Ant-124 peptide synthesis
A previously described GRK2 inhibitor peptide, KRX‐124, [2] was partially modified in order
to improve intracellular localization, by adding an Antoennapoedia sequence to the N‐ terminus.
Antoennapoedia conjugated peptide was synthesized using the solid‐phase approach and standard
Fmoc
methods
in
a
manual
reaction
vessel
[3].
The
hybrids
Antoennapoedia‐KRX‐683124 (Ant‐124) peptide and a scramble peptide containing only the
Antennapoedia sequence (Ant) were synthesized by loading the synthesizer with the pre‐assembled
peptide‐ resin. Conjugates were cleaved from the resin by treatment with trifluoroacetic acid (TFA,
70%) and purified by preparative RP‐HPLC (Lichrospher® 100 C18, 10 μm) using different
acetonitrile gradients in aqueous 0.1 % TFA. The identity and purity was confirmed by high
performance liquid chromatography (HPLC) and MALDI‐TOF mass spectrometry. Stock solutions
of peptide hybrids were prepared in PBS buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4,
1.4 mM KH2PO4 pH 7.3) and the concentrations were determined by UV spectroscopy and
quantitative amino acid analysis.
Luciferase Assay
Cells were transfected with plasmid expression vectors containing the luciferase reporter gene
linked to 5 repeats of an NF-κB binding site (κB-Luc) or atrial natriuretic factor (ANF) promoter
and transfected with a plasmid encoding GRK2, GRK2-DN or GRK5. The empty plasmid was
used as control (CTRL). Transient transfection was performed using the Lipofectamine 2000
(Invitrogen, Milano-Italy) according to the manufacturer’s instruction. Cells were stimulated with
the alpha 1 adrenergic receptor agonist phenylephrine (PE, 10−7 M) for 24 hours. Lysates were
analyzed using the luciferase assay system with reporter lysis buffer from Promega (Promega Italia,
Milano-Italy) and measured by liquid scintillation. Luciferase activity was normalized against the
coexpressed β-galactosidase activity to overcome variations in transfection efficiency between
samples.
Kinase activity assay
The activity assays were performed as previously described [1,2]. To evaluate the effect of Ant-124
on GRK2 activity we assessed GRK2 purified proteins by light-dependent phosphorylation of
rhodopsin-enriched rod outer segment membranes (ROS) using [γ-32P]-ATP. Briefly, 50 ng of
active GRK2 were incubated with ROS membranes in presence of Ant-124 or Ant in a reaction
buffer containing 10 mM MgCl2, 20 mM Tris–Cl, 2 mM EDTA, 5 mM EGTA, and 0.1 mM ATP
and 10 μCi of [32P]γ-ATP. After incubation with white light for 15 min at room temperature, the
reaction was quenched with ice-cold lysis buffer and centrifuged for 15 min at 13000g. ROS pellet
was washed twice in ice-cold lysis buffer to remove the unbound [γ32P]-ATP and then resuspended
in 100 μL of buffer and the level of [γ32P]-ATP incorporation into ROS was determined by liquid
scintillation counter. To evaluate the ability of GRK2 to phosphorylate IB, we used purified
proteins of GRK2 (Invitrogen, Milano-Italy) and IB (Santa Cruz Biotecnology Heidelberg,
Germany). The reaction was electrophoresed and resolved on SDS-PAGE 4–12% gradient
(Invitrogen). Phosphorylated IB was visualized by autoradiography of dried gels.
In Vivo Study
Experiments were carried out in accordance with the guidelines of the “Federico II” University
Ethical committee on 12-week–old normotensive Wistar Kyoto (WKY n=20, subdivided as
follows: untreated n=8, PE+Ant n=6, PE+Ant-124 n=6) and spontaneously hypertensive (SHR
n=12, subdivided as follows: Ant n=6, Ant-124 n=6) male rats (Charles River, Calco, LC, Italy),
which had access to water and food ad libitum. The animals were anesthetized by vaporized
isoflurane (4%). After the induction of anesthesia, rats were orotracheally intubated, the inhaled
concentration of isoflurane was reduced to 1.8%, and lungs were mechanically ventilated (New
England Medical Instruments Scientific, Inc, Medway MA). The chest was opened under sterile
conditions through a right parasternal minithoracotomy to expose the heart. Then, we performed 4
injections (50 μL each) of Ant-124 (10-4M) or Ant as control, into the cardiac wall (anterior, lateral,
posterior, and apical). Injections were performed once a week for three weeks. Finally, the chest
wall was quickly closed in layers using 3-0 silk suture, and animals were observed and monitored
until recovery. In the WKY group, after cardiac injection we implanted subcutaneously a
miniosmotic pump (ALZET 2004) releasing PE (100 mg/kg). In an another set of experiments, we
used GRK2fl/fl mice in which hypertrophy was induced by PE release by means of miniosmotic
pumps and GRK2 knockdown was induced through the intramyocardial injection of an adenovirus
encoding for CRE recombinase (AdCRE, 109 pfu/ml, Vector Biolabs, Malvern PA USA). Non
coding adenovirus was injected in the cardiac wall of control mice. The intra-cardiac injection of
AdCre is needed to induce the downregulation of GRK2 mainly in the heart of GRK2fl/fl mice
through the cre-lox system. This technique allows to target most of the adenovirus to the heart if
compared with other way of drug administration, such as intraperitoneal injection or intra-venous
administration.
Echocardiography
Transthoracic echocardiography was performed at days 0, 7, 14, and 21 after surgery using a
dedicated small-animal high-resolution imaging system (VeVo 770, Visualsonics, Inc). Anesthesia
in rats and mice was induced by isoflurane (4%) inhalation and maintained by mask ventilation
(isoflurane 2%). The chest was shaved using a depilatory cream. LV end-diastolic and end-systolic
diameters (LVEDD and LVESD, respectively) were measured at the level of the papillary muscles
from the parasternal short-axis view as recommended. Intraventricular septal (IVS) and LV
posterior wall thickness (PW) were measured at end diastole. LV fractional shortening (LVFS) was
calculated as follows: LVFS= (LVEDD−LVESD)/LVEDD×100. LV ejection fraction (LVEF) was
calculated using a built-in software. LV mass (LVM) was calculated according to the M-mode
cubic method: LVM=1.05×[(IVS+LVEDD+LVPW)3−(LVEDD)3]; LVM was corrected by body
weight. All of the measurements were averaged on 5 consecutive cardiac cycles and analyzed by 2
experienced investigators blinded to treatment.
Immunoprecipitation and Western Blot
Cells were lysed in RIPA/SDS buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCL, 1% Nonidet P40, 0, 25% deoxycholate, 9,4 mg/50 ml sodium orthovanadate, 20% SDS]. Protein concentration
was determined by using BCA assay kit (Pierce). Endogenous IB or GRK2 from total extracts
were immunoprecipitated with specific antibodies (Santa Cruz) and protein A/G agarose (Santa
Cruz). After extensive washing, the immunocomplexes were electrophoresed by SDS/PAGE and
transferred to nitrocellulose; IB or GRK2 were visualized by specific antibody (Upstate), antirabbit HRP-conjugated secondary antibody (Santa Cruz) and standard chemiluminescence (Pierce).
Whole lysate was used as positive control. As negative control, the assay was performed using a
non specific antibody from the same species as the IP antibody.
For western blot analysis, the experiments were performed as described previously [3,4]. The
antibodies anti-IκBα, actin, and GRK2 were from Santa Cruz Biotechnology, Inc. Blots from 3
independent experiments were quantified and corrected for appropriate loading control.
Densitometric analysis was performed using Image Quant software (Molecular Dynamics, Inc).
Results are reported as mean±SEM.
Electrophoretic Mobility-Shift Assay
Nuclear proteins were isolated from heart samples, and NF-κB binding activity was examined by
electrophoretic mobility-shift assay, as described previously [3,5]. For the competition assay
nuclear extracts were incubated with a 50-fold excess of unlabeled oligos for 20 minutes before
adding the labeled oligo. Electrophoretic mobility-shift assay for organic cation transporter 1 (OCT1) binding was performed as a loading control (5′tgtcgaatgcaaatcctctcctt3′).
Isolation of ventricular cardiomyocytes and Real Time PCR
Adult mouse ventricular myocytes were isolated from GRK2fl/fl mice hearts by a standard
enzymatic digestion procedure as previously described [6]. Total RNA was isolated and cDNA was
synthesized by reverse transcription. Real-time quantitative PCR was performed with the SYBR
Green real-time PCR master mix kit (Applied Biosystems-Life Technologies Italia, Monza-Italy)
and quantified by built-in SYBR Green Analysis (Applied Biosystem) on a StepOne instrument
(Applied Biosystem). Primers sequences are previously described [4].
References
1. Carotenuto, A., Cipolletta, E., Gomez-Monterrey, I., Sala, M., Vernieri, E., Limatola, A., et al.
(2013). Design, synthesis and efficacy of novel G protein-coupled receptor kinase 2
inhibitors. [Research Support, Non-U.S. Gov't]. Eur J Med Chem, 69, 384-392,
doi:10.1016/j.ejmech.2013.08.039.
2. Cipolletta, E., Campanile, A., Santulli, G., Sanzari, E., Leosco, D., Campiglia, P., et al. (2009).
The G protein coupled receptor kinase 2 plays an essential role in beta-adrenergic receptorinduced insulin resistance. [Research Support, Non-U.S. Gov't]. Cardiovasc Res, 84(3), 407415, doi:10.1093/cvr/cvp252.
3. Sorriento, D., Ciccarelli, M., Santulli, G., Campanile, A., Altobelli, G. G., Cimini, V., et al.
(2008). The G-protein-coupled receptor kinase 5 inhibits NFkappaB transcriptional activity
by inducing nuclear accumulation of IkappaB alpha. Proc Natl Acad Sci U S A, 105(46),
17818-17823, doi:0804446105 [pii] 10.1073/pnas.0804446105.
4. Sorriento, D., Santulli, G., Fusco, A., Anastasio, A., Trimarco, B., & Iaccarino, G. (2010).
Intracardiac injection of AdGRK5-NT reduces left ventricular hypertrophy by inhibiting
NF-kappaB-dependent hypertrophic gene expression. [Research Support, Non-U.S. Gov't].
Hypertension, 56(4), 696-704, doi:10.1161/HYPERTENSIONAHA.110.155960.
5. Sorriento, D., Campanile, A., Santulli, G., Leggiero, E., Pastore, L., Trimarco, B., et al. (2009). A
new synthetic protein, TAT-RH, inhibits tumor growth through the regulation of NFkappaB
activity. Mol Cancer, 8, 97, doi:10.1186/1476-4598-8-97.
6. Ciccarelli, M., Chuprun, J. K., Rengo, G., Gao, E., Wei, Z., Peroutka, R. J., et al. (2011). G
protein-coupled receptor kinase 2 activity impairs cardiac glucose uptake and promotes
insulin resistance after myocardial ischemia. [Research Support, N.I.H., Extramural
Research Support, Non-U.S. Gov't]. Circulation, 123(18), 1953-1962,
doi:10.1161/CIRCULATIONAHA.110.988642.