Systemic acquired resistance (SAR)
Background on SAR
Molecular changes associated with SAR
Role of SA and other signaling molecules
Role of NPR1 (non-expresser of pathogenesis related genes 1)
Roles of TGA and WRKY transcription factors
Role of chromatin remodeling in SAR
What do we know about SAR?
Systemic acquired resistance
Baker et al. 1997. Science. 276:726
Systemic acquired resistance
Systemic acquired resistance was first recognized as a significant phenomenon in the early 1900s.
At that time, it was recognized that infection of plants with “necrotizing” pathogens (causing HR)
often results in enhanced resistance to subsequent infections by a variety of fungal, bacterial and
viral pathogens. This physiological immunity was termed systemic acquired resistance (SAR).
SAR confers a broad spectrum type of resistance
SAR is effective against some but not all pathogens:
Tobacco: Phytophthora parasitica, Cercospora nicotianae, Peronospora tabacina
Tobacco mosaic virus, Tobacco necrosis virus,
Pseudomonas syringae pv. tabaci, Erwinia carotovora
Not effective against: Botrytis cinerea or Alternaria alternata
Arabidopsis: Phytophthora parasitica
Turnip crinkle virus
Pseudomonas syringae pv. tomato DC3000
Some key events in understanding regulation of SAR
Systemic acquired resistance was associated with the coordinated induction of a set of SAR genes
encoding proteins known as Pathogenesis-related (PR) proteins (Van Loon and Gianinazzi (early 1970s).
(1979) White found that acetyl salicylic acid application sufficient to induce PR gene expression
and enhanced resistance to tobacco mosaic virus in tobacco plant. Discovery came out the
interest in developing chemical control methods for viral infection. After that several groups went
on to show that salicylic acid application on tobacco leaves mimics pathogen induced expression
of PR genes and pathogen resistance in treated tissues.
(1990) Two groups one led by Klessig and Raskin and another led by Metraux
found that salicylic acid accumulates in cucumber and tobacco plants prior to pathogen infection, but
before the onset of resistance.
The work by these and many others led to the hypothesis that salicylic acid (SA) is the endogenous
signal molecule that is required for the induction of systemic acquired resistance.
(1993/1994) The group headed by Ryals made tobacco plants that could not accumulate SA and found
that these plants were defective in their ability to develop systemic acquired resistance.
This work demonstrated a central role for SA in establishing systemic acquired resistance.
The group also demonstrated that these tobacco plants were defective in their ability to
accumulate PR proteins.
(1997) Cloning of NPR1, a key regulator of SAR
PR (Pathogenesis-Related) proteins
PR proteins first identified as major proteins induced by necrotizing pathogens
(pathogens that induced the hypersensitive response)
Proteins secreted predominantly into intercellular
spaces in response to wounding or infection.
Soluble at pH 3
Basic homologs also found (in vacuole).
Proteinase resistant (but not proteinase inhibitors).
Some are developmentally expressed as part of
normal plant development in absence of wound or
infection (e.g. flowering).
Acidic gel
PR proteins
Induced by many
other pathogens.
Some PR proteins
are also induced by
abiotic stresses.
old nomenclature
Proteins first isolated
from apoplast of
TMV-infected
tobacco.
All tobacco
PR proteins
Traditional Basic gel
PR protein gels
PR genes induced after HR or SA treatment
What do PR proteins do?
Sels et al. (2008) Plant Physiol. Biochem. 46:941-950
Also van Loon et al. (2006) Annu. Rev. Phytopathol. 44:135-162
Some are members of large gene families – e.g. PR-1
van Loon et al. (2006) Annu. Rev. Phytopathol. 44:135-162
Constitutive expression of chitinase PR protein confers
resistance to Rhizoctonia solani
Control
Line 373
230
238
329
373
548
18 days after growth in R. solani-laden sand
11 d.a.g. in R. solani sand
Brogue et al. (1991) Science 254, 1194-1196
Application of salicylic acid mimics SAR
(1979) White found that the application of aspirin, salicylic acid, and benzoic acid
resulted in enhanced resistance to TMV. Used 3 tobacco cultivars that contained
the N resistance gene that confers HR to TMV. Found > 90% reduction in lesion
number in treated leaves versus water control.
Lesions obtained after
second inoculation
SA
SA accumulation is associated with acquisition of resistance
Science (1993) 261, 754-756.
Central role of SA in SAR
PR-1 mRNA
PR-1
PR-2
PR-3
Central role for SA in defense continued
Enhanced susceptibility
Loss of resistance
INA induces resistance
in presence of nahG
Mobile inducers of SAR
Kachroo. 2013. Curr. Opin. Plant Biol. 16:527
What is the mobile systemic signal(s) for SAR?
Methylsalicylate – meSA
SABP2 (meSA esterase) is required for SAR
Park et al. Science 318:113-116
What is the mobile systemic signal(s) for SAR?
Methylsalicylate – meSA
SAMT1 (SA methyltransferase) is required for SAR
Park et al. Science 318:113-116
What is the mobile systemic signal(s) for SAR?
Methylsalicylate – meSA
meSA induces SAR in systemic tissues expressing SABP2 (MeSA esterase)
Park et al. Science 318:113-116
A role of glycerol-3-phosphate in SAR
Reduced SAR in gly1 and gli1 mutants
G3P levels increase in response to pathogen
in local and systemic tissues
Chanda et al. (2011) Nat. Genet. 43:421-427
A role of glycerol-3-phosphate in SAR
Exogenous G3P restores SAR in gli1 and gly1 plants
Chanda et al. (2011) Nat. Genet. 43:421-427
G3P conferred SAR is dependent on DIR1
DIR1 is a proposed lipid transporter protein
DIR1 is needed for G3P transport
Chanda et al. (2011) Nat. Genet. 43:421-427
Azeleic acid
Model for azeleic acid induced systemic acquired resistance
Yu et al. 2013. Cell Rep. 3:1266
Abietaine diterpenoid dehydroabietinal (DA)
Chaturvedi et al. 2012. Plant J. 71:161
Signaling steps between SA and PR protein expression
and disease resistance.
The Arabidopsis NPR1 Gene That Controls
Systemic Acquired Resistance Encodes
a Novel Protein Containing Ankyrin Repeats
Hui Cao, Jane Glazebrook, Joseph D. Clarke,
Sigrid Volko, and Xinnian Dong
(1997) Cell 88, 57–63,
Previously: Linked a PR protein promoter called BGL2 to GUS.
Screened thousands of mutant transgenic BGL2-GUS plants for
ABSENCE of GUS activity induced by SA treatment.
Using standard Arabidopsis genetic mapping methods, identified a
single mutant gene, npr1. Phenotype:
 Complete absence of GUS activity in response to SA
 Absence of PR-1, PR-5, BGL2 expression in response to SA
 Is now susceptible to Peronospora parasitica and to
Pseudomonas syringae pv maculicola (Psm).
Cao et al. (1997) Cell 88, 57–63,
genotype:
Cloned NPR1 by standard
1990’s methods.
Chromosome walking,
YAC library…
Proof of cloning by
transgenic complementation of
mutants w/ wildtype
NPR1.
transgene: none
GUS
symptoms
wt
Psm inoculated
wt
Cao et al. (1997) Cell 88, 57–63,
npr1-2
nonnone compl. NPR1
npr1-1
NPR1
npr1-1 + NPR1
NPR1 has ankyrin repeats
Ankyrin repeats are
in lots of different
proteins.
Involved in proteinprotein interactions.
Especially in proteins
that control transcription.
In NF-kB and I-kB in
mammals. Induced
by many pathogens,
stresses…
Cao et al. (1997) Cell 88, 57–63,
NPR1 is reduced to a monomer during plant defense
Mou et al., (2003) Cell, 113:935–944
Expression of PR-1 is associated with NPR1 monomerization
Mou et al., (2003) Cell, 113:935–944
Monomeric NPR1 localizes to the nucleus
Mou et al., (2003) Cell, 113:935–944
NPR1 interacts with TGA transcription factors in yeast two-hybrid assays
TGA transcription factors bind to TGACG sequences found in the promoter of genes
such as PR-1
Zhou et al. (2000) MPMI 13:191–202
NPR1 enhances TGA1 binding to the as-1 element under
reducing conditions
Despres et al. (2003) Plant Cell. 15:2181–2191,
WRKY transcription factors: another key group of transcription
factors that regulate plant defense responses
Recognize the motif: (T)(T)TGAC(C/T).
Have the conserved WRKYGQK at N-terminal end.
Have a novel zinc-finger-like motif.
Bind DNA via divalent cation (probably zinc).
Approx. 100 members of WRKY family in
Arabidopsis.
NPR1 has 3 WRKY motifs in its promoter:
TTGACTTGACTTGGCTCTGCTCGTCAA
The WRKY superfamily of plant transcription factors
Thomas Eulgem, Paul J. Rushton, Silke Robatzek and Imre E. Somssich
(2000) Trends Plant Sci 5, 199-205.
Conserved amino acids
in WRKY proteins of
Arabidopsis (red).
Putative Zn-finger ligands
are highlighted in black.
Eulgem et al. (2000) TIPS 5, 199-205.
Identification of direct transcriptional targets of NPR1
WRKY54, WRKY38, WRKY59, WRKY18, WRKY70, WRKY66, and WRKY53
are induced directly by NPR1.
Wang et al. (2006) PLoS Pathogens 2:1042-1050
Evidence that WRKY58 negatively regulates plant defense
Wang et al. (2006) PLoS Pathogens 2:1042-1050
WRKY70 and 54 negatively
regulate SA biosynthesis and
positively regulate SAR
Wang et al. (2006) PLoS Pathogens 2:1042-1050
Identification and Cloning of a Negative Regulator
of Systemic Acquired Resistance, SNI1,
through a Screen for Suppressors of npr1-1
Xin Li, Yuelin Zhang, Joseph D. Clarke, Yan Li,†
and Xinnian Dong*
Cell, 98, 329–339, 1999.
Screened for EMS mutants of npr1-1 plants containing BGL2-GUS
reporter.
Look for plants that turn blue in response to INA (SA analog)
like NPR1 wild type plants.
But which, of course still harbor the npr1-1 mutation.
Found 11 loci that gave increased GUS, out of 7000 plants screened.
Li et al., Cell 98, 329–339.
Li et al., Cell 98, 329–339.
Li et al., Cell 98, 329–339.
SNI1 is similar to mouse Retinoblastoma (Rb). Rb is a tumor suppressor
that represses function of E2F transcription factor
93-95% of genes upregulated in sni1 mutants are induced by BTH
Li et al., Cell 98, 329–339.
SNI1 represses transcription in yeast
sni1 mutation alters gene expression – most genes also induced by BTH
Mosher et al. (2006) Plant Cell, 18:1750–1765
Chromatin modifications at the PR-1 promoter in sni1 mutants
Mosher et al. (2006) Plant Cell, 18:1750–1765
Model for signal transduction in SAR
Fu. 2013. Annu. Rev. Plant Biol. 64:839