑛 )�)
(1)
where y is the final fraction of MF20+ cells in the differentiated population, x the starting
average Oct4-GFP fluorescence, ymax, is the highest fraction that can be achieved with
a given cell line and protocol, xmin is a minimum value for a given setting on the flow
cytometer, cells would not be considered to be Oct4-GFP+ at the initiation of
86
differentiation, and A, a scaling factor to account for differences between flow cytometer
settings. The three parameters were fitted [156] by nonlinear regression minimizing the
sum of the residuals in y squared.
The result plotted in Figure 3-16 has physically meaningful parameter values of ymax =
29.5%, xmin = 166.5 AU, A = -7.4x10-4, with <R2> = 0.84. In general, we would expect
that ymax would depend on the differentiation protocol used (using low oxygen during
differentiation for example, would increase ymax), and xmin and A would be dependent on
the actual flow cytometer and the settings employed.
87
3.5 Discussion and future work
High oxygen and 2i supplementation during self-renewal separately and synergistically
increased Oct4 expression, and subsequently increased differentiation to
cardiomyocytes. This effect was reversible with continued self-renewal by using
appropriate oxygen modulation and elimination of 2i supplementation before
differentiation. Differentiation to cardiomyocytes was enhanced synergistically by using
low oxygen during differentiation. Earlier studies determined that low oxygen is best
employed during the first 6 days of differentiation, then high oxygen subsequently [117,
140]. Thus, oxygen conditions for synergistic enhancement of cardiomyogenesis are
different depending on the stage of differentiation, and realization of the most
enhancement of directed differentiation requires good control of O2 conditions to which
the cultured cells are exposed. Future work could translate these findings to human
ESC, as well as to differentiation protocols for other clinically relevant cell types. Other
published studies have shown that human ESC are more similar to mouse epiblast stem
cells (mEpiSC) than mESC, and requires ERK1/2 signaling for renewal [157], which 2i
supplementation blocks. With the isolation of hESC that are in a naïve state more
similar to mESC [124], it would be interesting to determine if these results can be
directly translated to the differentiation of such hESC to cardiomyocytes.
This study demonstrated a positive correlation between Oct4-GFP expression
immediately before differentiation and the fraction of MF20+ cells in the differentiated
populations. Recent studies [48, 128, 129] have provided a possible explanation and
mechanism for this correlation through the action of Oct4 enhancing fate choice down
88
the mesodermal lineage during early differentiation. Future studies could include
additional characterization of the differently self-renewed population via microarrays or
RNA-Seq to determine transcriptome-wide differences generated in clonal populations.
Results from such studies could direct investigations into better predictive methods for
differentiation into other therapeutically relevant cell types. In addition, this work also
raises new questions on the nature of preconditioning on clonal ESC populations – is
preconditioning employing selective pressures on the population, and certain
subpopulations favored by some culture conditions, or are all cells being affected
equally? One possibility would be to use brainbow technology [158] or other similar
methods to differentially mark otherwise clonal cells and to track the composition of the
marked cells under different self-renewal conditions. Finally, to understand the role of
Oct4 in the naïve, primed, and early differentiating ESC states, researchers could
generate a double reporter ESC line with the distal and proximal promoter regions of
Oct4 driving the expression of two different fluorophores in order to determine their
relative activities in individual cells during self-renewal and differentiation. It is
interesting to note that both Stella and Blimp1 expressions were downregulated in the
presence of 2i in self-renewing culture, although Stella expression is associated with the
naïve pluripotent state [53], while Blimp1 is associated with the primed pluripotent state
[150]. Both genes are markers for primordial germ cells, and this suggests that 2i use is
suppressing differentiation of ESC to germ cells.
Prior studies on self-renewal culture of PSC have focused on the maintenance and
propagation of cells in the undifferentiated state, and pluripotency of the cultured cells
89
was assessed by testing for the ability to differentiate into cells of all three germ layers,
the ability to contribute to chimeras, or form teratomas. However, there have not been
studies on the effects of self-renewal culture on the efficiency of subsequent
differentiation to specific cell types – a focus of directed differentiation studies. Similarly,
efforts to direct differentiation of PSC have focused on the period of differentiation, and
have not taken into consideration the effects self-renewal conditions that have occurred
before differentiation. This study has taken the direction of studying the effects of selfrenewing culture conditions immediately before directed differentiation of PSC, and
found that it indeed affects the efficiency of differentiation to cardiomyocytes.
These results provide a novel direction for consideration in design of directed
differentiation protocols as different self-renewing culture conditions employed
immediately before differentiation can affect the efficiency of subsequent differentiation
of clonal PSC. Studies on undifferentiated culture systems of PSC would benefit from
assessments of the efficiency of subsequent differentiation to one or more cell types of
interest, in addition to the standard pluripotency assays, to aid future translational work.
90
3.6 Figures
150
A
Sd9
O2 [%]
100
20
5
1
Cell Counts
50
0 1
10
150
B
103
102
104
150
Sd18
C
Sd18
O2 [%]
100
100
520
120
50
0
101
50
102
0
104
101
103
102
Oct4-GFP Fluorescence [AU]
103
104
Figure 3-1 Effects of culture O2 in self-renewing culture on distributions of Oct4-GFP
expression in O4G mESC.
Oct4-GFP distributions in populations self-renewed at 20%, 5%, or 1% O2 for (A) 9 days,
(B) 18 days, and (C) 5% or 1% for the first 9 days, then 20% for the next 9 days.
91
Relative Mean Oct4-GFP Fluorescence
1.2
A
1.0
0.8
O2 [%]
20
5
1
520
120
0.6
0.4
0.2
0
3
6
9
12
15
18
6
9
12
15
Days of Self-Renewal
18
100
Fraction Oct4-GFP+ Cells [%]
B
80
60
40
20
0
0
3
Figure 3-2 Mean Oct4-GFP fluorescence and fraction of Oct4-GFP+ cells from selfrenewal at different O2.
92
(A) Time course of mean Oct4-GFP fluorescence of mESC self-renewed under different
O2 conditions. (B) Fraction of Oct4-GFP+ cells in the self-renewing populations.
Self-renewal of mESC at low O2 reduced cell-level expression of Oct4-GFP, but does
not increase rates of spontaneous differentiation based on the fraction of Oct4-GFP+
cells in the population.
93
Differentiation after 9 days of Preconditioning
A
*
30
*
*
Preconditioning O2
*
20%
*
5%
20
*
*
B
1.0
*
*
45
*
Fraction of spontaneously
contracting areas [%]
10
0
1.5
1%
*
*
*
*
0.5
0
1.6
D
1.2
0.8
0.4
0
Cardiac
α-Actin
*
*
*
*
*
*
Expression relative to
undifferentiated cells (x10-4)
Expression relative to
undifferentiated cells (x10-3)
Number of MF20+ cells (x10-6)
Fraction of MF20+ cells [%]
40
*
30
*
15
*
0
1.6
E
cTnT
*
*
0.8
*
0.4
*
20
5
1
Differentiation O2 [%]
Figure 3-3 Effects of O2 preconditioning on subsequent differentiation.
94
*
*
1.2
0
20
5
1
Differentiation O2 [%]
*
C
Cells were self-renewed at 20%, 5%, or 1% O2 for 9 days (preconditioning) before
subsequent differentiation at 20%, 5%, or 1% O2. Each group of bars denote cells that
have been differentiated at the same O2, with white bars representing cells that have
been preconditioned at 20% O2, grey bars 5%, and black bars 1% O2.
(A) Fraction of MF20+ cells in the differentiated populations. (B) Number of MF20+ cells.
(C) Fraction of well that is spontaneously contracting. Real-time PCR analysis of (D)
cardiac α-Actin and (E) cTnT relative to undifferentiated cells.
Low O2 preconditioning decreases subsequent differentiation of mESC to
cardiomyocytes.
95
10
A
Fraction of Residual
Oct4-GFP+ cells [%]
Total Cell Number (x10-6)
8
6
4
2
0
8
6
*
*
Preconditioning O2
20%
5%
1%
4
2
0
20
5
1
Differentiation O2 [%]
B
20
5
1
Differentiation O2 [%]
Figure 3-4 Effects of O2 preconditioning on total cell number and fraction of residual
Oct4-GFP+ cells after differentiation.
Cells were differentiated as described in Figure 3-3 and assessed for (A) total cell
number and (B) fraction of residual undifferentiated Oct4-GFP+ cells in the differentiated
populations.
96
20
*
15
*
10
C
Cardiac
α-Actin
0.8
0.4
0
*
Fraction of spontaneously
contracting areas [%]
5
0
1.2
Expression relative to
undifferentiated cells (x10-3)
A
Number of MF20+ cells (x10-6)
Fraction of MF20+ cells [%]
25
Differentiation after 18 days of Preconditioning
(All differentiation performed at 5% O2)
1.5
B
1.0
0
25
D
20
15
10
*
*
5
0
1
20 5 1 5
20
20
Preconditioning O2 [%]
*
0.5
1
20 5 1 5
20
20
Preconditioning O2 [%]
Figure 3-5 Reversibility of O2 preconditioning.
Cells were preconditioned at 20%, 5%, or 1% O2 for 18 days, or 5% or 1% for the first 9
days, then at 20% O2 for the next 9 days (denoted as 520, 120) before
differentiation at 5% O2 for all conditions. *p<0.05 compared to cells preconditioned at
20% O2.
97
(A) Fraction of MF20+ cells in the differentiated populations. (B) Number of MF20+ cells.
(C) Real-time PCR analysis of cardiac α-Actin relative to undifferentiated cells. (E)
Fraction of cells that are spontaneously contracting.
The reduction of resulting cardiomyocytes differentiated from low O2 preconditioned
mESC can be reversed by self-renewal at high O2 before differentiation, although there
is a non-significant decrease remaining in fraction of spontaneously contracting cells for
120 preconditioning.
98
Fraction MF20+ cells in differentiated population [%]
Differentiation
O2 (%)
30
20
5
<R2>
0.97
0.74
0.99
1
20
10
0
0
250
500
750
Starting Mean Oct4-GFP Fluorescence [AU]
Figure 3-6 Correlation between mean Oct4-GFP fluorescence of the starting
undifferentiated populations and the fraction of MF20+ cells in the resulting
differentiated populations.
99
1000
5
Figure 3-7 Experimental design and nomenclature for preconditioning with O2
modulation and 2i supplementation.
100
Cell Number
150
A
100
Sd9
B
Sd18
Sd24
D
20/2iL
20/(2iL/L)
20/L
20/2iL
1/2iL
20/L
1/L
50
102
103
104
150
Cell Number
0 1
10
100
102
C
103
102
104
Sd18
E
103
104
103
104
Sd24
1/2iL
1/(2iL/L)
1/L
50
0
101
102
103
104
Oct4-GFP Fluorescence [AU]
102
Figure 3-8 Effects of 2i supplementation and O2 during self-renewal on Oct4-GFP
fluorescence distributions of undifferentiated mESC.
Oct4-GFP distributions in populations of mESC self-renewed (A) at 20% or 1% O2 for 9
days, at (B) 20% or (C) 1% O2 for 18 days, or at (D) 20% or (E) 1% O2 for 24 days.
101
A
3
2
1
0
0
100
Fraction Oct4-GFP+ [%]
Relative Mean Oct4-GFP Expression
4
5
10
15
20
25
B
80
60
40
20
0
0
Self-Renewal
Condition
20/L
1/L
20/2iL
1/2iL
20/(2iL/L)
1/(2iL/L)
5
20
25
10
15
Days in Self-Renewing Culture
Figure 3-9 Effects of 2i supplementation and culture O2 on mean Oct4-GFP
fluorescence and fraction of Oct4-GFP+ cells during self-renewal.
(A) Time course of mean Oct4-GFP fluorescence of the populations relative to cells selfrenewed continuously at 20% O2 with LIF only (20/L). (B) Fraction of Oct4-GFP cells in
the undifferentiated populations.
102
1.5
A
1.5
* Nanog
B
Rex1
*
#
#
1.0
1.0
*
#
*
0.5
0.5
*
0
3.6
0
Dusp6
C
*
*
D
*
Wnt3a
#
*
2.4
#
1
1.2
*
#
*
0
2.4
0
2.4
Stella
E
*
1.6
*
0.8
0
18
1.6
#
*
*
#
*
*
0
3
Sox17 *
G
Blimp1 *
F
0.8
#
*
12
* Fgf5
H
2
*
6
1
Self-Renewal Condition
103
1/(2iL/L)
1/2iL
1/L
*
20/(2iL/L)
20/2iL
0
#
*
20/L
1/(2iL/L)
1/2iL
1/L
20/(2iL/L)
0
20/2iL
#
20/L
Expression relative to 20/L at Sd18
2
Figure 3-10 Effects of 2i supplementation and culture O2 on gene expression of mESC
after 18 days in self-renewing culture.
Real-time PCR analysis of cells after 18 days of self renewal. Each group of bars
denote cells self-renewed at the same O2. White bars represent cells in culture with LIF
only, black with LIF and 2i, and grey with LIF and 2i for the first 9 days, and then with
LIF only for the next 9 days with expressions relative to that of the 20/L condition.
Genes assessed: Naïve pluripotency markers (A) Nanog and (B) Rex1; (C) marker of
functional ERK activity (inhibited by PD0325901) Dusp6; (D) Wnt3a (stimulated by
CHIR99021); primordial germ cell markers (E) Stella and (F) Blimp1; and early lineage
markers (G) Sox17 (primitive endoderm), and (H) Fgf5 (primitive ectoderm). *p<0.05
compared to 20/L; #p<0.05 compared to 1/L.
104
1.8
1.5
#
Nanog
A
B
1.2
1.0
0.6
0.5
Rex1
#
*
*
*
*
*
0
1.8
C
0
4
Dusp6 *
D
*
Wnt3a
#
1.2
#
2
*
0.6
*
#
*
0
2
*
*
Stella*
E
0
1.5
Blimp1
F
1.0
1
*
*
*
0
9
#
*
0.5
#
*
0
*
Sox17
G
#*
Fgf5
H
4
6
*
Self-Renewal Condition
105
1/(2iL/L)
*
1/2iL
1/L
20/(2iL/L)
0
#
*
20/L
1/(2iL/L)
1/L
20/(2iL/L)
20/2iL
1/2iL
#
*
20/2iL
3
0
*
2
20/L
Expression relative to 20/L at Sd24
*
Figure 3-11 Effects of 2i supplementation and culture O2 on gene expression of mESC
after 24 days in self-renewing culture.
Real-time PCR analysis of cells after 24 days of self renewal, as described in Figure
3-10.
2i use during self-renewal increased naïve pluripotency markers and decreased early
differentiation markers synergistically with high O2 and was reversible by subsequent
self-renewing culture without 2i.
106
0
1.0
*
#
0.5
#
0
30
C
*
None
Detected
107
*
20
4
0
Self-Renewal Condition
cTnT
*
F
20
1/(2iL/L)
*
E
1/2iL
*
1/L
B
*
20/(2iL/L)
D
20/2iL
#
20/L
*
Expression relative to undifferentiated mES (x10-3)
*
1/(2iL/L)
A
1/2iL
10
1/L
20/(2iL/L)
Fraction of MF20+ cells [%]
30
20/2iL
Number MF20+ cells (x10-6)
0
1.5
20/L
Fraction of spontaneously
contracting areas [%]
6
Cardiac
α-Actin
4
20
#
2
*
0
*
#
10
0
Titin
*
#
10
2
Figure 3-12 Effects of 2i supplementation and culture O2 on subsequent differentiation
after 18 days of preconditioning.
Cells preconditioned for 18 days as described in Figure 3-10 are subsequently
differentiated at 20% O2. (A) Fraction of MF20+ cells in differentiated population. (B)
Number of MF20+ cells. (C) Fraction of well that is spontaneously contracting. Real-time
PCR analysis of cardiac markers (D) cardiac α-Actin, (E) cTnT, and (F) Titin, relative to
undifferentiated mESC. *p<0.05 compared to population differentiated from 20/L cells,
#
p<0.05 compared to population differentiated from 1/L cells.
108
Cardiac
α-Actin
D
30
*
20
*
2
*
B
1.0
Expression relative to undifferentiated mES (x10-3)
10
0
1.5
*
*
*
#
0.5
*
*
0
30
C
*
#
*
0
40
*
E
*
cTnT
30
20
*
#
10
*
*
0
F
*
12
Titin
20
8
#
Self-Renewal Condition
1/2iL
1/(2iL/L)
*
*
1/L
0
*
20/L
1/(2iL/L)
None
Detected
1/2iL
1/L
20/(2iL/L)
None
Detected
20/2iL
0
4
20/2iL
10
20/L
Fraction of spontaneously
contracting areas [%]
*
4
#
20/(2iL/L)
Fraction of MF20+ cells [%]
Number MF20+ cells (x10-6)
6
*
A
Figure 3-13 Effects of 2i supplementation and culture O2 on subsequent differentiation
after 24 days of preconditioning.
109
Cells preconditioned for 24 days as described in Figure 3-11 are subsequently
differentiated at 20% (all populations) or 5% (blue bars - 20/2iL only) O2. (A) Fraction of
MF20+ cells in differentiated population. (B) Number of MF20+ cells. (C) Fraction of well
that is spontaneously contracting. Real-time PCR analysis of cardiac markers (D)
cardiac α-Actin, (E) cTnT, and (F) Titin, relative to undifferentiated mESC. *p<0.05
compared to population differentiated from 20/L cells, #p<0.05 compared to population
differentiated from 1/L cells.
High O2 and 2i use during preconditioning separately, synergistically, and reversibly
increased subsequent differentiation to cardiomyocytes. This effect can be further
enhanced by low O2 during differentiation.
110
Final mean fraction MF20+ cells [%]
30
20
18d preconditioning
24d preconditioning
10
0
0
1000
2000
Starting Mean Oct4-GFP Fluorescence [AU]
3000
Figure 3-14 Correlation between the fraction of MF20+ cells in the resulting
differentiated populations for cells preconditioned for 18 (red triangles) and 24 days
(blue circles) before differentiation and the mean Oct4-GFP fluorescence of the starting
undifferentiated populations. Cells were differentiated at 20% O2. For cells
preconditioned for 18d, <R2>= 0.63; for cells preconditioned for 24d, <R2>= 0.93, both
from a linear least squares regression.
111
All cells differentiated at 20% O2
30
A
Final mean fraction MF20+ cells [%]
20
Length of
Preconditioning
9d
18d
24d
10
Linear correlation: r2 = 0.84
0
0
30
1000
2000
3000
B
20
10
Semi-log fit: r2 = 0.88
0
1000
10000
100
Starting Mean Oct4-GFP Fluorescence [AU]
Figure 3-15 Linear and semi-log correlations between mean Oct4-GFP fluorescence of
starting undifferentiated populations and the fraction of MF20+ cells in the resulting
differentiated populations for all cells differentiated at 20% O2.
112
Final mean fraction MF20+ cells [%]
30
20
10
r2 = 0.84
0
0
1000
2000
3000
Starting Mean Oct4-GFP Fluorescence [AU]
Figure 3-16 Model fit for correlation between mean Oct4-GFP fluorescence of starting
undifferentiated populations and the fraction of MF20+ cells in the resulting
differentiated populations for all cells differentiated at 20% O2.
Model used was y = ymax(1 – exp(A(x-xmin)), where y = final fraction of MF20+ cells in
the differentiated population; ymax = hypothesized maximum MF20+ fraction possible; x
= starting average Oct4-GFP fluorescence; xmin = minimum fluorescence for cell to be
considered Oct-GFP+; A = scaling factor. Fitted values: ymax = 29.5%, xmin = 166.5;
A = -7.4x10-4. <R2> = 0.84.
113
-Page Intentionally Left Blank-
114
Chapter 4 Integrative Perspective Paper: Opportunities and Obstacles
in the Commercialization of Pluripotent Stem Cell-Based Products
and Services
4.1 Executive Summary
The major commercialization opportunity resulting from the discovery of human
pluripotent stem cells is their role in the production of replacement cells, tissues, and
organs for cell therapy, with a single product potentially reaching blockbuster US market
sizes of US$1 billion or more. However, this tremendous opportunity is equally matched
by significant challenges, both technological and commercial. Investors and
entrepreneurs willing to enter the market now can look to related fields of providing
research consumables and equipment for pluripotent stem cell research or using the
cells themselves to create research and diagnostic tools. While these markets are
significantly smaller than that of cell therapies, there is already demonstrated profitability
and fewer uncertainties. This also allows players to gain technologies, market
knowledge, and the financial ability to support their moves into the cell therapy space in
the long run. As the cell therapy market evolves from its current development phase to
having actual products on the shelf, initial strategies taken by companies are expected
to focus on high impact therapies, in order to attract financing with promises of high
returns and to establish market credibility. Players pursuing this long-term goal will need
to navigate issues of intellectual property, and regulatory and ethical challenges, before
the oft-repeated potential of pluripotent stem cells in bringing new therapies to the clinic
can be realized.
115
4.2 Introduction
The discovery of human embryonic stem cells (hESCs) and their pluripotent nature
rapidly led to widespread expectations that their contribution to human therapies and
greatest opportunities for commercialization would arise from their potential to generate
replacement cells, tissues, and even organs for use in regenerative medicine. The
subsequent discovery of human induced pluripotent stem cells (hiPSCs) heralded a
second path to the same goal, with the added advantage of significantly reducing the
risk of rejection of the transplant, as well as sidestepping the ethical challenges
associated with use of hESCs. Realizing this goal still requires many challenges to be
overcome, and at this point in time, there are no FDA-approved hESC or hiPSC derived
cell-based therapeutics commercially available, with only two hESC-based clinical trials
in progress in the United States. The chasm between current reality and the vision is
undeniably large and fraught with obstacles, both scientific and commercial. However,
the commercialization options for human pluripotent stem cells (hPSCs, which include
both hESCs and hiPSCs) are not limited to producing replacement tissues, with
companies already bringing other hPSC-based products and services, such as
laboratory consumables for use in hPSC research and hPSC-based tools for
development research, drug discovery, disease modeling, and toxicology studies to the
market. The different commercialization opportunities, associated obstacles, and
potential business models for hPSC-based products and services are examined here.
116
4.3 Pluripotent Stem Cell Research and Diagnostic Consumables and Equipment
As hPSC research activity grows in academic, medical, and commercial settings, so
does demand for laboratory consumables and equipment that support such endeavors.
Of course, much of the consumables and scientific equipment used are not specific to
hPSC research activity, but there is a category that caters exclusively or predominantly
to hPSC work. Examples include reprogramming ‘kits’ based on different techniques or
services to perform the actual work of reprogramming the client’s cells, hPSC specific
growth factors, culture reagents, and antibodies for maintenance of pluripotency or
directed differentiation, and testing services to evaluate the genetic stability of stem cell
lines.
The global market for such products and services was estimated to be US$883M in
2011, growing to US$1.35B in 2015, with a 11% annual growth rate [159]. While this is
only a small fraction of the entire US$20.5B market for the entire laboratory supply
market in the US alone, it is certainly growing much quicker than the 0.1% annual
growth the larger category achieved in the 5 years from 2007 to 2012, and the projected
3.4% in the next 5 years [160]. This market is heavily dependent on research funding
availability which feeds demand from scientists and laboratories, and the anemic growth
in the US market over the past 5 years reflects the changes in funding availability, both
from federal and other government sources, private foundations, and commercial
companies.
117
Companies in this market segment include dedicated small start-ups such as Stemgent
(Cambridge, MA), and ArunA Biomedical (Athens, GA) as well as divisions within wellestablished large companies such as Life Technologies (Carlsbad, CA, soon to be
acquired by Thermo Fisher Scientific (Waltham, MA)) and Becton Dickinson (Franklin
Lakes, NJ). This market is considered to be mature, with well-established business
models and a number of large operating firms with stable growth. Scale and a deep
portfolio of products are keys to success in this model, with substantial revenue possible
in the aggregate of small revenue streams of individual products, hence favoring large
companies with the necessary sales and supply chain bandwidth. While smaller
companies and start-ups may be sustainable with one or two blockbuster products, a
typical business model for these companies would be to license their products to the
larger companies rather than going it alone, or to be acquired [161]. An example would
be ArunA’s agreement with Thermo Fisher Scientific to ride on their sales and
distribution channels. Interestingly enough, the reverse has happened with the
agreement between Pfizer and Stemgent, which will see custom reagents developed by
Pfizer sold through the latter [162].
With the research landscape rapidly evolving, new tools and reagents come on to the
market very frequently. Recent new products include mRNA-based reprogramming kits
introduced in 2011, based on a 2010 publication [63]. The rapid translation of scientific
discoveries to commercially available products and services in this market makes it
attractive to investors and entrepreneurs. Stemgent, for example, raised $14M by 2009
from Venture Capital (VC) firms HealthCare Ventures and Morgenthaler Ventures [163].
118
However, the challenge is to find and occupy a niche in this crowded market with large
established companies.
Establishing a presence in this market, while not directly involved in cell therapy, can
also be a strategy to enter the regenerative medicine market more directly. This could
be achieved by entering collaborations with firms developing hPSC-derived cell therapy
products in the hope that when a product does succeed, the firm would have locked in
future demand for the consumables used in the manufacture of the cell therapy product.
Companies looking to supply to this market will need to develop or have access to
cGMP-certified facilities, and satisfy other FDA requirements such as those for record
keeping, and purity and potency of product [164].
119
4.4 Pluripotent Stem Cell-Derived Tools for Disease Modelling, Drug Discovery,
and Toxicology
While it is understandable that the general public’s interest in hPSC stem from their
potential for use in replacement cell therapies, researchers and pharmaceutical
companies are currently equally or even more interested in hPSCs as research tools for
use in developmental studies, disease modeling, drug discovery, and toxicology [165–
167]. While this is a market with evolving business models, researchers [166, 167],
investors [161], and industry [165, 168] are bullish on its short to medium-term
profitability and scalability.
Using hPSC’s ability to differentiate into specific adult cell phenotypes, researchers are
now able to test drug candidates in vitro for toxicological effects, displacing current
technologies of using transformed cell lines, primary cell lines, or animal models. The
market for such an application alone has been estimated to be US$100M per product,
for a total of US$500M or more [161]. However, it is hiPSC’s ability to generate adult
cells with specific disease phenotypes, by creating hiPSC from patients with those
diseases, and differentiating the cells into the desired cell types, that hPSCs come into
their own as research tools. This ‘disease-in-a-dish’ concept [166] overcomes the lack
of appropriate animal models for certain human diseases, and also enables highthroughput screening activities not possible with use of animal subjects. Multiple
disease-specific hiPSC lines have already been developed, such as those derived from
patients with Type 1 diabetes, Parkinson’s disease, and Down’s syndrome [20].
120
Companies already active in this new market space also include both small and large
firms such as iPierian (San Francisco, CA), Fate Therapeutics (San Diego, CA),
GlaxoSmithKlein (London, UK), and GE Healthcare (Piscataway, NJ). For example,
iPierian focusses on drug discovery platforms for neurodegenerative diseases such as
Alzheimer’s, while GE Healthcare produces human cardiomyocytes derived from ESC
for both toxicology studies and drug discovery. We are only beginning to see profitability
and hence market share and leadership are in flux, with the first mover advantage for
many diseases still not taken.
That said, there are several technical challenges that need to be addressed: (1) lack of
reliable and efficient differentiation protocols to produce certain desired differentiated
cell types; (2) heterogeneity in differentiated cell phenotypes after differentiation; and (3)
difficulty in recapitulating the disease in the in vitro model. For (1), both purity of the final
cell product and amount of cells produced are still lacking. Methods to purify for the
desired cell types continue to be topics of research [24]. As for (2), it has been reported
that cells derived from in vitro differentiation exhibit heterogeneity in their level of
maturity, and can thus have different phenotypes from cell to cell. Using these cells to
assess the effect of a drug may well result in multiple false positives and negatives
arising from a lack of consistency in the cells used [24]. Finally, as certain diseases may
not be cell-type specific, but arise instead from interactions between different cell types
(autoimmune diseases are a prime example), the ‘disease-in-a-dish’ may not be able to
capture the phenotype to be studied.
121
In spite of the aforementioned technical challenges to be addressed, investors and
entrepreneurs are positive about this market, and it has been described to have “the
most attractive commercial opportunities for companies” in the immediate future [161].
Compared to providing tools for PSC-related research, developing the PSC themselves
as research tools allows companies active in this market to move more directly into
therapeutic applications of hPSC products. Building competencies necessary for
success in this market, especially manufacturing-scale methods for differentiation, will
be crucial in entering the cell therapy market. In addition, the possibility of short to
medium term profitability in this market will allow companies to obtain favorable
valuations from the capital markets, as well as to build a brand and financial resources
for future expansion into cell therapies, creating opportunities for long term success.
Another application of hPSCs in this arena that is further away from commercial reality
is the concept of personalized drug discovery and testing. Instead of a ‘disease-in-adish’, the possibility is now of a ‘patient-in-a-dish’ where each testing platform is
genetically identical to the specific patient from which it was derived using iPSC
technologies. If successfully implemented, individuals can now test the safety and
efficacy of drugs on their own cells. However, the profitability of such a business model
will inevitably be affected by the higher costs of having personalized testing platforms
rather than a common one for each disease. The viability of such a service will depend
on degree of heterogeneity in responses to the drugs being tested, and the prevalence
of the disease. While consumers of the ‘disease-in-a-dish’ product would be commercial
laboratories or academic researchers, it is less clear who would be paying for the
122
‘patient-in-a-dish’ service. It is likely that individuals will have to bear this cost, through
health insurance providers, although one could imagine that the drug manufacturer may
choose to defray part or all of the cost as a means to avail themselves of future
recurring purchases of their therapy. In fact, some of the challenges associated with
personalized cell therapy manifest themselves here, where there needs to be a severe
unmet need (such as a high likelihood of a severe adverse reaction to a drug which, on
the other hand, could be therapeutically very effective) for such a product to be
commercially viable.
123
4.5 Replacement Cell Therapies Derived from Pluripotent Stem Cells
We now turn to the major goal of effective, possibly personal, cell-based therapeutics
derived from hPSCs. Despite the fact that such technologies are still in their nascent
state, there are already those in the general public who are seeking such therapies,
usually driven by personal circumstances, fuelled by inaccurate depictions of stem cell
based medicine perpetuated by unscrupulous providers [169]. In reality, the FDA has
clarified that there are currently no approved hPSC-derived cell therapies, although two
are currently undergoing clinical trials, not including Geron’s high profile exit from the
field after citing financial concerns [170].
To investors and entrepreneurs, the larger field of cell therapy, which is agnostic to the
source of the cells used, is itself just a few years ahead in maturity. This rapidly evolving
field has both ardent supporters and firm detractors [171–173]. Adding on the
uncertainty of hPSC technology raises additional challenges, both technical and
commercial, that need to be addressed for the successful commercialization of hPSCderived cell therapies.
As with using hPSC-derived cells as drug discovery tools, a primary technological
challenge is the lack of robust and scalable protocols capable of generating the desired
cell types in the required numbers and purity. That they will be used for transplants
raises additional constraints from the US Food & Drug Administration (FDA) such as
additional investigations needed for those that have ex vivo contact with live non-human
cells, on top of the already understandably strict guidelines for cell therapies [174–176].
124
A second technological challenge is the difficulty of tracking cells after their introduction
into the patient, and the lack of possible safeguards to reverse the procedure should
anything go wrong [177]. The field requires major advances in biomonitoring and novel
technologies capable of selectively removing or destroying rogue cells after
transplantation in order to properly address safety concerns arising from the use of such
therapeutics.
Thirdly, the issue of tumorigenicity of residual, undifferentiated hPSC is a major cause
for concern. Uncontrolled differentiation of pluripotent cells introduced into a patient,
together with the hPSC’s ability to proliferate indefinitely, creates a safety issue unlike
that of any other cellular therapeutic. In addition, genetic abnormalities in the hPSC
could potentially cause the development of teratocarcinomas, which are highly
malignant tumors with a persisting core of proliferating stem cells, raising the level of
concern yet again [178].
A related problem arises from the use of hiPSC around the issue of safety of the
method of reprogramming used to generate the pluripotent cells. While recent advances
have moved away from genetic manipulations using viral vectors, favoring transient,
non-integrative methodologies [179], difficulties in assessing the quality and efficiency of
the reprogramming, heterogeneities in effectiveness of the techniques depending on the
starting cell populations, and finally, concerns regarding the possible post-differentiation
tumorigenicity of the cell products, make this a closely studied field.
125
Finally, while it is commonly recognized that allogeneic transplants using hPSC-derived
products will necessarily have to address the immune response of the recipient, the
assumption that autologous hPSC-derived cellular therapies will not face the same
issues has been cast into doubt. Multiple recent publications reached conflicting
conclusions [31, 180, 181], and this is not surprising, given that these cells have been
exposed to factors absent in normal human physiology which may have altered their
phenotype sufficiently to evoke an immune response.
Even as researchers are tackling these technological challenges, investors, industry
players, and entrepreneurs are finding that the rules of this new market are far from
being written, and are contending with challenges of their own.
Firstly, the patent landscape for intellectual property (IP) associated with PSCs has
been described as a “minefield” [182], with companies interested in entering the field
having to invest upwards of hundreds of millions of dollars on IP protection in order to
legally operate. As a result, successful companies in this field will need to have
comprehensive and robust IP strategies, as well as the ability to either license the
necessary technologies from their holders, or operate around them. This issue is
compounded by the fact that there is still no harmonization world-wide regarding the
patentability of hPSC-associated technologies, with the example of Germany restricting
stem cell patents [183]. The original patents issued to James Thomson and the
Wisconsin Alumni Research Fund (WARF) covering hESC survived legal challenge in
126
the US, but with the rapidly evolving science and intense interest in the field, we should
not expect that we will hear the definitive last word on this complex issue any time soon
[184–186].
Looking beyond the issue of IP, business models and their associated sustainability
have not been verified. Successful models will arise from the simultaneous evolution of
technology and business strategy. A prior study recommended five possible strategies
for value capture in the regenerative medicine market: (1) Orphan Designation, where
the company focuses on a small market with unmet needs to take advantage of favored
regulatory treatment resulting in prolonged market exclusivity, then using this
opportunity to expand into other products with larger demands in the long run; (2) High
Impact Therapies, where there are high unmet needs for treatments for chronic
diseases in order to make oneself attractive for financing; (3) Platform Solution, where a
single product serves multiple disease markets in order to build a diverse revenue
stream; (4) Therapy Kit, for therapies with minimal cell manipulations but depend more
on devices for administration, are for those firms with the goal of transforming into a
device-based company; and (5) Incremental Solution, where the company introduces an
incrementally better product than an existing offering, making use of regulators’ and
physician’s familiarities with the product category [187].
For hPSC products, it is not possible for a company to adopt strategy (5), for obvious
reasons, and there does not seem to be current endeavors to develop products suitable
for strategies (3) and (4). Most companies entering the field are expected to adopt
127
strategy (2), given the need to attract long term and high levels of financing, and the
obligation to generate high returns. As the market matures in the future, newer
companies will attempt to find their own niche by adopting (1), or gain traction using (5).
However, this is projecting far into the future, assuming continued successes for hPSCderived cell therapies for a wide variety of conditions.
It is also worthwhile to consider the impact of pursuing allogeneic or autologous
products. As previously mentioned, autologous cell therapies would naturally attract
greater operating costs due to the need for individualized processing of cells from each
patient, while autologous treatments can take advantage of the economies of scale of
bulk processing. This advantage is reduced with lower numbers of units produced, and
suggests that for companies pursuing strategy (1) of targeting orphan diseases,
autologous treatments may succeed, especially if the increased cost is lower than the
potential gain of the autologous product over the allogeneic equivalent. A proposed
hybrid model, where the patient requires multiple doses of the same product, can take
advantage of economies of scale at the individual level, where the multiple doses of the
autologous product are manufactured simultaneously. This would reduce the average
costs of goods compared to single dose autologous products, but still suffers from a
cost disadvantage when compared to allogeneic equivalents [161].
It is well known that there are political uncertainties and ethical controversies associated
with the generation and use of hESCs, resulting in regulatory restrictions on their
derivation and use in many parts of the world, including the US [188]. From the Bush
128
era restrictions to Sherley v. Sebelius, the research community has faced uncertainties
in funding, and this may well have pushed researchers away from the field [189, 190].
As hESC research is still far from commercialization, a large proportion of the advances
made have come from academic research funded through federal support. With these
restrictions, investors may view hESC endeavors as being more risky than other
avenues, with reduced risk sharing by the government and academia.
Even hiPSCs may not be free from controversy, as questions around ownership of
derived cell lines created from donated tissue arise, and issues of personal privacy
around information indirectly obtained as a result of undergoing treatment become
known, as the field advances [191]. Companies will need to remain aware of the
sentiment of policy makers and the general public with regards to such issues and
anticipate that their business models and strategies will need to adapt to this audience.
With a US market conservatively estimated at US$1B just for a hPSC-derived product
for Type 1 diabetes alone [161], and similar blockbuster potential expected for other
diseases with levels of morbidity and mortality that cannot be managed with current
therapies, it is not surprising that, despite the nascent state of the technology and
significant risks and uncertainties, there continues to be widespread efforts to translate
hPSC-based research into clinical applications.
129
4.6 Discussion
While the major commercialization potential of hPSCs is that of generating replacement
cells, tissues, and possibly organs for regenerative medicine, we are still one to two
decades away from a first commercial product, extrapolating from the historical
development timelines of other biotechnologies such as protein-based pharmaceuticals
and therapeutic antibodies [192]. In the meantime, it is important to temper the
expectations of both supporters and detractors of the field, given the far-reaching claims
of the potential of hPSC technology, in order for the field to continue to receive
sustainable levels of financial, regulatory, and public support [193]. Entrepreneurs and
investors eyeing the substantial prize on the long term horizon can and already are
making moves in the supporting market for consumables and equipment, as well as
developing hPSC-based diagnostic and research tools to position themselves for
successful transitions into the business of hPSC-based therapeutics [163, 165, 168].
The road to successful commercialization will not be smooth. Geron’s high profile exit
from the cell therapy market, after the fanfare of being the first hPSC-derived cell
therapy to reach clinical trials (a hESC-derived product for spinal cord injuries), was
seen by many as a setback. However, after the announcement, while Geron’s share
price dropped by 20%, the two other players with significant investments in the field,
Advanced Cell Technology, currently the only firm with on-going Phase I trials for hESCderived therapies for macular degeneration, and BioTime, saw modest gains instead
[170]. Prices of companies in the wider biotechnology field, as a whole, did not react to
the news. This signified that investors are confident in the future earnings potential of
130
companies pursuing hPSC-based therapies. BioTime, led by Geron’s former CEO Dr.
Tom Okarma, subsequently purchased Geron’s hPSC assets, fulfilling the underlying
expectation that Geron’s exit was an opportunity for other players to pick up
technologies and IP that have already been significantly de-risked by Geron’s years of
investments [170, 194].
Geron’s decision was reported to be financially driven, which underscores the large
levels of investments and long incubation times before results can be reasonably
expected. With the current VC exit timelines of between five and ten years, and the first
commercial product expected to be at least twice that amount of time away, there is a
financial gap that needs to be filled for the field to continue to move forward.
Governments and non-profit foundations have typically filled the gap for research in this
field, and more recently, the industry has also stepped in, many with realistic short to
medium term strategies for sustainable operations (including those described above),
with an eye on the long-term goal. Savvy investors and entrepreneurs who are willing to
be patient, have the knowledge and ability to navigate the complexities of the hPSC
markets, and the intellectual and technological capital for high impact therapies, will be
the ones who deliver on the oft-repeated promises made at the discovery of hESCs.
131
-Page Intentionally Left Blank-
132
References
[1]
M. J. Evans and M. H. Kaufman, “Establishment in culture of pluripotent cells from
mouse embryos,” Nature, vol. 292, pp. 154–156, 1981.
[2]
J. A. Thomson, J. Itskovitz-Eldor, S. S. Shapiro, M. A. Waknitz, J. J. Swiergiel, V.
S. Marshall, and J. M. Jones, “Embryonic Stem Cell Lines Derived from Human
Blastocysts,” Science, vol. 282, no. 5391, pp. 1145–1147, Nov. 1998.
[3]
K. Hochedlinger and R. Jaenisch, “Nuclear Transplantation, Embryonic Stem
Cells and the Potential for Cell Therapy,” The New England Journal of Medicine,
vol. 349, pp. 275–286, Jan. 2003.
[4]
G. Q. Daley, M. A. Goodell, and E. Y. Snyder, “Realistic Prospects for Stem Cell
Therapeutics,” Hematology, pp. 398–418, Jan. 2003.
[5]
G. Keller, “Embryonic stem cell differentiation: emergence of a new era in biology
and medicine,” Genes & Development, vol. 19, pp. 1129–1155, May 2005.
[6]
G. Q. Daley and D. T. Scadden, “Prospects for Stem Cell-Based Therapy,” Cell,
vol. 132, no. 4, pp. 544–548, 2008.
[7]
S. Yamanaka, J. Li, G. Kania, S. Elliott, R. P. Wersto, J. Van Eyk, A. M. Wobus,
and K. R. Boheler, “Pluripotency of embryonic stem cells,” Cell and Tissue
Research, vol. 331, no. 1, pp. 5–22, Jan. 2008.
[8]
J. Rossant, “Stem Cells and Early Lineage Development,” Cell, vol. 132, no. 4, pp.
527–531, Feb. 2008.
[9]
C. J. Lengner, F. D. Camargo, K. Hochedlinger, G. G. Welstead, S. Zaidi, S.
Gokhale, H. R. Scholer, A. Tomilin, and R. Jaenisch, “Oct4 Expression Is Not
Required for Mouse Somatic Stem Cell Self-Renewal,” Cell Stem Cell, vol. 1, pp.
403–415, Oct. 2007.
[10] M. A. Laflamme, K. Y. Chen, A. V Naumova, V. Muskheli, J. A. Fugate, S. K.
Dupras, H. Reinecke, C. Xu, M. Hassanipour, S. Police, C. O’Sullivan, L. Collins,
Y. Chen, E. Minami, E. A. Gill, S. Ueno, C. Yuan, J. Gold, and C. E. Murry,
“Cardiomyocytes derived from human embryonic stem cells in pro-survival factors
enhance function of infarcted rat hearts,” Nature Biotechnology, vol. 25, pp. 1015–
1024, Sep. 2007.
[11] R. K. Burt, L. Verda, D.-A. Kim, Y. Oyama, K. Luo, and C. Link, “Embryonic Stem
Cells As an Alternate Marrow Donor Source: Engraftment without Graft-VersusHost Disease,” The Journal of Experimental Medicine, vol. 199, no. 7, pp. 895–
904, Apr. 2004.
133
[12] J.-H. Kim, J. M. Auerbach, J. a Rodríguez-Gómez, I. Velasco, D. Gavin, N.
Lumelsky, S.-H. Lee, J. Nguyen, R. Sánchez-Pernaute, K. Bankiewicz, and R.
McKay, “Dopamine neurons derived from embryonic stem cells function in an
animal model of Parkinson’s disease,” Nature, vol. 418, pp. 50–56, Jul. 2002.
[13] K. A. D’Amour, A. G. Bang, S. Eliazer, O. G. Kelly, A. D. Agulnick, N. G. Smart, M.
a Moorman, E. Kroon, M. K. Carpenter, and E. E. Baetge, “Production of
pancreatic hormone-expressing endocrine cells from human embryonic stem
cells,” Nature Biotechnology, vol. 24, no. 11, pp. 1392–1401, Nov. 2006.
[14] M. Eiraku, K. Watanabe, M. Matsuo-Takasaki, M. Kawada, S. Yonemura, M.
Matsumura, T. Wataya, A. Nishiyama, K. Muguruma, and Y. Sasai, “SelfOrganized Formation of Polarized Cortical Tissues from ESCs and Its Active
Manipulation by Extrinsic Signals,” Cell Stem Cell, vol. 3, no. 5, pp. 519–532, Nov.
2008.
[15] W. M. Rideout, K. Hochedlinger, M. Kyba, G. Q. Daley, and R. Jaenisch,
“Correction of a Genetic Defect by Nuclear Transplantation and Combined Cell
and Gene Therapy,” Cell, vol. 109, no. 1, pp. 17–27, Apr. 2002.
[16] K. Takahashi, K. Tanabe, M. Ohnuki, M. Narita, T. Ichisaka, K. Tomoda, and S.
Yamanaka, “Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by
Defined Factors,” Cell, vol. 131, no. 5, pp. 861–872, Nov. 2007.
[17] J. Yu, M. A. Vodyanik, K. Smuga-Otto, J. Antosiewicz-Bourget, J. L. Frane, S.
Tian, J. Nie, G. A. Jonsdottir, V. Ruotti, R. Stewart, I. I. Slukvin, and J. A.
Thomson, “Induced Pluripotent Stem Cell Lines Derived from Human Somatic
Cells,” Science, vol. 318, no. 5858, pp. 1917–1920, Dec. 2007.
[18] M. Wernig, A. Meissner, R. Foreman, T. Brambrink, K. Hochedlinger, M. Ku, B. E.
Bernstein, and R. Jaenisch, “In vitro reprogramming of fibroblasts into a
pluripotent ES-cell-like state,” Nature, vol. 448, no. 7151, pp. 318–324, Jul. 2007.
[19] J. Hanna, M. Wernig, S. Markoulaki, C.-W. Sun, A. Meissner, J. P. Cassady, C.
Beard, T. Brambrink, L.-C. Wu, T. M. Townes, and R. Jaenisch, “Treatment of
Sickle Cell Anemia Mouse Model with iPS Cells Generated from Autologous Skin,”
Science, vol. 318, pp. 1920–1923, Dec. 2007.
[20] I.-H. Park, N. Arora, H. Huo, N. Maherali, T. Ahfeldt, A. Shimamura, M. W. Lensch,
C. Cowan, K. Hochedlinger, and G. Q. Daley, “Disease-Specific Induced
Pluripotent Stem Cells,” Cell, vol. 134, no. 5, pp. 877–886, Sep. 2008.
[21] N. Maherali, R. Sridharan, W. Xie, J. Utikal, S. Eminli, K. Arnold, M. Stadtfeld, R.
Yachechko, J. Tchieu, R. Jaenisch, K. Plath, and K. Hochedlinger, “Directly
Reprogrammed Fibroblasts Show Global Epigenetic Remodeling and Widespread
Tissue Contribution,” Cell Stem Cell, vol. 1, no. 1, pp. 55–70, Jun. 2007.
134
[22] S. Nishikawa, R. A. Goldstein, and C. R. Nierras, “The promise of human induced
pluripotent stem cells for research and therapy,” Nature Reviews. Molecular Cell
Biology, vol. 9, pp. 725–729, 2008.
[23] M. Stadtfeld and K. Hochedlinger, “Induced pluripotency: history, mechanisms,
and applications,” Genes & Development, vol. 24, no. 20, pp. 2239–2263, Oct.
2010.
[24] S. M. Wu and K. Hochedlinger, “Harnessing the potential of induced pluripotent
stem cells for regenerative medicine,” Nature Cell Biology, vol. 13, no. 5, pp. 497–
505, May 2011.
[25] F. Soldner, J. Laganière, A. W. Cheng, D. Hockemeyer, Q. Gao, R. Alagappan, V.
Khurana, L. I. Golbe, R. H. Myers, S. Lindquist, L. Zhang, D. Guschin, L. K. Fong,
B. J. Vu, X. Meng, F. D. Urnov, E. J. Rebar, P. D. Gregory, H. S. Zhang, and R.
Jaenisch, “Generation of Isogenic Pluripotent Stem Cells Differing Exclusively at
Two Early Onset Parkinson Point Mutations,” Cell, vol. 146, no. 1, pp. 318–331,
Jul. 2011.
[26] M. Wernig, J.-P. Zhao, J. Pruszak, E. Hedlund, D. Fu, F. Soldner, V. Broccoli, M.
Constantine-Paton, O. Isacson, and R. Jaenisch, “Neurons derived from
reprogrammed fibroblasts functionally integrate into the fetal brain and improve
symptoms of rats with Parkinson’s disease,” Proceedings of the National
Academy of Sciences of the United States of America, vol. 105, no. 15, pp. 5856–
5861, Apr. 2008.
[27] C. N. Mayhew and J. M. Wells, “Converting human pluripotent stem cells into beta
cells: recent advances and future challenges,” Current Opinion in
OrganTransplantation, vol. 15, no. 1, pp. 54–60, 2010.
[28] D. Taura, M. Sone, K. Homma, N. Oyamada, K. Takahashi, N. Tamura, S.
Yamanaka, and K. Nakao, “Induction and Isolation of Vascular Cells From Human
Induced Pluripotent Stem Cells - Brief Report,” Arteriosclerosis, Thrombosis, and
Vascular Biology, vol. 29, no. 7, pp. 1100–1103, Jul. 2009.
[29] M. Stadtfeld, E. Apostolou, H. Akutsu, A. Fukuda, P. Follett, S. Natesan, T. Kono,
T. Shioda, and K. Hochedlinger, “Aberrant silencing of imprinted genes on
chromosome 12qF1 in mouse induced pluripotent stem cells,” Nature, vol. 465, no.
7295, pp. 175–181, May 2010.
[30] “CTGTAC Meeting # 45 Cellular Therapies Derived from Human Embryonic Stem
Cells – Considerations for Pre-Clinical Safety Testing and Patient Monitoring,”
2008.
[31] T. Zhao, Z.-N. Zhang, Z. Rong, and Y. Xu, “Immunogenicity of induced pluripotent
stem cells,” Nature, vol. 474, no. 7350, pp. 212–215, Jan. 2011.
135
[32] K. Fukuda and S. Yuasa, “Stem Cells as a Source of Regenerative
Cardiomyocytes.,” Circulation Research, vol. 98, pp. 1002–1013, Apr. 2006.
[33] A. G. Smith, J. K. Heath, D. D. Donaldson, G. G. Wong, J. Moreau, M. Stahlt, and
D. Rogers, “Inhibition of pluripotential embryonic stem cell differentiation by
purified polypeptides,” Nature, vol. 336, pp. 688–690, 1988.
[34] Q.-L. Ying, J. Wray, J. Nichols, L. Batlle-Morera, B. Doble, J. Woodgett, P. Cohen,
and A. Smith, “The ground state of embryonic stem cell self-renewal,” Nature, vol.
453, no. 7194, pp. 519–523, 2008.
[35] C. Xu, E. Rosler, J. Jiang, J. S. Lebkowski, J. D. Gold, C. O’Sullivan, K. DelavanBoorsma, M. Mok, A. Bronstein, and M. K. Carpenter, “Basic Fibroblast Growth
Factor Supports Undifferentiated Human Embryonic Stem Cell Growth Without
Conditioned Medium,” Stem Cells, vol. 23, no. 3, pp. 315–323, Mar. 2005.
[36] J. B. Lee, J. M. Song, J. E. Lee, J. H. Park, S. J. Kim, S. M. Kang, J. N. Kwon, M.
K. Kim, S. Il Roh, and H. S. Yoon, “Available human feeder cells for the
maintenance of human embryonic stem cells,” Reproduction, vol. 128, pp. 727–
735, Dec. 2004.
[37] C. Xu, M. S. Inokuma, J. Denham, K. Golds, P. Kundu, J. D. Gold, and M. K.
Carpenter, “Feeder-free growth of undifferentiated human embryonic stem cells,”
Nature Biotechnology, vol. 19, no. 10, pp. 971–974, Oct. 2001.
[38] T. E. Ludwig, M. E. Levenstein, J. M. Jones, W. T. Berggren, E. R. Mitchen, J. L.
Frane, L. J. Crandall, C. A. Daigh, K. R. Conard, M. S. Piekarczyk, R. A. Llanas,
and J. A. Thomson, “Derivation of human embryonic stem cells in defined
conditions,” Nature Biotechnology, vol. 24, no. 2, pp. 185–187, Feb. 2006.
[39] L. A. Boyer, D. Mathur, and R. Jaenisch, “Molecular control of pluripotency,”
Current Opinion in Genetics & Development, vol. 16, no. 5, pp. 455–462, 2006.
[40] L. A. Boyer, T. I. Lee, M. F. Cole, S. E. Johnstone, S. S. Levine, J. P. Zucker, M.
G. Guenther, R. M. Kumar, H. L. Murray, R. G. Jenner, D. K. Gifford, D. A. Melton,
R. Jaenisch, and R. A. Young, “Core Transcriptional Regulatory Circuitry in
Human Embryonic Stem Cells,” Cell, vol. 122, no. 6, pp. 947–956, Sep. 2005.
[41] Y.-H. Loh, Q. Wu, J.-L. Chew, V. B. Vega, W. Zhang, X. Chen, G. Bourque, J.
George, B. Leong, K.-Y. Wong, J. Liu, K. W. Sung, X.-D. Zhao, C. W. H. Lee, K.-P.
Chiu, L. Lipovich, V. A. Kuznetsov, P. Robson, L. W. Stanton, C.-L. Wei, Y. Ruan,
B. Lim, and H.-H. Ng, “The Oct4 and Nanog transcription network regulates
pluripotency in mouse embryonic stem cells,” Nature Genetics, vol. 38, pp. 431–
440, Apr. 2006.
136
[42] H.-H. Ng and M. A. Surani, “The transcriptional and signalling networks of
pluripotency,” Nature Cell Biology, vol. 13, no. 5, pp. 490–496, May 2011.
[43] R. A. Young, “Control of the Embryonic Stem Cell State,” Cell, vol. 144, no. 6, pp.
940–954, Mar. 2011.
[44] D. Zeineddine, E. Papadimou, K. Chebli, M. Gineste, J. Liu, C. Grey, S. Thurig, A.
Behfar, V. A. Wallace, I. S. Skerjanc, and M. Pucéat, “Oct-3/4 dose dependently
regulates specification of embryonic stem cells toward a cardiac lineage and early
heart development.,” Developmental Cell, vol. 11, no. 4, pp. 535–546, Oct. 2006.
[45] H. Niwa, J. Miyazaki, and A. G. Smith, “Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells,” Nature Genetics, vol.
24, no. 4, pp. 372–376, Apr. 2000.
[46] H. Niwa, Y. Toyooka, D. Shimosato, D. Strumpf, K. Takahashi, R. Yagi, and J.
Rossant, “Interaction between Oct3/4 and Cdx2 Determines Trophectoderm
Differentiation,” Cell, vol. 123, no. 5, pp. 917–929, Dec. 2005.
[47] R. T. Rodriguez, J. M. Velkey, C. Lutzko, R. Seerke, D. B. Kohn, K. S. O’Shea,
and M. T. Firpo, “Manipulation of OCT4 Levels in Human Embryonic Stem Cells
Results in Induction of Differential Cell Types,” Experimental Biology and
Medicine, vol. 232, no. 10, pp. 1368–1380, Nov. 2007.
[48] M. Thomson, S. J. Liu, L.-N. Zou, Z. Smith, A. Meissner, and S. Ramanathan,
“Pluripotency Factors in Embryonic Stem Cells Regulate Differentiation into Germ
Layers,” Cell, vol. 145, no. 6, pp. 875–889, Jun. 2011.
[49] A. M. Singh, T. Hamazaki, K. E. Hankowski, and N. Terada, “A Heterogeneous
Expression Pattern for Nanog in Embryonic Stem Cells,” Stem Cells, vol. 25, no.
10, pp. 2534–2542, Oct. 2007.
[50] I. Chambers, J. Silva, D. Colby, J. Nichols, B. Nijmeijer, M. Robertson, J. Vrana, K.
Jones, L. Grotewold, and A. Smith, “Nanog safeguards pluripotency and mediates
germline development,” Nature, vol. 450, no. 7173, pp. 1230–1234, 2007.
[51] P. Yu, G. Pan, J. Yu, and J. A. Thomson, “FGF2 Sustains NANOG and Switches
the Outcome of BMP4-Induced Human Embryonic Stem Cell Differentiation,” Cell
Stem Cell, vol. 8, no. 3, pp. 326–334, Mar. 2011.
[52] Y. Toyooka, D. Shimosato, K. Murakami, K. Takahashi, and H. Niwa,
“Identification and characterization of subpopulations in undifferentiated ES cell
culture,” Development, vol. 135, no. 5, pp. 909–918, Mar. 2008.
137
[53] K. Hayashi, S. M. C. D. S. Lopes, F. Tang, and M. A. Surani, “Dynamic
Equilibrium and Heterogeneity of Mouse Pluripotent Stem Cells with Distinct
Functional and Epigenetic States,” Cell Stem Cell, vol. 3, pp. 391–401, Oct. 2008.
[54] K. M. Loh and B. Lim, “A Precarious Balance: Pluripotency Factors as Lineage
Specifiers.,” Cell Stem Cell, vol. 8, pp. 363–369, Apr. 2011.
[55] D. A. F. Loebel, C. M. Watson, R. A. De Young, and P. P. L. Tam, “Lineage
choice and differentiation in mouse embryos and embryonic stem cells,”
Developmental Biology, vol. 264, pp. 1–14, Dec. 2003.
[56] D. E. Cohen and D. Melton, “Turning straw into gold: directing cell fate for
regenerative medicine,” Nature Reviews. Genetics, vol. 12, no. 4, pp. 243–252,
Apr. 2011.
[57] A. M. Becker, M. Rubart, and L. J. Field, “Inducing Embryonic Stem Cells to
Become Cardiomyocytes,” in Regenerating the Heart, I. S. Cohen and G. R.
Gaudette, Eds. Totowa, NJ: Humana Press, 2011, pp. 7–24.
[58] S. J. Kattman, A. D. Witty, M. Gagliardi, N. C. Dubois, M. Niapour, A. Hotta, J.
Ellis, and G. Keller, “Stage-Specific Optimization of Activin/Nodal and BMP
Signaling Promotes Cardiac Differentiation of Mouse and Human Pluripotent
Stem Cell Lines,” Cell Stem Cell, vol. 8, pp. 228–240, Feb. 2011.
[59] C. Xu, S. Police, N. Rao, and M. K. Carpenter, “Characterization and Enrichment
of Cardiomyocytes Derived From Human Embryonic Stem Cells,” Circulation
Research, vol. 91, no. 6, pp. 501–508, Aug. 2002.
[60] T. Takahashi, B. Lord, P. C. Schulze, R. M. Fryer, S. S. Sarang, S. R. Gullans,
and R. T. Lee, “Ascorbic Acid Enhances Differentiation of Embryonic Stem Cells
into Cardiac Myocytes,” Circulation, vol. 107, no. 14, pp. 1912–1916, Apr. 2003.
[61] A. Behfar, C. Perez-Terzic, R. S. Faustino, D. K. Arrell, D. M. Hodgson, S.
Yamada, M. Puceat, N. Niederländer, A. E. Alekseev, L. V Zingman, and A.
Terzic, “Cardiopoietic programming of embryonic stem cells for tumor-free heart
repair.,” The Journal of Experimental Medicine, vol. 204, no. 2, pp. 405–420, Feb.
2007.
[62] R. Passier, D. Ward-van Oostwaard, J. Snapper, J. Kloots, R. J. Hassink, E. Kuijk,
B. Roelen, A. B. de la Riviere, and C. Mummery, “Increased Cardiomyocyte
Differentiation from Human Embryonic Stem Cells in Serum-Free Cultures,” Stem
Cells, vol. 23, pp. 772–780, 2005.
[63] L. Warren, P. D. Manos, T. Ahfeldt, Y.-H. Loh, H. Li, F. Lau, W. Ebina, P. K.
Mandal, Z. D. Smith, A. Meissner, G. Q. Daley, A. S. Brack, J. J. Collins, C.
Cowan, T. M. Schlaeger, and D. J. Rossi, “Highly Efficient Reprogramming to
138
Pluripotency and Directed Differentiation of Human Cells with Synthetic Modified
mRNA,” Cell Stem Cell, vol. 7, no. 5, pp. 618–630, Nov. 2010.
[64] S. Zhu, H. Wurdak, J. Wang, C. A. Lyssiotis, E. C. Peters, C. Y. Cho, X. Wu, and
P. G. Schultz, “A Small Molecule Primes Embryonic Stem Cells for Differentiation,”
Cell Stem Cell, vol. 4, no. 5, pp. 416–426, May 2009.
[65] G. Narazaki, H. Uosaki, M. Teranishi, K. Okita, B. Kim, S. Matsuoka, S.
Yamanaka, and J. K. Yamashita, “Directed and Systematic Differentiation of
Cardiovascular Cells From Mouse Induced Pluripotent Stem Cells,” Circulation,
vol. 118, no. 5, pp. 498–506, Jul. 2008.
[66] E. Kroon, L. A. Martinson, K. Kadoya, A. G. Bang, O. G. Kelly, S. Eliazer, H.
Young, M. Richardson, N. G. Smart, J. Cunningham, A. D. Agulnick, K. A.
D’Amour, M. K. Carpenter, and E. E. Baetge, “Pancreatic endoderm derived from
human embryonic stem cells generates glucose-responsive insulin-secreting cells
in vivo,” Nature Biotechnology, vol. 26, no. 4, pp. 443–452, Apr. 2008.
[67] M. Bengtsson, A. Ståhlberg, P. Rorsman, and M. Kubista, “Gene expression
profiling in single cells from the pancreatic islets of Langerhans reveals lognormal
distribution of mRNA levels,” Genome Research, vol. 15, no. 10, pp. 1388–1392,
Oct. 2005.
[68] A. Raj, C. S. Peskin, D. Tranchina, D. Y. Vargas, and S. Tyagi, “Stochastic mRNA
Synthesis in Mammalian Cells,” PLoS biology, vol. 4, no. 10, pp. 1707–1719, Oct.
2006.
[69] A. Sigal, R. Milo, A. Cohen, N. Geva-Zatorsky, Y. Klein, Y. Liron, N. Rosenfeld, T.
Danon, N. Perzov, and U. Alon, “Variability and memory of protein levels in
human cells,” Nature, vol. 444, no. 7119, pp. 643–646, 2006.
[70] J. M. Levsky and R. H. Singer, “Gene expression and the myth of the average
cell,” Trends in Cell Biology, vol. 13, no. 1, pp. 4–6, 2003.
[71] S. J. Altschuler and L. F. Wu, “Cellular Heterogeneity: Do Differences Make a
Difference?,” Cell, vol. 141, no. 4, pp. 559–563, May 2010.
[72] H. H. Chang, M. Hemberg, M. Barahona, D. E. Ingber, and S. Huang,
“Transcriptome-wide noise controls lineage choice in mammalian progenitor cells,”
Nature, vol. 453, no. 7194, pp. 544–547, 2008.
[73] M. A. Canham, A. A. Sharov, M. S. H. Ko, and J. M. Brickman, “Functional
Heterogeneity of Embryonic Stem Cells Revealed through Translational
Amplification of an Early Endodermal Transcript,” PLoS Biology, vol. 8, no. 5, p.
e1000379, May 2010.
139
[74] K. H. Narsinh, N. Sun, V. Sanchez-Freire, A. S. Lee, P. Almeida, S. Hu, T. Jan, K.
D. Wilson, D. Leong, J. Rosenberg, M. Yao, R. C. Robbins, and J. C. Wu, “Single
cell transcriptional profiling reveals heterogeneity of human induced pluripotent
stem cells,” The Journal of Clinical Investigation, vol. 121, no. 3, pp. 1217–1221,
Mar. 2011.
[75] M. F. Pera and P. P. L. Tam, “Extrinsic regulation of pluripotent stem cells,”
Nature, vol. 465, no. 7299, pp. 713–720, Jun. 2010.
[76] A. M. Singh and N. Terada, “Bypassing Heterogeneity: The Road to Embryonic
Stem Cell-Derived Cardiomyocyte Specification,” Trends in Cardiovascular
Medicine, vol. 17, no. 3, pp. 96–101, 2007.
[77] M. Elowitz, A. Levine, and E. Siggia, “Stochastic gene expression in a single cell,”
Science, vol. 297, pp. 1183–1186, 2002.
[78] M. Kaern, T. C. Elston, W. J. Blake, and J. J. Collins, “Stochasticity in gene
expression: from theories to phenotypes.,” Nature Reviews. Genetics, vol. 6, pp.
451–464, Jun. 2005.
[79] T.-L. To and N. Maheshri, “Noise Can Induce Bimodality in Positive
Transcriptional Feedback Loops Without Bistability,” Science, vol. 327, no. 5969,
pp. 1142–1145, Feb. 2010.
[80] S. Huang, “Non-genetic heterogeneity of cells in development: more than just
noise,” Development, vol. 136, pp. 3853–3862, Dec. 2009.
[81] M. Intaglietta, P. C. Johnson, and R. M. Winslow, “Microvascular and tissue
oxygen distribution,” Cardiovascular Research, vol. 32, pp. 632–643, Oct. 1996.
[82] P. W. Soothill, K. H. Nicolaides, C. H. Rodeck, and S. Campbell, “Effect of
Gestational Age on Fetal and Intervillous Blood Gas and Acid-Base Values in
Human Pregnancy,” Fetal Diagnosis and Therapy, vol. 1, no. 4, pp. 168–175,
1986.
[83] O. Siggaard-Andersen and R. Huch, “The oxygen status of fetal blood,” Acta
Anaesthesiologica Scandinavica, vol. 39, no. Supplementum 107, pp. 129–135,
Jan. 1995.
[84] E. Jauniaux, B. Gulbis, and G. J. Burton, “Physiological implications of the
materno–fetal oxygen gradient in human early pregnancy,” Reproductive
BioMedicine Online, vol. 7, no. 2, pp. 250–253, 2003.
[85] Y. M. Lee, C.-H. Jeong, S.-Y. Koo, M. J. Son, H. S. Song, S.-K. Bae, J. A. Raleigh,
H.-Y. Chung, M.-A. Yoo, and K.-W. Kim, “Determination of Hypoxic Region by
Hypoxia Marker in Developing Mouse Embryos In Vivo: A Possible Signal for
140
Vessel Development,” Developmental Dynamics, vol. 220, pp. 175–186, Feb.
2001.
[86] S. C. Land, “Hochachka’s ‘Hypoxia Defense Strategies’ and the development of
the pathway for oxygen,” Comparative Biochemistry and Physiology. Part B,
Biochemistry & Molecular Biology, vol. 139, no. 3, pp. 415–433, Nov. 2004.
[87] E. Jauniaux, B. Gulbis, and G. J. Burton, “The Human First Trimester Gestational
Sac Limits Rather than Facilitates Oxygen Transfer to the Foetus - A Review,”
Placenta, vol. 24, no. Suppl A, pp. S86–S93, Apr. 2003.
[88] R. H. Wenger, I. Kvietikova, A. Rolfs, M. Gassmann, and H. H. Marti, “Hypoxiainducible factor-1alpha is regulated at the post-mRNA level,” Kidney International,
vol. 51, pp. 560–563, 1997.
[89] G. L. Wang, B.-H. Jiang, E. A. Rue, and G. L. Semenza, “Hypoxia-inducible factor
1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension,”
Proceedings of the National Academy of Sciences of the United States of America,
vol. 92, no. 12, pp. 5510–5514, Jun. 1995.
[90] B.-H. Jiang, G. L. Semenza, C. Bauer, and H. H. Marti, “Hypoxia-inducible factor
1 levels vary exponentially over a physiologically relevant range of O2 tension,”
The American Journal of Physiology, vol. 271, no. 4, pp. C1172–C1180, Oct.
1996.
[91] C.-J. Hu, L.-Y. Wang, L. A. Chodosh, B. Keith, and M. C. Simon, “Differential
Roles of Hypoxia-Inducible Factor 1alpha (HIF-1alpha) and HIF-2alpha in Hypoxic
Gene Regulation,” Molecular and Cellular Biology, vol. 23, no. 24, pp. 9361–9374,
2003.
[92] F. Wang, S. Thirumangalathu, and M. R. Loeken, “Establishment of New Mouse
Embryonic Stem Cell Lines Is Improved by Physiological Glucose and Oxygen,”
Cloning and Stem Cells, vol. 8, no. 2, pp. 108–116, Jan. 2006.
[93] J. Gibbons, E. Hewitt, and D. K. Gardner, “Effects of Oxygen Tension on the
Establishment and Lactate Dehydrogenase Activity of Murine Embryonic Stem
Cells,” Cloning and Stem Cells, vol. 8, no. 2, pp. 117–122, 2006.
[94] C. J. Lengner, A. a Gimelbrant, J. a Erwin, A. W. Cheng, M. G. Guenther, G. G.
Welstead, R. Alagappan, G. M. Frampton, P. Xu, J. Muffat, S. Santagata, D.
Powers, C. B. Barrett, R. a Young, J. T. Lee, R. Jaenisch, and M. Mitalipova,
“Derivation of Pre-X Inactivation Human Embryonic Stem Cells under
Physiological Oxygen Concentrations,” Cell, vol. 141, pp. 872–883, May 2010.
[95] C.-H. Jeong, H.-J. Lee, J.-H. Cha, J. H. Kim, K. R. Kim, J.-H. Kim, D.-K. Yoon,
and K.-W. Kim, “Hypoxia-inducible Factor-1alpha Inhibits Self-Renewal of Mouse
141
Embryonic Stem Cells in Vitro via Negative Regulation of the Leukemia Inhibitory
Factor-STAT3 Pathway,” The Journal of Biological Chemistry, vol. 282, no. 18, pp.
13672–13679, May 2007.
[96] D. E. Powers, J. R. Millman, R. B. Huang, and C. K. Colton, “Effects of Oxygen on
Mouse Embryonic Stem Cell Growth, Phenotype Retention, and Cellular
Energetics,” Biotechnology and Bioengineering, vol. 101, no. 2, pp. 241–254, Oct.
2008.
[97] N. R. Forsyth, A. Musio, P. Vezzoni, A. H. R. W. Simpson, B. S. Noble, and J.
McWhir, “Physiologic Oxygen Enhances Human Embryonic Stem Cell Clonal
Recovery and Reduces Chromosomal Abnormalities,” Cloning and Stem Cells,
vol. 8, no. 1, pp. 16–23, Jan. 2006.
[98] S. D. Westfall, S. Sachdev, P. Das, L. B. Hearne, M. Hannink, R. M. Roberts, and
T. Ezashi, “Identification of Oxygen-Sensitive Transcriptional Programs in Human
Embryonic Stem Cells,” Stem Cells and Development, vol. 17, no. 5, pp. 869–881,
Oct. 2008.
[99] S. M. Prasad, M. Czepiel, C. Cetinkaya, K. Smigielska, S. C. Weli, H. Lysdahl, A.
Gabrielsen, K. Petersen, N. Ehlers, T. Fink, S. L. Minger, and V. Zachar,
“Continuous hypoxic culturing maintains activation of Notch and allows long-term
propagation of human embryonic stem cells without spontaneous differentiation,”
Cell Proliferation, vol. 42, no. 1, pp. 63–74, 2009.
[100] C. E. Forristal, K. L. Wright, N. a Hanley, R. O. C. Oreffo, and F. D. Houghton,
“Hypoxia inducible factors regulate pluripotency and proliferation in human
embryonic stem cells cultured at reduced oxygen tensions,” Reproduction, vol.
139, pp. 85–97, Jan. 2010.
[101] N. R. Forsyth, A. Kay, K. Hampson, A. Downing, R. Talbot, and J. McWhir,
“Transcriptome alterations due to physiological normoxic (2% O2) culture of
human embryonic stem cells,” Regenerative Medicine, vol. 3, no. 6, pp. 817–833,
Nov. 2008.
[102] T. Ezashi, P. Das, and R. M. Roberts, “Low O2 tensions and the prevention of
differentiation of hES cells,” Proceedings of the National Academy of Sciences of
the United States of America, vol. 102, no. 13, pp. 4783–4788, 2005.
[103] M. V Gustafsson, X. Zheng, T. Pereira, K. Gradin, S. Jin, J. Lundkvist, J. L. Ruas,
L. Poellinger, U. Lendahl, and M. Bondesson, “Hypoxia Requires Notch Signaling
to Maintain the Undifferentiated Cell State,” Developmental Cell, vol. 9, pp. 617–
628, Nov. 2005.
[104] K. L. Covello, J. Kehler, H. Yu, J. D. Gordan, A. M. Arsham, C.-J. Hu, P. A.
Labosky, M. C. Simon, and B. Keith, “HIF-2alpha regulates Oct-4: effects of
142
hypoxia on stem cell function, embryonic development, and tumor growth,” Genes
& Development, vol. 20, pp. 557–570, Mar. 2006.
[105] Z. Hewitt, N. R. Forsyth, M. Waterfall, D. Wojtacha, A. J. Thomson, and J. McWhir,
“Fluorescence-Activated Single Cell Sorting of Human Embryonic Stem Cells,”
Cloning and Stem Cells, vol. 8, no. 3, pp. 225–234, Jan. 2006.
[106] Y. Yoshida, K. Takahashi, K. Okita, T. Ichisaka, and S. Yamanaka, “Hypoxia
Enhances the Generation of Induced Pluripotent Stem Cells,” Cell Stem Cell, vol.
5, no. 3, pp. 237–241, Sep. 2009.
[107] J. Hanna, K. Saha, B. Pando, J. van Zon, C. J. Lengner, M. P. Creyghton, A. van
Oudenaarden, and R. Jaenisch, “Direct cell reprogramming is a stochastic
process amenable to acceleration,” Nature, vol. 462, pp. 595–601, Dec. 2009.
[108] D. E. Powers, J. R. Millman, S. Bonner-Weir, M. J. Rappel, and C. K. Colton,
“Accurate Control of Oxygen Level in Cells During Culture on Silicone Rubber
Membranes with Application to Stem Cell Differentiation,” Biotechnology Progress,
vol. 26, no. 3, pp. 805–818, 2009.
[109] M. C. Simon and B. Keith, “The role of oxygen availability in embryonic
development and stem cell function,” Nature Reviews. Molecular Cell Biology, vol.
9, no. 4, pp. 285–296, Apr. 2008.
[110] T.-S. Kim, S. Misumi, C.-G. Jung, T. Masuda, Y. Isobe, F. Furuyama, H. Nishino,
and H. Hida, “Increase in Dopaminergic Neurons From Mouse Embryonic Stem
Cell-Derived Neural Progenitor/Stem Cells Is Mediated by Hypoxia Inducible
Factor-1alpha,” Journal of Neuroscience Research, vol. 86, pp. 2353–2362, Aug.
2008.
[111] P. Mondragon-Teran, G. J. Lye, and F. S. Veraitch, “Lowering Oxygen Tension
Enhances the Differentiation of Mouse Embryonic Stem Cells into Neuronal Cells,”
Biotechnology Progress, vol. 25, no. 5, pp. 1480–1488, 2009.
[112] C. Bauwens, T. Yin, S. Dang, R. Peerani, and P. W. Zandstra, “Development of a
Perfusion Fed Bioreactor for Embryonic Stem Cell-Derived Cardiomyocyte
Generation: Oxygen-Mediated Enhancement of Cardiomyocyte Output.,”
Biotechnology and Bioengineering, vol. 90, no. 4, pp. 452–461, May 2005.
[113] K. A. Purpura, S. H. L. George, S. M. Dang, K. Choi, A. Nagy, and P. W. Zandstra,
“Soluble Flt-1 Regulates Flk-1 Activation to Control Hematopoietic and Endothelial
Development in an Oxygen-Responsive Manner,” Stem Cells, vol. 26, no. 11, pp.
2832–2842, Nov. 2008.
[114] S. Niebruegge, C. L. Bauwens, R. Peerani, N. Thavandiran, S. Masse, E.
Sevaptisidis, K. Nanthakumar, K. Woodhouse, M. Husain, E. Kumacheva, and P.
143
W. Zandstra, “Generation of Human Embryonic Stem Cell-Derived Mesoderm and
Cardiac Cells Using Size-Specified Aggregates in an Oxygen-Controlled
Bioreactor,” Biotechnology and Bioengineering, vol. 102, no. 2, pp. 493–507, Feb.
2009.
[115] E. J. Koay and K. A. Athanasiou, “Hypoxic chondrogenic differentiation of human
embryonic stem cells enhances cartilage protein synthesis and biomechanical
functionality,” Osteoarthritis and Cartilage, vol. 16, pp. 1450–1456, Dec. 2008.
[116] C. A. V Rodrigues, M. M. Diogo, C. L. da Silva, and J. M. S. Cabral, “Hypoxia
Enhances Proliferation of Mouse Embryonic Stem Cell-Derived Neural Stem
Cells,” Biotechnology and Bioengineering, vol. 106, no. 2, pp. 260–270, Jun. 2010.
[117] J. R. Millman, D. E. Powers, R. E. Yu, J. Paul, G. M. Dula, B. Chevva, J. Paulo, M.
M. Almeida, J. H. Tan, and C. K. Colton, “Differentiation of pluripotent stem cells
under low oxygen increases generation of cardiomyocytes and influences
differentiation to ectoderm, mesoderm, and endoderm,” (in preparation).
[118] X. Yuan, W. Li, and S. Ding, “Small Molecules in Cellular Reprogramming and
Differentiation,” in Epigenetics and Disease, S. M. Gasser and E. Li, Eds. Basel:
Springer Basel, 2011, pp. 253–266.
[119] J. Bain, L. Plater, M. Elliott, N. Shpiro, C. J. Hastie, H. McLauchlan, I. Klevernic, J.
S. C. Arthur, D. R. Alessi, and P. Cohen, “The selectivity of protein kinase
inhibitors: a further update,” The Biochemical Journal, vol. 408, no. 3, pp. 297–
315, Dec. 2007.
[120] D. B. Ring, K. W. Johnson, E. J. Henriksen, J. M. Nuss, D. Goff, T. R. Kinnick, S.
T. Ma, J. W. Reeder, I. Samuels, T. Slabiak, A. S. Wagman, M.-E. W. Hammond,
and S. D. Harrison, “Selective Glycogen Synthase Kinase 3 Inhibitors Potentiate
Insulin Activation of Glucose Transport and Utilization In Vitro and In Vivo,”
Diabetes, vol. 52, pp. 588–595, 2003.
[121] J. Silva, O. Barrandon, J. Nichols, J. Kawaguchi, T. W. Theunissen, and A. Smith,
“Promotion of Reprogramming to Ground State Pluripotency by Signal Inhibition,”
PLoS biology, vol. 6, no. 10, pp. 2237–2247, Oct. 2008.
[122] S. F. Gilbert, Developmental Biology, Eighth Edi. Sinauer Associates Inc., 2006.
[123] B. Greber, G. Wu, C. Bernemann, J. Y. Joo, D. W. Han, K. Ko, N. Tapia, D.
Sabour, J. Sterneckert, P. Tesar, and H. R. Schöler, “Conserved and Divergent
Roles of FGF Signaling in Mouse Epiblast Stem Cells and Human Embryonic
Stem Cells,” Cell Stem Cell, vol. 6, pp. 215–226, Mar. 2010.
[124] J. Hanna, A. W. Cheng, K. Saha, J. Kim, C. J. Lengner, F. Soldner, J. P. Cassady,
J. Muffat, B. W. Carey, and R. Jaenisch, “Human embryonic stem cells with
144
biological and epigenetic characteristics similar to those of mouse ESCs,”
Proceedings of the National Academy of Sciences of the United States of America,
vol. 107, no. 20, pp. 9222–9227, 2010.
[125] H. Tsutsui, B. Valamehr, A. Hindoyan, R. Qiao, X. Ding, S. Guo, O. N. Witte, X.
Liu, C.-M. Ho, and H. Wu, “An optimized small molecule inhibitor cocktail supports
long-term maintenance of human embryonic stem cells,” Nature communications,
vol. 2, no. 167, pp. 1–8, Jan. 2011.
[126] L. L. Rubin and K. M. Haston, “Stem cell biology and drug discovery,” BMC
Biology, vol. 9, no. 42, Jan. 2011.
[127] C. E. Murry and G. Keller, “Differentiation of Embryonic Stem Cells to Clinically
Relevant Populations: Lessons from Embryonic Development,” Cell, vol. 132, pp.
661–680, 2008.
[128] V. Camara-Clayette, F. Le Pesteur, W. Vainchenker, and F. Sainteny,
“Quantitative Oct4 Overproduction in Mouse Embryonic Stem Cells Results in
Prolonged Mesoderm Commitment During Hematopoietic Differentiation In Vitro,”
Stem Cells, vol. 24, pp. 1937–1945, 2006.
[129] S. Stefanovic, N. Abboud, S. Désilets, D. Nury, C. Cowan, and M. Pucéat,
“Interplay of Oct4 with Sox2 and Sox17: a molecular switch from stem cell
pluripotency to specifying a cardiac fate,” The Journal of Cell Biology, vol. 186, no.
5, pp. 665–673, Sep. 2009.
[130] Y. Il Yeom, G. Fuhrmann, C. E. Ovitt, A. Brehm, K. Ohbo, M. Gross, K. Hubner,
and H. R. Scholer, “Germline regulatory element of Oct-4 specific for the
totipotent cycle of embryonal cells,” Development, vol. 122, no. 3, pp. 881–894,
1996.
[131] J. H. Hanna, K. Saha, and R. Jaenisch, “Pluripotency and Cellular
Reprogramming: Facts, Hypotheses, Unresolved Issues,” Cell, vol. 143, pp. 508–
525, Nov. 2010.
[132] Q. Zhou, H. Chipperfield, D. A. Melton, and W. H. Wong, “A gene regulatory
network in mouse embryonic stem cells,” Proceedings of the National Academy of
Sciences of the United States of America, vol. 104, no. 42, pp. 16438–16443, Oct.
2007.
[133] J. V Watson, S. H. Chambers, and P. J. Smith, “A Pragmatic Approach to the
Analysis of DNA Histograms With a Definable G1 Peak,” Cytometry, vol. 8, no. 1,
pp. 1–8, 1987.
[134] E. Stead, J. White, R. Faast, S. Conn, S. Goldstone, J. Rathjen, U. Dhingra, P.
Rathjen, D. Walker, and S. Dalton, “Pluripotent cell division cycles are driven by
145
ectopic Cdk2, cyclin A/E and E2F activities,” Oncogene, vol. 21, no. 54, pp. 8320–
8333, Nov. 2002.
[135] D. Strumpf, C.-A. Mao, Y. Yamanaka, A. Ralston, K. Chawengsaksophak, F. Beck,
and J. Rossant, “Cdx2 is required for correct cell fate specification and
differentiation of trophectoderm in the mouse blastocyst,” Development, vol. 132,
no. 9, pp. 2093–2102, May 2005.
[136] M. Kanai-Azuma, Y. Kanai, J. M. Gad, Y. Tajima, C. Taya, M. Kurohmaru, Y.
Sanai, H. Yonekawa, K. Yazaki, P. P. L. Tam, and Y. Hayashi, “Depletion of
definitive gut endoderm in Sox17-null mutant mice,” Development, vol. 129, pp.
2367–2379, May 2002.
[137] U. Lendahl, L. B. Zimmerman, and R. D. G. McKay, “CNS Stem Cells Express a
New Class of Intermediate Filament Protein,” Cell, vol. 60, pp. 585–595, Mar.
1990.
[138] D. Bader, T. Masaki, and D. A. Fischman, “Immunochemical Analysis of Myosin
Heavy Chain during Avian Myogenesis In Vivo and In Vitro.,” The Journal of Cell
Biology, vol. 95, no. 3, pp. 763–770, Dec. 1982.
[139] J. Xavier-Neto, C. M. Neville, M. D. Shapiro, L. Houghton, G. F. Wang, W.
Nikovits, F. E. Stockdale, and N. Rosenthal, “A retinoic acid-inducible transgenic
marker of sino-atrial development in the mouse heart,” Development, vol. 126, no.
12, pp. 2677–2687, Jun. 1999.
[140] J. R. Millman, “Effects of Low Oxygen Culture on Pluripotent Stem Cell
Differentiation and Tumor Formation,” Massachusetts Institute of Technology,
2011.
[141] J. R. Millman, R. E. Yu, G. M. Dula, J. Paul, B. Chevva, J. H. Tan, and C. K.
Colton, “Extended low oxygen culture of pluripotent stem cells reduces the
fraction of residual tumor-forming cells in differentiated populations,” (in
preparation).
[142] D. A. Sassoon, I. Garner, and M. Buckingham, “Transcripts of alpha-cardiac and
alpha-skeletal actins are early markers for myogenesis in the mouse embryo,”
Development, vol. 104, no. 1, pp. 155–164, Sep. 1988.
[143] Q. Wang, R. S. Reiter, Q.-Q. Huang, J.-P. Jin, and J. J.-C. Lin, “Comparative
Studies on the Expression Patterns of Three Troponin T Genes During Mouse
Development,” The Anatomical Record, vol. 263, no. 1, pp. 72–84, May 2001.
[144] S. Masui, Y. Nakatake, Y. Toyooka, D. Shimosato, R. Yagi, K. Takahashi, H.
Okochi, A. Okuda, R. Matoba, A. A. Sharov, M. S. H. Ko, and H. Niwa,
146
“Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse
embryonic stem cells,” Nature Cell Biology, vol. 9, no. 6, pp. 625–635, Jun. 2007.
[145] A. Raj and A. van Oudenaarden, “Nature, Nurture, or Chance: Stochastic Gene
Expression and Its Consequences,” Cell, vol. 135, no. 2, pp. 216–226, 2008.
[146] A. Peixoto, M. Monteiro, B. Rocha, and H. Veiga-Fernandes, “Quantification of
Multiple Gene Expression in Individual Cells,” Genome Research, vol. 14, no. 10A,
pp. 1938–1947, Oct. 2004.
[147] V. Tropepe, S. Hitoshi, C. Sirard, T. W. Mak, J. Rossant, and D. van der Kooy,
“Direct Neural Fate Specification from Embryonic Stem Cells: A Primitive
Mammalian Neural Stem Cell Stage Acquired through a Default Mechanism,”
Neuron, vol. 30, no. 1, pp. 65–78, Apr. 2001.
[148] S. Labeit and B. Kolmerer, “Titins: Giant Proteins in Charge of Muscle
Ultrastructure and Elasticity,” Science, vol. 270, no. 5234, pp. 293–296, Oct. 1995.
[149] J. Silva, J. Nichols, T. W. Theunissen, G. Guo, A. L. van Oosten, O. Barrandon, J.
Wray, S. Yamanaka, I. Chambers, and A. Smith, “Nanog is the Gateway to the
Pluripotent Ground State,” Cell, vol. 138, no. 4, pp. 722–737, Aug. 2009.
[150] M. Saitou, S. C. Barton, and M. A. Surani, “A molecular programme for the
specification of germ cell fate in mice,” Nature, vol. 418, no. 6895, pp. 293–300,
Jul. 2002.
[151] Y. Ohinata, B. Payer, D. O’Carroll, K. Ancelin, Y. Ono, M. Sano, S. C. Barton, T.
Obukhanych, M. Nussenzweig, A. Tarakhovsky, M. Saitou, and M. A. Surani,
“Blimp1 is a critical determinant of the germ cell lineage in mice,” Nature, vol. 436,
no. 7048, pp. 207–213, Jul. 2005.
[152] O. Haub and M. Goldfarb, “Expression of the fibroblast growth factor-5 gene in the
mouse embryo,” Development, vol. 112, pp. 397–406, Jun. 1991.
[153] M. Ekerot, M. P. Stavridis, L. Delavaine, M. P. Mitchell, C. Staples, D. M. Owens, I.
D. Keenan, R. J. Dickinson, K. G. Storey, and S. M. Keyse, “Negative-feedback
regulation of FGF signalling by DUSP6/MKP-3 is driven by ERK1/2 and mediated
by Ets factor binding to a conserved site within the DUSP6/MKP-3 gene promoter,”
The Biochemical Journal, vol. 412, no. 2, pp. 287–298, Jun. 2008.
[154] F. Lanner and J. Rossant, “The role of FGF/Erk signaling in pluripotent cells,”
Development, vol. 137, pp. 3351–3360, Oct. 2010.
[155] N. Sato, L. Meijer, L. Skaltsounis, P. Greengard, and A. H. Brivanlou,
“Maintenance of pluripotency in human and mouse embryonic stem cells through
147
activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor,” Nature
Medicine, vol. 10, no. 1, pp. 55–63, Jan. 2004.
[156] H. P. Garnir and F. S. Garnirmonjoie, “Fit of the function y(x) = A [1 − exp(−kx)] to
data strongly embedded in noise,” Nuclear Instruments and Methods in Physics
Research, vol. 190, pp. 333–336, Dec. 1981.
[157] P. J. Tesar, J. G. Chenoweth, F. A. Brook, T. J. Davies, E. P. Evans, D. L. Mack,
R. L. Gardner, and R. D. G. McKay, “New cell lines from mouse epiblast share
defining features with human embryonic stem cells,” Nature, vol. 448, no. 7150,
pp. 196–199, Jul. 2007.
[158] J. Livet, T. A. Weissman, H. Kang, R. W. Draft, J. Lu, R. A. Bennis, J. R. Sanes,
and J. W. Lichtman, “Transgenic strategies for combinatorial expression of
fluorescent proteins in the nervous system,” Nature, vol. 450, pp. 56–62, Nov.
2007.
[159] MarketResearch.com, “Market Research Projects Stem Cell Market at $1.3 Billion
by 2015,” 2011. [Online]. Available: http://finance.yahoo.com/news/marketresearch-projects-stem-cell-120800551.html. [Accessed: 01-May-2013].
[160] A. Son, “IBISWorld Industry Report 42349: Laboratory Supply Wholesaling in the
US,” 2012.
[161] D. Smith, “Commercialization challenges associated with induced pluripotent stem
cell-based products,” Regenerative Medicine, vol. 5, no. 4, pp. 593–603, Jul. 2010.
[162] H. McCusker, “Stem Cell Research Tools, Services and Reagents,” Scimitar
Equity Blog, 2010. [Online]. Available:
http://www.scimitarequity.com/blog/2010/04/19/stem-cell-research-tools-servicesand-reagents/. [Accessed: 28-Apr-2013].
[163] S. Webb, “The gold rush for induced pluripotent stem cells,” Nature Biotechnology,
vol. 27, no. 11, pp. 977–9, Nov. 2009.
[164] “Guidance for Human Somatic Cell Therapy and Gene Therapy,” 1998.
[165] R. McKernan, J. McNeish, and D. Smith, “Pharma’s Developing Interest in Stem
Cells,” Cell Stem Cell, vol. 6, no. 6, pp. 517–20, Jun. 2010.
[166] M. Csete, “Translational prospects for human induced pluripotent stem cells,”
Regenerative Medicine, vol. 5, no. 4, pp. 509–19, Jul. 2010.
[167] M. Grskovic, A. Javaherian, B. Strulovici, and G. Q. Daley, “Induced pluripotent
stem cells--opportunities for disease modelling and drug discovery,” Nature
Reviews. Drug Discovery, vol. 10, no. 12, pp. 915–29, Dec. 2011.
148
[168] S. Webb, “Burgeoning stem cell product market lures major suppliers,” Nature
Biotechnology, vol. 28, no. 6, pp. 535–6, Jun. 2010.
[169] D. Lau, U. Ogbogu, B. Taylor, T. Stafinski, D. Menon, and T. Caulfield, “Stem Cell
Clinics Online: The Direct-to-Consumer Portrayal of Stem Cell Medicine,” Cell
Stem Cell, vol. 3, no. 6, pp. 591–4, Dec. 2008.
[170] D. Brindley and C. Mason, “Human embryonic stem cell therapy in the post-Geron
era,” Regenerative Medicine, vol. 7, no. 1, pp. 17–8, Jan. 2012.
[171] L. B. Giebel, “Stem cells - a hard sell to investors,” Nature Biotechnology, vol. 23,
no. 7, pp. 798–800, Jul. 2005.
[172] T. N. McAllister, N. Dusserre, M. Maruszewski, and N. L’heureux, “Cell-based
therapeutics from an economic perspective: primed for a commercial success or a
research sinkhole?,” Regenerative Medicine, vol. 3, no. 6, pp. 925–37, Nov. 2008.
[173] C. Mason, D. a Brindley, E. J. Culme-Seymour, and N. L. Davie, “Cell therapy
industry: billion dollar global business with unlimited potential,” Regenerative
Medicine, vol. 6, no. 3, pp. 265–72, May 2011.
[174] “Preclinical Assessment of Investigational Cellular and Gene Therapy Products,”
2012.
[175] J. P. Siegel, “Human Cells or Tissues Intended for Transplant into a Human
Recipient that Have Ex-vivo Contact with Live Non-human Animal Cells, Tissues
or Organs Letter,” 2002. [Online]. Available:
http://www.fda.gov/BiologicsBloodVaccines/SafetyAvailability/ucm136703.htm.
[Accessed: 28-Apr-2013].
[176] D. G. Halme and D. A. Kessler, “FDA Regulation of Stem-Cell-Based Therapies,”
The New England Journal of Medicine, vol. 255, no. 16, pp. 1730–1735, 2006.
[177] C. E. P. Goldring, P. a Duffy, N. Benvenisty, P. W. Andrews, U. Ben-David, R.
Eakins, N. French, N. a Hanley, L. Kelly, N. R. Kitteringham, J. Kurth, D.
Ladenheim, H. Laverty, J. McBlane, G. Narayanan, S. Patel, J. Reinhardt, A.
Rossi, M. Sharpe, and B. K. Park, “Assessing the Safety of Stem Cell
Therapeutics,” Cell Stem Cell, vol. 8, no. 6, pp. 618–28, Jun. 2011.
[178] U. Ben-David and N. Benvenisty, “The tumorigenicity of human embryonic and
induced pluripotent stem cells,” Nature Reviews Cancer, vol. 11, no. 4, pp. 268–
77, Apr. 2011.
[179] C. A. Sommer and G. Mostoslavsky, “The Evolving Field of Induced Pluripotency:
Recent Progress and Future Challenges,” Journal of Cellular Physiology, vol. 228,
no. 2, pp. 267–75, Feb. 2013.
149
[180] K. Okita, N. Nagata, and S. Yamanaka, “Immunogenicity of Induced Pluripotent
Stem Cells,” Circulation Research, vol. 109, no. 7, pp. 720–1, Sep. 2011.
[181] P. Guha, J. W. Morgan, G. Mostoslavsky, N. P. Rodrigues, and A. S. Boyd, “Lack
of Immune Response to Differentiated Cells Derived from Syngeneic Induced
Pluripotent Stem Cells,” Cell Stem Cell, vol. 12, no. 4, pp. 407–412, Jan. 2013.
[182] K. Sheridan, “Rush for patents is choking US stem cell research,” Agence FrancePresse, Washington, 25-Jan-2011.
[183] M. Lutticke, “Germany restricts stem cell patents,” 2012. [Online]. Available:
http://dw.de/p/16quR. [Accessed: 23-Apr-2013].
[184] B. P. Georgieva and J. M. Love, “Human induced pluripotent stem cells: a review
of the US patent landscape,” Regenerative Medicine, vol. 5, no. 4, pp. 581–91, Jul.
2010.
[185] K. T. Vrtovec and C. T. Scott, “Patenting pluripotence: the next battle for stem cell
intellectual property,” Nature Biotechnology, vol. 26, no. 4, pp. 393–5, Apr. 2008.
[186] G. Bahadur and M. Morrison, “Patenting human pluripotent cells: balancing
commercial, academic and ethical interests,” Human Reproduction, vol. 25, no. 1,
pp. 14–21, Jan. 2010.
[187] D. S. Couto, L. Perez-Breva, and C. L. Cooney, “Regenerative Medicine: Learning
from Past Examples,” Tissue Engineering: Part A, vol. 18, no. 21–22, pp. 2386–
93, Nov. 2012.
[188] STEMGEN, “Stem Cell World Map,” International Database on the Legal and
Socio-Ethical Issues in Stem Cell Research. [Online]. Available:
http://www.stemgen.org/stem-cell-world-map. [Accessed: 28-Apr-2013].
[189] A. D. Levine, “Policy Uncertainty and the Conduct of Stem Cell Research,” Cell
Stem Cell, vol. 8, no. 2, pp. 132–5, Feb. 2011.
[190] J. L. Furman, F. Murray, and S. Stern, “Growing Stem Cells: The Impact of
Federal Funding Policy on the U.S. Scientific Frontier,” Journal of Policy Analysis
and Management, vol. 31, no. 3, pp. 661–705, Jun. 2012.
[191] T. Caulfield, C. Rachul, and A. Zarzeczny, “The Evolution of Policy Issues in Stem
Cell Research: An International Survey,” Stem cell Reviews and Reports, vol. 8,
no. 4, pp. 1037–42, Dec. 2012.
[192] G. Q. Daley, “Stem cells : roadmap to the clinic,” The Journal of Clinical
Investigation, vol. 120, no. 1, pp. 8–10, 2010.
150
[193] T. Bubela, M. D. Li, M. Hafez, M. Bieber, and H. Atkins, “Is belief larger than fact:
expectations, optimism and reality for translational stem cell research,” BMC
Medicine, vol. 10, no. 1, p. 133, Jan. 2012.
[194] P. Krzyzanowski, “BioTime: A new Geron, without a decade of baggage,” Signals
Blog, 2013. [Online]. Available: http://www.signalsblog.ca/biotime-a-new-geronwithout-a-decade-of-baggage/. [Accessed: 26-Apr-2013].
151